| Literature DB >> 36267412 |
Zhiwei Zhu1, Jie Wang1, Xiaoxue Fan1, Qi Long1, Huazhi Chen1, Yaping Ye1, Kaiyao Zhang1, Zhongmin Ren1, Yang Zhang1, Qingsheng Niu2, Dafu Chen1,3, Rui Guo1,3.
Abstract
Nosema ceranae is a widespread fungal parasite for honey bees, causing bee nosemosis. Based on deep sequencing and bioinformatics, identification of circular RNAs (circRNAs) in Apis cerana workers' midguts and circRNA-regulated immune response of host to N. ceranae invasion were conducted in this current work, followed by molecular verification of back-splicing sites and expression trends of circRNAs. Here, 10185 and 7405 circRNAs were identified in the midguts of workers at 7 days (AcT1) and 10 days (AcT2) post inoculation days post-inoculation with N. ceranae. PCR amplification result verified the back-splicing sites within three specific circRNAs (novel_circ_005123, novel_circ_007177, and novel_circ_015140) expressed in N. ceranae-inoculated midgut. In combination with transcriptome data from corresponding un-inoculated midguts (AcCK1 and AcCK2), 2266 circRNAs were found to be shared by the aforementioned four groups, whereas the numbers of specific ones were 2618, 1917, 5691, and 3723 respectively. Further, 83 52) differentially expressed circRNAs (DEcircRNAs) were identified in AcCK1 vs. AcT1 (AcCK2 vs. AcT2) comparison group. Source genes of DEcircRNAs in workers' midgut at seven dpi were involved in two cellular immune-related pathways such as endocytosis and ubiquitin mediated proteolysis. Additionally, competing endogenous RNA (ceRNA) network analysis showed that 23 13) DEcircRNAs in AcCK1 vs. AcT1 (AcCK2 vs. AcT2) comparison group could target 18 14) miRNAs and further link to 1111 (1093) mRNAs. These target mRNAs were annotated to six cellular immunity pathways including endocytosis, lysosome, phagosome, ubiquitin mediated proteolysis, metabolism of xenobiotics by cytochrome P450, and insect hormone biosynthesis. Moreover, 284 164) internal ribosome entry site and 54 26) ORFs were identified from DEcircRNAs in AcCK1 vs. AcT1 (AcCK2 vs. AcT2) comparison group; additionally, ORFs in DEcircRNAs in midgut at seven dpi with N. ceranae were associated with several cellular immune pathways including endocytosis and ubiquitin-mediated proteolysis. Ultimately, RT-qPCR results showed that the expression trends of six DEcircRNAs were consistent with those in transcriptome data. These results demonstrated that N. ceranae altered the expression pattern of circRNAs in A. c. cerana workers' midguts, and DEcircRNAs were likely to regulate host cellular and humoral immune response to microsporidian infection. Our findings lay a foundation for clarifying the mechanism underlying host immune response to N. ceranae infection and provide a new insight into interaction between Asian honey bee and microsporidian.Entities:
Keywords: Apis cerana cerana; Nosema ceranae; circular RNA; host-pathogen interaction; immune response; non-coding RNA
Year: 2022 PMID: 36267412 PMCID: PMC9577369 DOI: 10.3389/fgene.2022.1013239
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Primers for RT-PCR and RT-qPCR conducted in this work.
| Forward primer | Sequence (5′-3′) | Reverse primer | Sequence (5′-3′) | Purpose |
|---|---|---|---|---|
| novel_circ_005123-F | AGTGGAGGATTGCTGGGTAG | novel_circ_005123-R | GCTTTGACAGTCGTATTCGG | RT-PCR |
| novel_circ_007177-F | GCAAGCAAAGCATCGTTAC | novel_circ_007177-R | AATACTGCCAGGTTCTCACAG | RT-PCR |
| novel_circ_015140-F | CCTTCAATGTCTCCCTCTGTC | novel_circ_015140-R | TGGCACTACGACCAAATCC | RT-PCR |
| novel_circ_016536-F | ATCTCCTACTTCGCACTGGG | novel_circ_016536-R | ATCGTATCACTTCCCTCGC | RT-PCR |
| novel_circ_010689-F | GCTCTCGTTTACCTCTTCAGA | novel_circ_010689-R | CGCTATCTTCTCCACTATTTGG | RT-qPCR |
| novel_circ_005734-F | GGAGGCTATCCGAGATGAT | novel_circ_005734-R | CTTCGTTGGTGGTGACTTC | RT-qPCR |
| novel_circ_016924-F | TCGGGACGGTAGCAGTAAT | novel_circ_016924-R | CAGTGGTATCCTCGTGTCGT | RT-qPCR |
| novel_circ_017693-F | CACTGTCGTGGTAGCCAAA | novel_circ_017693-R | GGGAAGAACCTGGAACATC | RT-qPCR |
| novel_circ_008642-F | TACGGGACAGCGAGAAGTT | novel_circ_008642-R | CGTGTATCCAATCATCACCG | RT-qPCR |
| novel_circ_005927-F | AGTTGCCGTAAATGGTGTC | novel_circ_005927-R | CGACTCGGTTCTTCCAAAT | RT-qPCR |
|
| GGTTGTTGATAGTGGAGATGG |
| CACGACCAGCAATAGGAAT | RT-qPCR |
FIGURE 1Number, type, and length distribution of circRNAs in the midguts of A. c. cerana workers inoculated with N. ceranae. (A) Venn diagram of circRNAs in AcCK1, AcCK2, AcT1, and AcT2 groups. (B) Number statistics of circRNAs derived from various genomic origins. (C) Length distribution of circRNAs.
