| Literature DB >> 36267581 |
Fabricia de Arruda Roque1, Juxing Chen2, Raquel B Araujo2, André Luis Murcio1,2,3, Brunna Garcia de Souza Leite1, Mylena Tückmantel Dias Tanaka1, Carlos Alexandre Granghelli1, Paulo Henrique Pelissari1, Rachel Santos Bueno Carvalho1, David Torres2, Mercedes Vázquez-Añón2, Deana Hancock2, Cristiane Soares da Silva Araujo1, Lúcio Francelino Araujo1.
Abstract
Trace mineral minerals Zn, Cu, and Mn play important roles in breeder production and progeny performance. The objective of this study was to determine maternal supplementation of trace mineral minerals on breeder production and progeny growth and development. A total of 540 broiler breeders, Cobb 500 (Slow feathering; 0-66 weeks old) were assigned to one of three treatment groups with the same basal diet and three different supplemental trace minerals: ITM-inorganic trace minerals in sulfates: 100, 16, and 100 ppm of Zn, Cu, and Mn respectively; MMHAC -mineral methionine hydroxy analog chelate: 50, 8, and 50 ppm of bis-chelated MINTREX®Zn, Cu and Mn (Novus International, Inc.), and TMAAC - trace minerals amino acid complex: 50, 8, and 50 ppm of Zn, Cu, and Mn. At 28 weeks of age, eggs from breeder treatments were hatched for progeny trial, 10 pens with 6 males and 6 female birds per pen were fed a common diet with ITM for 45 days. Breeder production, egg quality, progeny growth performance, mRNA expression of gut health associated genes in breeder and progeny chicks were measured. Data were analyzed by one-way ANOVA; means were separated by Fisher's protected LSD test. A p-Value ≤ 0.05 was considered statistically different and 0.1 was considered numerical trend. Breeders on ITM treatment had higher (p < 0.05) body weight (BW), weight gain and lower (p < 0.05) feed conversion ratio (FCR) from 0 to 10 weeks, when compared to birds fed MMHAC. MMHAC significantly improved egg mass by 3 g (p < 0.05) and FCR by 34 points (0.05 < p < 0.1) throughout the reproductive period (26-66 weeks) in comparison to ITM. MMHAC improved (p < 0.01) egg yolk color versus (vs.) ITM and TMAAC in all periods, except 28 weeks, increased (p < 0.01) eggshell thickness and resistance vs. TMAAC at 58 weeks, and reduced (p < 0.05) jejunal NF-κB gene expression vs. TMAAC at 24 weeks. There was a significant reduction in tibial dry matter weight, Seedor index and resistance for the breeders that received MMHAC and/or TMAAC when compared to ITM at 18 weeks. Lower seedor index but numerically wider tibial circumference was seen in hens fed MMHAC at 24 weeks, and wider tibial circumference but lower tibial resistance in hens fed TMAAC at 66 weeks. Maternal supplementation of MMHAC in breeder hens increased (p < 0.0001) BW vs. ITM and TMAAC at hatching, reduced (p < 0.05) feed intake vs. ITM at d14 and d28, and improved (p < 0.01) FCR and performance index vs. TMAAC at d28, reduced (p < 0.01) NF-κB gene expression and increased (p < 0.05) A20 gene expression vs. TMAAC on d0 and vs. ITM on d14, reduced (p < 0.05) TLR2 gene expression vs. ITM on d0 and vs. TMAAC on d14, increased (p < 0.05) MUC2 gene expression vs. both ITM and TMAAC on d45 in progeny jejunum. Overall, these results suggest that supplementation with lower levels of MHA-chelated trace minerals improved breeder production and egg quality and reduced breeder jejunal inflammation while maintaining tibial development in comparison to those receiving higher inorganic mineral supplementation, and it also carried over the benefits to progeny with better growth performance, less jejunal inflammation and better innate immune response and gut barrier function in comparison to ITM and/or TMAAC.Entities:
Keywords: bone quality; breeder reproduction; chelated trace minerals; egg quality; gut health; intestinal inflammation; maternal supplementation; progeny
Year: 2022 PMID: 36267581 PMCID: PMC9577897 DOI: 10.3389/fphys.2022.948378
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Composition of the basal diet for all stages of development.
