| Literature DB >> 36263116 |
María José Contreras-Gómez1,2,3, José R W Martinez2,3, Lina Rivas2,3, Roberto Riquelme-Neira2,3,4, Juan A Ugalde3,5, Aniela Wozniak3,6,7, Patricia García3,6,7, José M Munita2,3, Jorge Olivares-Pacheco1,3, Manuel Alcalde-Rico1,2,3.
Abstract
Carbapenem-resistant Pseudomonas aeruginosa (CRPA) is one of the pathogens that urgently needs new drugs and new alternatives for its control. The primary strategy to combat this bacterium is combining treatments of beta-lactam with a beta-lactamase inhibitor. The most used combinations against P. aeruginosa are ceftazidime/avibactam (CZA) and ceftolozane/tazobactam (C/T). Although mechanisms leading to CZA and C/T resistance have already been described, among which are the resistance-nodulation-division (RND) efflux pumps, the role that these extrusion systems may play in CZA, and C/T baseline susceptibility of clinical isolates remains unknown. For this purpose, 161 isolates of non-carbapenemase-producing (Non-CP) CRPA were selected, and susceptibility tests to CZA and C/T were performed in the presence and absence of the RND efflux pumps inhibitor, Phenylalanine-arginine β-naphthylamide (PAβN). In the absence of PAβN, C/T showed markedly higher activity against Non-CP-CRPA isolates than observed for CZA. These results were even more evident in isolates classified as extremely-drug resistant (XDR) or with difficult-to-treat resistance (DTR), where CZA decreased its activity up to 55.2% and 20.0%, respectively, whereas C/T did it up to 82.8% (XDR), and 73.3% (DTR). The presence of PAβN showed an increase in both CZA (37.6%) and C/T (44.6%) activity, and 25.5% of Non-CP-CRPA isolates increased their susceptibility to these two combined antibiotics. However, statistical analysis showed that only the C/T susceptibility of Non-CP-CRPA isolates was significantly increased. Although the contribution of RND activity to CZA and C/T baseline susceptibility was generally low (two-fold decrease of minimal inhibitory concentrations [MIC]), a more evident contribution was observed in a non-minor proportion of the Non-CP-CRPA isolates affected by PAβN [CZA: 25.4% (15/59); C/T: 30% (21/70)]. These isolates presented significantly higher MIC values for C/T. Therefore, we conclude that RND efflux pumps are participating in the phenomenon of baseline susceptibility to CZA and, even more, to C/T. However, the genomic diversity of clinical isolates is so great that deeper analyzes are necessary to determine which elements are directly involved in this phenomenon.Entities:
Keywords: RND efflux pump; baseline susceptibility; carbapenem resistant Pseudomonas aeruginosa; cefotolozane/tazobactam; ceftazidime/avibactam
Year: 2022 PMID: 36263116 PMCID: PMC9574371 DOI: 10.3389/fphar.2022.1007162
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
Conditions and sequence of the primers used in the Multiplex PCR for molecular detection of the carbapenemase genes bla VIM, bla KPC, bla NDM, bla SPM, or bla IMP.
| PCR reaction | Carbapenemase gene | Sequence (5′→3′) | Product size (bp) | Annealing temperature | References |
|---|---|---|---|---|---|
| Multiplex 1 |
| CGTCTAGTTCTGCTGTCTTG | 798 | 55°C |
|
| CTTGTCATCCTTGTTAGGCG | |||||
|
| GGTGTTTGGTCGCATATCGC | 504 |
| ||
| CCATTCAGCCAGATCGGCATC | |||||
|
| GGAATAGAGTGGCTTAAYTCTC | 188 |
| ||
| CCAAACYACTASGTTATCT | |||||
| Multiplex 2 |
| GGTTTGGCGATCTGGTTTTC | 452 | 63°C |
|
| CGGTGATATTGTCACTGGTGTGG | |||||
|
| AAAATCTGGGTACGCAAACG | 271 |
| ||
| ACATTATCCGCTGGAACAGG |
CZA and C/T susceptibility profile among Non-CP-CRPA clinical isolates with different multi-drug resistance phenotypes.