FIGURE 2PCR amplification (A) and Sanger sequencing (B) of three A. c. cerana circRNAs. Black arrows indicate the direction of primers for PCR amplification, and green arrows indicate back-splicing sites within circRNAs.
FIGURE 3Number statistics of DEcircRNAs in AcCK1 vs. AcT1 and AcCK2 vs. AcT2 comparison groups. (A) Number of up- and down-regulated circRNAs (B) Venn analysis of DEcircRNAs.
FIGURE 4GO categorization of DEcircRNAs’ source genes in AcCK1 vs AcT1 (A) and AcCK2 vs AcT2 (B) comparison groups.
KEGG pathways enriched by source genes of DEcircRNAs in AcCK1 vs AcT1 comparison group.
| Pathway | Ko number | Number of source gene | Gene id |
|---|---|---|---|
| Spliceosome | ko03040 | 2 | 107997744, 108004399 |
| Endocytosis | ko04144 | 2 | 107993574, 108001896 |
| Mucin type O-glycan biosynthesis | ko00512 | 1 | 108003572 |
| Tyrosine metabolism | ko00350 | 1 | 107994400 |
| Other glycan degradation | ko00511 | 1 | 108001667 |
| ECM-receptor interaction | ko04512 | 1 | 107997219 |
| Insulin resistance | ko04931 | 1 | 107999877 |
| FoxO signaling pathway | ko04068 | 1 | 107999607 |
| Hippo signaling pathway-fly | ko04391 | 1 | 107995510 |
| Ribosome biogenesis in eukaryotes | ko03008 | 1 | 107995090 |
| Ubiquitin mediated proteolysis | ko04120 | 1 | 108001789 |
| RNA transport | ko03013 | 1 | 107998561 |
KEGG pathways enriched by source genes of DEcircRNAs in AcCK2 vs. AcT2 comparison group.
| Pathway | Ko number | Number of source gene | Source gene id |
|---|---|---|---|
| Sphingolipid metabolism | ko00600 | 1 | 107995902 |
| ECM-receptor interaction | ko04512 | 1 | 107998342 |
| mTOR signaling pathway | ko04150 | 1 | 107997811 |
| Insulin resistance | ko04931 | 1 | 107999331 |
| Neuroactive ligand-receptor interaction | ko04080 | 1 | 107993584 |
FIGURE 5DEcircRNA-miRNA network engaged in N. ceranae-response of A. c. cerana workers. (A) Regulatory network in AcCK1 vs AcT1 comparison group (B) Regulatory network in AcCK2 vs AcT2 comparison group.
Summary of cellular immune pathways enriched by DEcircRNA-targeted mRNAs within ceRNA networks.
| Pathway | Number of target mRNA in AcCK1 vs AcT1 | Number of target mRNA in AcCK2 vs AcT2 | Ko number |
|---|---|---|---|
| Endocytosis | 28 | 28 | ko04144 |
| Lysosome | 4 | 4 | ko04142 |
| Phagosome | 3 | 3 | ko04145 |
| Ubiquitin mediated proteolysis | 2 | 2 | ko04120 |
| Metabolism of xenobiotics by cytochrome P450 | 1 | 1 | ko00980 |
| Insect hormone biosynthesis | 1 | 2 | ko00981 |
FIGURE 6RT-qPCR verification of DEcircRNAs.Student’s t test, “*” indicates p ≤ 0.05 and “**” indicates p ≤ 0.01.
FIGURE 7A working model of DEcircRNA-regulated response of A. c. cerana workers to N. ceranae infection.