| Ingredients (g/kg) | Starter | Grower | Pre-reproduction | Reproduction I | Reproduction II | Reproduction III |
|---|---|---|---|---|---|---|
| Corn, 8.8%CP | 58.680 | 59.320 | 64.740 | 70.940 | 70.880 | 70.640 |
| Soybean meal., 45% CP | 28.380 | 14.250 | 17.760 | 19.340 | 19.000 | 19.020 |
| Soybean oil | 3.210 | |||||
| Wheat bran | 5.000 | 21.860 | 10.840 | |||
| Premix* | 2.000 | 2.000 | 2.000 | 2.000 | 2.000 | 2.000 |
| Dicalcium phosphate | 1.810 | 1.430 | 1.750 | 1.760 | 1.550 | 1.390 |
| Limestone | 0.190 | 0.530 | 2.510 | 2.630 | 2.960 | 3.150 |
| Salt | 0.410 | 0.370 | 0.270 | 0.260 | 0.270 | 0.270 |
| Sodium bicarbonate | 0.150 | 0.150 | 0.150 | |||
| MHA-methionine | 0.190 | 0.120 | 0.110 | 0.150 | 0.120 | 0.120 |
| L-Lysine HCl. 78% | 0.110 | 0.060 | 0.030 | 0.010 | 0.010 | |
| L-Threonine. 98% | 0.020 | 0.060 | 0.020 | 0.010 | ||
| Zinc bacitracin. 15% | 0.100 | 0.100 | 0.100 | |||
| Total | 100.0 | 100.0 | 100.0 | 100.0 | 100.0 | 100.0 |
| Calculated composition, % | ||||||
| AME | 2950 | 2763 | 2820 | 2820 | 2800 | 2780 |
| Crude protein | 19.000 | 15.360 | 15.500 | 15.000 | 14.500 | 14.000 |
| Lysine disp | 0.920 | 0.640 | 0.630 | 0.660 | 0.630 | 0.630 |
| AAS disp | 0.690 | 0.540 | 0.540 | 0.570 | 0.542 | 0.542 |
| Methionine disp | 0.490 | 0.290 | 0.280 | 0.310 | 0.380 | 0.380 |
| Threonine disp | 0.640 | 0.520 | 0.520 | 0.500 | 0.473 | 0.473 |
| Isoleucine | 0.720 | 0.510 | 0.520 | 0.500 | 0.549 | 0.549 |
| Leucine | 1.510 | 0.820 | 0.820 | 0.740 | 0.730 | 1.297 |
| Tryptophane | 0.210 | 0.150 | 0.160 | 0.170 | 0.157 | 0.157 |
| Valine | 0.770 | 0.470 | 0.490 | 0.530 | 0.504 | 0.504 |
| Calcium | 1.000 | 1.000 | 1.500 | 2.900 | 3.100 | 3.200 |
| Phosphorus disp | 0.450 | 0.400 | 0.440 | 0.420 | 0.380 | 0.350 |
| Phosphorus total | 0.790 | 0.800 | 0.670 | 0.610 | 0.670 | 0.670 |
| Chlorine | 0.280 | 0.260 | 0.200 | 0.190 | 0.196 | 0.196 |
| Potassium | 0.740 | 0.630 | 0.640 | 0.640 | 0.563 | 0.563 |
| Sodium | 0.200 | 0.180 | 0.180 | 0.180 | 0.180 | 0.180 |
| Ac. linoleic | 3.130 | 1.570 | 1.720 | 1.500 | 1.492 | 1.630 |
*Vitamin levels supplied in the feed through the premixes (considering inclusion of 20 kg/Ton): Vitamin A, 12000000 IU; Vitamin D3, 3,000,000 IU; Vitamin E, 75,000 IU; Vitamin K, 6,000 mg/ton; Thiamine, 2500 mg/ton; Riboflavin, 10,000 mg/ton; Pantothenic acid, 25,000 mg/ton; Niacin, 40,000 mg/ton; Pyridoxine, 6,000 mg/ton; Folic acid, 4,000 mg/ton; Vitamin B12, 35 mg/ton; Biotin, 300 mg/tone; Vitamin C, 50,000 mg/ton; Choline, 300,000 mg/ton.
