| Literature DB >> 36249808 |
Yunyun Quan1, Zhujun Yin2, Shilong Chen2, Jirui Lang1, Liyang Han1, Jing Yi2, Lu Zhang2, Qianhua Yue2, Weiwei Tian2, Ping Chen2, Shenglin Du2, Jianbo Wang2, Ying Dai2, Hua Hua2, Jin Zeng2, Li Li2, Junning Zhao1.
Abstract
The main objective of this study was to investigate the alterations in the gut microbiota (GM) of pulmonary fibrosis (PF) mice induced by bleomycin (BLM) with its underlying mechanisms. BLM was docked with the targets of TGF-β/SMAD and caspase-3 pathways using the molecular docking technique. HE staining and Masson staining were applied to observe the histopathological changes in the pulmonary tissues. Detection of the apoptotic signals was conducted by flow cytometry and TUNEL staining. The mRNA expression of targets involved in the TGF-β/SMAD and caspase-3 signaling pathways in lungs was determined by qPCR. Immunohistochemistry (IHC) assay was used to detect the expression levels of cleaved caspase-3 and BAX proteins in mice lung tissues. 16S rDNA sequencing analysis was used to investigate the changes of GM in the fecal samples of mice in each group. The results showed that the apoptosis rate of pulmonary cells in the BLM group distinctly increased, with the expression levels of crucial target pro-apoptotic gene caspase-3, BAX with the corresponding protein, cleaved caspase-3, BAX were apparently elevated. This was accompanied by a significant increase in pro-fibrotic targets level such as TGF-β, fibronectin, collagen I, and collagen III. The mechanisms of PF induced by BLM were related to apoptosis of lung tissue cells such as alveolar epithelial cells and destroyed alveolar structure and excessive production of extracellular matrix (ECM), which may be bound up with activating TGF-β/SMAD and caspase-3 pathways. As for the GM, it was found that, after BLM induced PF in mice, the micro ecological balance of the GM was destroyed; the distance of PCo1 and Pco2 was significantly elongated, and the relative abundance of some intestinal probiotics like Catenibacterium and Lactobacillus (L. johnsonii and L. gasseri) dramatically lowered while the relative abundance of Verrucomicrobiales and Enterobacteriales substantially increased. Therefore, GM changes associated with PF in mouse models induced by BLM and the concept of "gut-lung axis" might provide an optional therapeutic strategy for PF.Entities:
Keywords: bleomycin; gut microbiota; gut-lung axis; pulmonary fibrosis; signaling pathway
Year: 2022 PMID: 36249808 PMCID: PMC9561135 DOI: 10.3389/fphar.2022.985223
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
FIGURE 1Experimental outline and 3D view of compound with targets. (A) Chemical structure of BLM. (B) Description of the experimental design. (C) Experimental process. (D) 3D view of compound BLM. (E) The main targets in related signaling pathways. (F) The “lock and key principle” of molecular docking.
Szapiel score for alveolitis and PF.
| Staining | Lung pathology | Severity | Description | Score |
|---|---|---|---|---|
| HE | Alveolitis | None | No alveolitis |
|
| Mild | Monocyte infiltration leads to thickening of alveolar septum, only limited to localized pleural lesions accounting for less than 20% of the lung, and the alveolar structure is well preserved. |
| ||
| Moderate | A more extensive alveolitis involving 20%–50% of the lung but still predominantly pleura. |
| ||
| Severe | Diffuse alveolitis, involving more than 50% of the lung, occasionally, consolidation of air spaces by the alveolar monocytes and some areas of hemorrhage in the interstitium and/or alveolus. |
| ||
| Masson | Lung fibrosis | None | No evidence of fibrosis |
|
| Mild | Less than 20% of the lung is involved in localized fibrosis. Fibrosis involves the pleura and the interstitium of the subpleural parenchyma, and alveolar structure is distorted to some extent. |
| ||
| Moderate | Widespread fibrosis involves 20%–50% of the lung and for fibrotic areas, most of which extend inward from the pleura and remain focal. |
| ||
| Severe | Wide range of fibrosis involves more than 50% of the lung. Fusion lesion with extensive disorder of parenchyma structure, including cystic spaces arranged by cuboidal epithelium. |
|
Primers used for qPCR in this study.
