Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome.

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.