Limestone. 50% small particle size/50% Large particle size.
MHA (84% methionine. 12% Ca. PB, 49.3%. EM, 4.014 kcal/kg).
Apparent Metabolic Energy.
Disp: Disponible.
Concentrations of zinc (Zn) Copper (Cu) and Manganese (Mg) in mineral premix at inclusion 20 kg/MT.
| Analyzed | Formulated | ||||||
|---|---|---|---|---|---|---|---|
| ITM | MMHAC | TMAAC | ITM | MMHAC | TMAAC | ||
| Zn | mg/kg | 4516 | 2829 | 2614 | 5000 | 2500 | 2500 |
| Cu | mg/kg | 779 | 451 | 474 | 800 | 400 | 400 |
| Mn | mg/kg | 5702 | 2735 | 2703 | 5000 | 2500 | 2500 |
Value based on duplicate determinations; ITM—inorganic trace minerals in sulfates: 100, 16, and 100 ppm of Zn, Cu, and Mn respectively; MMHAC-mineral methionine hydroxy analog chelate: 50, 8, 50 ppm of bis-chelated MINTREX®Zn, Cu, and Mn (Novus International, Inc.), and TMAAC—trace minerals amino acid complex: 50, 8, and 50 ppm of Zn, Cu, and Mn.
Composition of the basal diet for all stages of development of progeny broiler.
| Ingredients (g/kg) | Starter (1–14 days) | Grower (15–28 days) | Finisher (29–45 days) |
|---|---|---|---|
| Corn 8.8% CP | 61.911 | 68.546 | 69.857 |
| Soybean meal 45% CP | 33.410 | 27.200 | 25.420 |
| Soybean oil | 0.947 | 0.874 | 1.384 |
| Premix* | 0.500 | 0.500 | 0.500 |
| Dicalcium phosphate | 1.169 | 0.972 | 0.990 |
| Limestone | 0.952 | 0.857 | 0.861 |
| Salt | 0.281 | 0.268 | 0.249 |
| Sodium bicarbonate | 0.201 | 0.186 | 0.177 |
| MHA-Methionine | 0.306 | 0.265 | 0.248 |
| L-Lysine HCl. 78% | 0.223 | 0.249 | 0.238 |
| L-Threonine. 98% | 0.042 | 0.025 | 0.018 |
| Salinomycin 12% | 0.055 | 0.055 | 0.055 |
| Phytaverse | 0.003 | 0.003 | 0.003 |
| Total | 100.0 | 100.0 | 100.0 |
| Calculated composition % | |||
| AME | 2965 | 3050 | 3100 |
| Crude protein | 19.000 | 15.360 | 17.793 |
| Lysine disp | 0.920 | 0.640 | 0.630 |
| AAS disp | 0.690 | 0.540 | 0.540 |
| Methionine disp | 0.490 | 0.290 | 0.280 |
| Threonine disp | 0.640 | 0.520 | 0.520 |
| Isoleucine | 0.720 | 0.510 | 0.520 |
| Leucine | 1.510 | 0.820 | 0.820 |
| Tryptophane | 0.210 | 0.150 | 0.160 |
| Valine | 0.770 | 0.470 | 0.490 |
| Calcium | 1.000 | 1.000 | 1.500 |
| Phosphorus disp | 0.450 | 0.400 | 0.440 |
| Phosphorus Total | 0.790 | 0.800 | 0.670 |
| Chlorine | 0.280 | 0.260 | 0.200 |
| Potassium | 0.740 | 0.630 | 0.640 |
| Sodium | 0.200 | 0.180 | 0.180 |
| Ac. Linoleic | 3.130 | 1.570 | 1.720 |
*Vitamin levels supplied in the feed through the premixes (considering inclusion of 5 kg/Ton): Vitamin A, 2016.0 IU; Vitamin D3, 630.0 IU/g; Vitamin E, 10000.1 IU; Vitamin K, 630 mg/Ton; Thiamine, 756 mg/kg; Riboflavin, 1,512 mg/kg; Pantothenic acid, 2,520 mg/kg; Niacin, 10,080 mg/kg; Pyridoxine, 816 mg/kg; Folic acid, 189 mg/kg; Vitamin B12, 4536.1 mcg/kg; Selenium, 70 mg/kg Iodine, 200 mg/kg; Iron 8,000 mg/kg; Choline, 80 g/tkg.