| No isolates (%) | MIC CZA (µg/ml) | MIC C/T (µg/ml) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| MIC50 | MIC90 | S (%) | R (%) | MIC50 | MIC90 | S (%) | I (%) | R (%) | ||
| Non-MDR | 53 (32.9) | 4 | 8 | 49 (92.5) | 4 (7.5) | 1 | 1 | 52 (98.1) | 1 (1.9) | 0 (0.0) |
| MDR | 49 (30.5) | 8 | 16 | 37 (75.5) | 12 (24.5) | 1 | 4 | 45 (91.8) | 3 (6.1) | 1 (2.0) |
| XDR | 29 (18) | 8 | 64 | 16 (55.2) | 13 (44.8) | 2 | 32 | 24 (82.8) | 1 (3.4) | 4 (13.8) |
| DTR | 30 (18.6) | 16 | 32 | 6 (20.0) | 24 (80.0) | 2 | 32 | 22 (73.3) | 4 (13.3) | 4 (13.3) |
| Total | 161 (100) | 8 | 32 | 108 (67.1) | 53 (32.9) | 1 | 8 | 143 (88.8) | 9 (5.6) | 9 (5.6) |
MIC: minimum inhibitory concentration; CZA: ceftazidime/avibactam; C/T: ceftolozane/tazobactam; S: susceptible; I: intermediate; R: resistant; Non-MDR: non multi-drug resistant; MDR: multi-drug resistant; XDR: extremely drug resistant; DTR: difficult-to-treat resistance.
FIGURE 1MIC distribution of CZA and C/T among different multi-drug resistance phenotypes in Non-CP-CRPA clinical isolates. Non-CP-CRPA isolates (Total) were classified as Non-MDR, MDR, XDR, and DTR. The distribution of (A) CZA and (B) C/T MIC values among these groups are represented in the graphic. Green, yellow and red colors indicate MIC values considered by CLSI as “susceptible”, “intermediate”, and “resistant”, respectively. It is observed that acquisition of each more multi-drug resistance phenotype is strongly associated with the increase of (A) CZA and (B) C/T MIC values, in particular for CZA.
FIGURE 2Correlation between MIC values of CZA and C/T in Non-CP-CRPA clinical isolates. Combinations of CZA and C/T MIC values for each one of the Non-CP-CRPA isolates were quantified and represented in a matrix (A). MIC values were grouped as S (susceptible), I (intermediate), and R (resistant) according to the breakpoint of CZA and C/T established by CLSI (2020). (B) The correlation analysis (Spearman’s rank correlation test) showed that the MIC distribution of CZA and C/T presented a significant positive correlation (Spearman r: 0.7215; p < 0.0001). However, most of the isolates (95.7%) had lower C/T MIC values than those obtained for CZA, indicating that C/T presented a higher activity than CZA overall Non-CP-CRPA isolates. Furthermore, most CZA-resistant isolates remained susceptible to C/T, but most C/T-resistant isolates also showed a CZA-resistant phenotype.
FIGURE 3Role of RND efflux systems on “baseline susceptibility” to CZA and C/T in Non-CP-CRPA clinical isolates. Non-CP-CRPA isolates were classified as “Non-RND”, “RND 2x”, and “RND ≥4x” according to the increase in the levels of CZA or C/T susceptibility in the presence of the efflux pump inhibitor, PAβN. The isolates with equal or higher MIC values in the presence of PAβN were named “Non-RND”, and no contribution of the RND efflux systems in CZA or C/T susceptibility was considered. The isolates whose MIC values decreased two-fold or more than two-fold in the presence of PAβN were named “RND 2x” or “RND ≥4x”, respectively, and a role of the RND efflux systems in CZA or C/T susceptibility was considered. Panel (A) shows the proportion of the Non-CP-CRPA isolates with the different combinations of overlapped RND contribution to CZA and/or C/T susceptibility. Panel (B) shows the CZA and C/T MIC distribution among the individual isolates classified as “Non-RND”, “RND 2x”, and “RND ≥4x”. The results showed that (A) 37.6% (n = 59), 44.6% (n = 70), and 25.5% (n = 40) of Non-CP-CRPA analyzed (n = 157) were considered as “RND” (sum of “RND 2x” and “RND ≥4x”) for CZA, C/T, or both, respectively. The CZA and C/T MIC distribution among “Non-RND”, “RND 2x” and “RND ≥4x” isolates showed a significant increase of C/T MIC values in “RND ≥4x”, evidencing that RND may contribute to a high level of C/T resistance.