| Gene | NCBI gene ID | Direction | Primer sequence (5′-3′) | Product length (bp) | Annealing temperature (°C) |
|---|---|---|---|---|---|
|
| 14433 | Forward | GGTTGTCTCCTGCGACTTCA | 183 | 60 |
| Reverse | TGGTCCAGGGTTTCTTACTCC | ||||
|
| 12367 | Forward | CTCGCTCTGGTACGGATGTG | 201 | 60 |
| Reverse | TCCCATAAATGACCCCTTCATCA | ||||
|
| 12370 | Forward | TGCTTGGACTACATCCCACAC | 171 | 60 |
| Reverse | GTTGCAGTCTAGGAAGTTGACC | ||||
|
| 12371 | Forward | AGCCAGAGGTTCTCAGACCAG | 103 | 60 |
| Reverse | ATATCTGCATGTCCCCTGATCT | ||||
|
| 12043 | Forward | GCTACCGTCGTGACTTCGC | 147 | 60 |
| Reverse | CCCCACCGAACTCAAAGAAGG | ||||
|
| 12028 | Forward | AGACAGGGGCCTTTTTGCTAC | 137 | 60 |
| Reverse | AATTCGCCGGAGACACTCG | ||||
|
| 12842 | Forward | TAAGGGTCCCCAATGGTGAGA | 203 | 60 |
| Reverse | GGGTCCCTCGACTCCTACAT | ||||
|
| 12825 | Forward | CTGTAACATGGAAACTGGGGAAA | 144 | 60 |
| Reverse | CCATAGCTGAACTGAAAACCACC | ||||
|
| 11475 | Forward | CCCAGACATCAGGGAGTAATGG | 104 | 60 |
| Reverse | TCTATCGGATACTTCAGCGTCA | ||||
|
| 14268 | Forward | ATGTGGACCCCTCCTGATAGT | 124 | 60 |
| Reverse | GCCCAGTGATTTCAGCAAAGG | ||||
|
| 22352 | Forward | TCCACACGCACCTACAGTCT | 100 | 60 |
| Reverse | CCGAGGACCGGGTCACATA | ||||
|
| 12550 | Forward | CAGTTCCGAGGTCTACACCTT | 131 | 60 |
| Reverse | TGAATCGGGAGTCTTCCGAAAA | ||||
|
| 17126 | Forward | AAGCCATCACCACTCAGAATTG | 100 | 60 |
| Reverse | CACTGATCTACCGTATTTGCTGT | ||||
|
| 17127 | Forward | CATTCCATTCCCGAGAACACTAA | 126 | 60 |
| Reverse | GCTGTGGTTCATCTGGTGGT | ||||
|
| 11461 | Forward | CCAGATCCTGTCCAAACTAAGG | 169 | 60 |
| Reverse | CTCTTTAGCATAGTAGTCCGCT |
Primers used for GM sequencing analysis in this study.
| Name | Primer sequence |
|---|---|
| 515F | 5′-GTGYCAGCMGCCGCGGTAA-3′ |
| 806R | 5′-GGACTACHVGGGTWTCTAAT-3′ |
FIGURE 2The affinity of BLM binding to each target and the interactions within the complex.
FIGURE 3Visual analysis for BLM-BCL2 complex of molecular docking.
FIGURE 4Effect of BLM on lungs, percent survival, body weight and lung coefficient of mice and the pathological section analysis of HE and Masson staining. (A) Active state of mice. (B) The lung tissues of mice. (C) Percent survival. (D) Body weight changes. (E) Lung coefficient changes. (F) HE staining with magnification times (×200). (G) Masson staining with magnification times (×200). ***p < 0.001 vs. normal and sham group. “ns” indicates not significant.
FIGURE 9Apoptosis analysis by flow cytometry and GM sequencing analysis. (A) Apoptosis analysis by flow cytometry. (B) Cluster heatmap analysis of high abundance at species level. (C) Rank abundance curve. (D) Rarefaction curve. (E) Community distance analysis. (F) Distance of PCo1 and PCo2. (G) Community function prediction. *p < 0.05, ***p < 0.001 vs normal and sham group. “ns” indicates not significant.
FIGURE 5The mRNA expression level of targets in caspase-3 and TGF-β/SMAD pathways. ***p < 0.001 vs. normal and sham group. “ns” indicates not significant.
FIGURE 6TUNEL assay of mice lung tissues (×630). DAPI (blue), TMR(red).
FIGURE 7The effect of BLM on the expression of pro-apoptotic key proteins in lung tissue of mice and the quantitative results of TUNEL apoptosis assay. (A) IHC schematic diagram. (B) IHC staining of cleaved caspase-3 in lung tissue (×400). (C) IHC staining of BAX in lung tissue (×400). (D) Examples of color deconvolution analysis. (E) Quantitative results of cleaved caspase-3 in lung tissue. (F) Quantitative results of BAX in lung tissue. (G) Quantitative results of TUNEL apoptosis in lung tissue. ***p < 0.001 vs. normal and sham group. “ns” indicates not significant.
FIGURE 8Community composition and difference analysis of GM. (A) Bar plot of relative abundance at order level. (B) Sankey plot of relative abundance at phylum, family, and genus level. (C) Quantitative analysis of representative community. *p < 0.05, **p < 0.01, ***p < 0.001 vs normal and sham group. “ns” indicates not significant.
FIGURE 10The potential molecular mechanisms of BLM on PF and the influence on GM. (A) The potential molecular mechanisms of BLM on PF in caspase-3 apoptosis signaling pathway and TGF-β/SMAD fibrosis signaling pathway. (B) The potential influence on GM of BLM.