Limestone. 100% small particle size.
MHA (84% methionine. 12% Ca. PB 49.3%. EM 4.014 kcal/kg).
Apparent Metabolic Energy.
Disp, disponible.
The sequence of primers for qRT-PCR.
| Gene | Forward primer sequence (5′–3′) | Reverse primer sequence (5′–3′) | Accession number | Fragment legnth (bp) |
|---|---|---|---|---|
| β-actin | CAACACAGTGCTGTCTGGTGGTA | ATCGTACTCCTGCTTGCTGATCC | L08165 | 205 |
| IL6 | GAGGGCCGTTCGCTATTTG | ATTGTGCCCGAACTAAAACATTC | AJ309540 | 63 |
| A20 | AGGCTCCTCCTGTGGTAAAGC | GAAAAGGCTGGGAGCAGTTG | XM_003640919.2 | 99 |
| NF-κB | GTGTGAAGAAACGGGAACTG | GGCACGGTTGTCATAGATGG | NM_205129 | 202 |
| MUC2 | GCCTGCCCAGGAAATCAAG | CGACAAGTTTGCTGGCACAT | BX930545 | 59 |
| IL-1β | CAGCCCGTGGGCATCA | CTTAGCTTGTAGGTGGCGATGTT | NM_204524 | 58 |
| TLR2 | CGCTTAGGAGAGACAATCTGTGAA | GCCTGTTTTAGGGATTTCAGAGAATTT | NM_001161650.3 | 90 |
IL6, interleukin 6; A20, alpha-induced protein 3; NF-kB, nuclear factor kappa B; MUC2, mucin-2, protein; IL-1β, interleukin-1β; TLR2, toll like receptor 2.
Effect of inorganic or organic trace minerals on the performance of broiler breeders.
| Trace mineral source | BW, kg | DBWG, g | DFI, g | FCR |
|---|---|---|---|---|
| 0–4 weeks | ||||
| ITM | 0.555 | 18.134 | 33.699 | 1.851 |
| MMHAC | 0.554 | 18.098 | 33.724 | 1.865 |
| TMAAC | 0.554 | 18.085 | 33.693 | 1.856 |
| SEM | 0.009 | 0.084 | 0.060 | 0.051 |
| | 0.8860 | 0.9172 | 0.9291 | 0.7518 |
| 0–10 weeks | ||||
| ITM | 1.178 | 16.151 | 43.779 | 2.545 |
| MMHAC | 1.150 | 15.761 | 43.787 | 2.608 |
| TMAAC | 1.161 | 15.909 | 43.777 | 2.596 |
| SEM | 0.024 | 0.090 | 0.024 | 0.065 |
| | 0.0130 | 0.0132 | 0.9521 | 0.0372 |
| 0–18 weeks | ||||
| ITM | 1.973 | 15.279 | 54.100 | 3.340 |
| MMHAC | 1.970 | 15.257 | 54.104 | 3.354 |
| TMAAC | 1.970 | 15.258 | 54.099 | 3.346 |
| SEM | 0.047 | 0.113 | 0.013 | 0.080 |
| | 0.9868 | 0.9883 | 0.9653 | 0.9258 |
| 0–24 weeks | ||||
| ITM | 3.100 | 18.173 | 68.032 | 3.543 |
| MMHAC | 3.060 | 17.928 | 68.037 | 3.601 |
| TMAAC | 3.095 | 18.145 | 68.032 | 3.567 |
| SEM | 0.076 | 0.141 | 0.010 | 0.082 |
| | 0.4214 | 0.4122 | 0.9309 | 0.3987 |
Means within a column without a common superscript differ (p ≤ 0.05).
