Literature DB >> 7031603

Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

V E Brennan, L A Bobek, J A Bruenn.   

Abstract

ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

Entities:  

Mesh：

Substances：

Year:  1981        PMID： 7031603      PMCID： PMC327498          DOI： 10.1093/nar/9.19.5049

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN： 0305-1048            Impact factor:   16.971


  26 in total

1.  Preparative two-dimensional polyacrylamide gel electrophoresis of 32 P-labeled RNA.

Authors:  R de Wachter; W Fiers
Journal:  Anal Biochem       Date:  1972-09       Impact factor: 3.365

2.  Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose.

Authors:  P S Thomas
Journal:  Proc Natl Acad Sci U S A       Date:  1980-09       Impact factor: 11.205

3.  Isolation of Suppressive Sensitive Mutants from Killer and Neutral Strains of SACCHAROMYCES CEREVISIAE.

Authors:  J M Somers
Journal:  Genetics       Date:  1973-08       Impact factor: 4.562

4.  Nucleotide sequences at the 5'-termini of the alfalfa mosaic virus RNAs and the intercistronic junction in RNA 3.

Authors:  E C Koper-Zwarthoff; F T Brederode; G Veeneman; J H van Boom; J F Bol
Journal:  Nucleic Acids Res       Date:  1980-12-11       Impact factor: 16.971

5.  Yeast killer toxin: purification and characterisation of the protein toxin from Saccharomyces cerevisiae.

Authors:  R G Palfree; H Bussey
Journal:  Eur J Biochem       Date:  1979-02-01

6.  Nucleotide sequence of the putative recognition site for coat protein in the RNAs of alfalfa mosaic virus and tobacco streak virus.

Authors:  E C Koper-Zwarthoff; J F Bol
Journal:  Nucleic Acids Res       Date:  1980-08-11       Impact factor: 16.971

7.  Translational analysis of the killer-associated virus-like particle dsRNA genome of S. cerevisiae: M dsRNA encodes toxin.

Authors:  K A Bostian; J E Hopper; D T Rogers; D J Tipper
Journal:  Cell       Date:  1980-02       Impact factor: 41.582

8.  Electron microscopic heteroduplex analysis of "killer" double-stranded RNA species from yeast.

Authors:  H M Fried; G R Fink
Journal:  Proc Natl Acad Sci U S A       Date:  1978-09       Impact factor: 11.205

9.  Virion DNA-independent RNA polymerase from Saccharomyces cerevisiae.

Authors:  J D Welsh; M J Leibowitz; R B Wickner
Journal:  Nucleic Acids Res       Date:  1980-06-11       Impact factor: 16.971

10.  Plasmids controlled exclusion of the K2 killer double-stranded RNA plasmid of yeast.

Authors:  R B Wickner
Journal:  Cell       Date:  1980-08       Impact factor: 41.582
View more
  9 in total

1.  A very small viral double-stranded RNA.

Authors:  T H Chang; N Banerjee; J Bruenn; W Held; T Peery; Y Koltin
Journal:  Virus Genes       Date:  1989-03       Impact factor: 2.332

2.  Conservative replication and transcription of Saccharomyces cerevisiae viral double-stranded RNA in vitro.

Authors:  M E Nemeroff; J A Bruenn
Journal:  J Virol       Date:  1986-03       Impact factor: 5.103

3.  Three different M1 RNA-containing viruslike particle types in Saccharomyces cerevisiae: in vitro M1 double-stranded RNA synthesis.

Authors:  R Esteban; R B Wickner
Journal:  Mol Cell Biol       Date:  1986-05       Impact factor: 4.272

4.  RNA polymerase activity in virions from Ustilago maydis.

Authors:  B S Ben-Tzvi; Y Koltin; M Mevarech; A Tamarkin
Journal:  Mol Cell Biol       Date:  1984-01       Impact factor: 4.272

Review 5.  Double-stranded ribonucleic acid killer systems in yeasts.

Authors:  D J Tipper; K A Bostian
Journal:  Microbiol Rev       Date:  1984-06

6.  Two Ustilago maydis viral dsRNAs of different size code for the same product.

Authors:  L J Field; J A Bruenn; T H Chang; O Pinhasi; Y Koltin
Journal:  Nucleic Acids Res       Date:  1983-05-11       Impact factor: 16.971

7.  Overlapping genes in a yeast double-stranded RNA virus.

Authors:  M E Diamond; J J Dowhanick; M E Nemeroff; D F Pietras; C L Tu; J A Bruenn
Journal:  J Virol       Date:  1989-09       Impact factor: 5.103

8.  Yeast killer dsRNA plasmids are transcribed in vivo to produce full and partial-length plus-stranded RNAs.

Authors:  K A Bostian; V E Burn; S Jayachandran; D J Tipper
Journal:  Nucleic Acids Res       Date:  1983-02-25       Impact factor: 16.971

9.  Structural and functional analysis of separated strands of killer double-stranded RNA of yeast.

Authors:  D J Thiele; M J Leibowitz
Journal:  Nucleic Acids Res       Date:  1982-11-11       Impact factor: 16.971
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.