ITM, inorganic trace minerals: 100, 16, and 100 ppm of Zn, Cu, and Mn respectively, as sulfates; MMHAC-mineral methionine hydroxy analog chelate: 50, 8, 50 ppm of bis-chelated MINTREX®Zn, Cu, and Mn (Novus International, Inc.), and TMAAC—trace minerals amino acid complex: 50, 8, and 50 ppm of Zn, Cu, and Mn.
Body weight (BW), daily body weight gain (DBWG), daily feed intake (DFI) and feed conversion (FCR).
Effect of feeding supplemental inorganic or organic trace minerals on the performance of broiler breeders (26–66 weeks).
| Trace mineral source | Egg production, % | Egg mass, g | FCR per egg mass | Egg number | |
|---|---|---|---|---|---|
| 26–66 weeks | |||||
| ITM | 63.9 | 41.9 | 3.96 | 169.14 | |
| MMHAC | 67.9 | 44.9 | 3.62 | 180.03 | |
| TMAAC | 66.2 | 44.0 | 3.76 | 175.58 | |
| SEM | 1.6 | 1.2 | 0.14 | 4.35 | |
|
| Treatment | 0.2036 | 0.0262 | 0.0987 | 0.2100 |
Means within a column without a common superscript differ (p ≤ 0.05).
ITM, inorganic trace minerals: 100, 16, and 100 ppm of Zn, Cu, and Mn respectively, as sulfates; MMHAC-mineral methionine hydroxy analog chelate: 50, 8, 50 ppm of bis-chelated MINTREX®Zn, Cu, and Mn (Novus International, Inc.), and TMAAC—trace minerals amino acid complex: 50, 8, and 50 ppm of Zn, Cu, and Mn.
Effect of inorganic or organic trace minerals on egg quality parameters of broiler breeders.
| Trace mineral source | Weight (g) | Yolk coloration | Resistance (kgf) | Eggshell thickness (mm) |
|---|---|---|---|---|
| Week 28 | ||||
| ITM | 57.178 | 8.617 | 4.103 | 0.393 |
| MMHAC | 57.944 | 8.523 | 3.974 | 0.383 |
| TMAAC | 58.152 | 8.52 | 4.093 | 0.379 |
| SEM | 0.455 | 0.080 | 0.080 | 0.003 |
| | 0.2916 | 0.6191 | 0.4498 | 0.0196 |
| Week 40 | ||||
| ITM | 66.708 | 6.550 | 4.058 | 0.398 |
| MMHAC | 67.404 | 6.922 | 3.85 | 0.398 |
| TMAAC | 67.484 | 6.598 | 3.784 | 0.39 |
| SEM | 0.528 | 0.080 | 0.102 | 0.004 |
| | 0.5225 | 0.0036 | 0.1535 | 0.3271 |
| Week 50 | ||||
| ITM | 68.028 | 5.905 | 3.767 | 0.369 |
| MMHAC | 69.058 | 6.182 | 3.764 | 0.375 |
| TMAAC | 70.178 | 6.000 | 3.520 | 0.377 |
| SEM | 0.819 | 0.061 | 0.089 | 0.005 |
| | 0.1835 | 0.0082 | 0.0913 | 0.5045 |
| Week 58 | ||||
| ITM | 70.707 | 6.595 | 3.594 | 0.398 |
| MMHAC | 72.372 | 7.161 | 3.593 | 0.394 |
| TMAAC | 73.005 | 6.479 | 3.030 | 0.372 |
| SEM | 0.915 | 0.074 | 0.123 | 0.005 |
| | 0.2044 | < 0.0001 | 0.0027 | 0.0020 |
| Week 65 | ||||
| ITM | 72.146 | 7.991 | 3.293 | 0.379 |
| MMHAC | 73.604 | 8.331 | 3.512 | 0.374 |
| TMAAC | 73.155 | 7.548 | 3.408 | 0.375 |
| SEM | 0.738 | 0.088 | 0.120 | 0.005 |
| | 0.3674 | < 0.0001 | 0.4357 | 0.7839 |
Means within a column without a common superscript differ (p ≤ 0.05).
ITM—inorganic trace minerals: 100, 16, and 100 ppm of Zn, Cu, and Mn respectively, as sulfates; MMHAC-mineral methionine hydroxy analog chelate: 50, 8, 50 ppm of bis-chelated MINTREX®Zn, Cu, and Mn (Novus International, Inc.), and TMAAC—trace minerals amino acid complex: 50, 8, and 50 ppm of Zn, Cu, and Mn.
FIGURE 1Effect of inorganic or organic trace minerals on jejunal NFκB gene expression in broiler breeders at 24 weeks of age. ab Means without a common superscript differ (p ≤ 0.05). ITM—inorganic trace minerals: 100, 16, and 100 ppm of Zn, Cu, and Mn respectively, as sulfates; MMHAC-mineral methionine hydroxy analog chelate: 50, 8, 50 ppm of bis-chelated MINTREX–Zn, Cu, and Mn (Novus International, Inc.), and TMAAC—trace minerals amino acid complex: 50, 8, and 50 ppm of Zn, Cu, and Mn.
Effect of feeding supplemental inorganic or organic trace minerals on bone quality.
| Trace mineral source | WW, % | DW, % | DM, % | LGTH, cm | Seedor Índex | CIR, mm | R, kg/N |
|---|---|---|---|---|---|---|---|
| 18 weeks | |||||||
| ITM | 16.22 | 10.65 | 65.79 | 12.56 | 8.48 | 7.87 | 7.28 |
| MMHAC | 15.59 | 9.54 | 61.49 | 12.50 | 7.64 | 7.87 | 4.86 |
| TMAAC | 15.98 | 10.04 | 62.79 | 12.60 | 7.96 | 8.11 | 5.54 |
| SEM | 0.35 | 0.22 | 1.02 | 0.12 | 0.14 | 0.09 | 0.38 |
| | 0.4534 | 0.0034 | 0.0146 | 0.8550 | 0.0006 | 0.1177 | <0.0001 |
| 24 weeks | |||||||
| ITM | 19.86 | 12.56 | 63.24 | 12.63 | 9.94 | 8.17 | 12.94 |
| MMHAC | 19.67 | 11.99 | 61.17 | 12.73 | 9.41 | 8.41 | 11.73 |
| TMAAC | 19.79 | 12.50 | 63.36 | 12.63 | 9.97 | 8.18 | 13.62 |
| SEM | 0.46 | 0.24 | 0.85 | 0.09 | 0.17 | 0.08 | 0.72 |
| | 0.9580 | 0.2000 | 0.1315 | 0.6363 | 0.0399 | 0.0920 | 0.1797 |
| 66 weeks | |||||||
| ITM | 26.92 | 16.39 | 60.93 | 12.56 | 12.96 | 8.34 | 11.20 |
| MMHAC | 26.71 | 16.83 | 63.14 | 12.35 | 13.45 | 8.10 | 9.19 |
| TMAAC | 26.36 | 16.07 | 61.03 | 12.55 | 12.82 | 8.81 | 8.79 |
| SEM | 0.53 | 0.37 | 0.94 | 0.12 | 0.29 | 0.09 | 0.59 |
| | 0.7600 | 0.3500 | 0.1800 | 0.3572 | 0.2408 | <0.0001 | 0.0133 |
Means within a column without a common superscript differ (p ≤ 0.05).
ITM, inorganic trace minerals: 100, 16, and 100 ppm of Zn, Cu and Mn respectively, as sulfates; MMHAC-mineral methionine hydroxy analog chelate: 50, 8, 50 ppm of bis-chelated MINTREX®Zn, Cu, and Mn (Novus International, Inc.), and TMAAC—trace minerals amino acid complex: 50, 8, and 50 ppm of Zn, Cu, and Mn.
Wet weight (WW), dry weight (DW), dry matter (DM), length (LGTH), circumference (CIR) and resistance (R).
Effect of inorganic or organic trace minerals on the performance of progeny.
| Trace mineral source | BW, g | BWG, g | DBWG, g | FI, g | FCR | PEI |
|---|---|---|---|---|---|---|
| At hatch (day 1) | ||||||
| ITM | 42.000 | |||||
| MMHAC | 43.860 | |||||
| TMAAC | 42.940 | |||||
| SEM | 0.070 | |||||
| | <0.0001 | |||||
| 0–14 days | ||||||
| ITM | 408.929 | 366.929 | 26.209 | 536.250 | 1.401 | 181.072 |
| MMHAC | 390.231 | 346.374 | 24.741 | 488.651 | 1.435 | 170.482 |
| TMAAC | 398.507 | 355.564 | 25.397 | 483.291 | 1.385 | 175.413 |
| SEM | 13.406 | 13.387 | 0.956 | 13.989 | 0.023 | 9.738 |
| | 0.6188 | 0.5604 | 0.5604 | 0.0231 | 0.2854 | 0.7460 |
| 0–28 days | ||||||
| ITM | 1269.470 | 1227.470 | 43.838 | 1926.667 | 1.541 | 279.697 |
| MMHAC | 1215.125 | 1171.268 | 41.831 | 1726.170 | 1.484 | 277.041 |
| TMAAC | 1181.795 | 1138.852 | 40.673 | 1832.942 | 1.612 | 239.674 |
| SEM | 30.721 | 30.703 | 1.097 | 43.803 | 0.028 | 11.056 |
| | 0.1450 | 0.1380 | 0.1380 | 0.0118 | 0.0051 | 0.0262 |
| 0–45 days | ||||||
| ITM | 2853.488 | 2811.488 | 62.478 | 4877.947 | 1.728 | 357.521 |
| MMHAC | 2807.759 | 2763.902 | 61.42 | 4615.985 | 1.695 | 352.832 |
| TMAAC | 2767.417 | 2724.474 | 60.544 | 4678.027 | 1.720 | 334.144 |
| SEM | 43.901 | 43.891 | 0.975 | 79.013 | 0.021 | 8.420 |
| | 0.3947 | 0.3862 | 0.3862 | 0.0665 | 0.5047 | 0.1351 |
Means within a column without a common superscript differ (p ≤ 0.05).
ITM, inorganic trace minerals: 100, 16, and 100 ppm of Zn, Cu and Mn respectively, as sulfates; MMHAC-mineral methionine hydroxy analog chelate: 50, 8, 50 ppm of bis-chelated MINTREX®Zn, Cu, and Mn (Novus International, Inc.), and TMAAC—trace minerals amino acid complex: 50, 8, and 50 ppm of Zn, Cu, and Mn.
Body weight (BW), body weight gain (BWG), daily body weight gain (DBWG), feed intake (FI), feed conversion ratio (FCR) and Performance index (PEI).
FIGURE 2Effect of inorganic or organic trace minerals on jejunal anti-inflammatory gene expression in progeny broilers at 1-, 14-, and 45-days of age. ab Means without a common superscript differ (p ≤ 0.05). ITM—inorganic trace minerals: 100, 16, and 100 ppm of Zn, Cu and Mn respectively, as sulfates; MMHAC-mineral methionine hydroxy analog chelate: 50, 8, 50 ppm of bis-chelated MINTREX®Zn, Cu, and Mn (Novus International, Inc.), and TMAAC—trace minerals amino acid complex: 50, 8, and 50 ppm of Zn, Cu, and Mn.