| Literature DB >> 36249796 |
Reshmi Akter1, Jong Chan Ahn1, Jinnatun Nahar1, Muhammad Awais1, Zelika Mega Ramadhania1, Se-Woung Oh2, Ji-Hyung Oh3, Byoung Man Kong4, Esrat Jahan Rupa1, Dong Wong Lee5, Deok Chun Yang1, Se Chan Kang1.
Abstract
Phenolics are phytochemicals in plants, fruits, and vegetables have potential health-promoting efficacies. However, mostly available as a complex form. So, to increase the contents and nutritional value of the phenolic compounds, fermentation is most readily used in the food industry. Especially, the hydrolyzable tannins present in the pomegranate that can be liberated into monomolecular substances, which enhances biological activity. Thus, this study aims to convert hydrolyzable tannins to ellagic acid by fermentation using Tannin acyl hydrolase (TAH) and a novel bacteria strain Lactobacillus vespulae DCY75, respectively to investigate its effect on Estrogen receptor alpha (ERα) and estrogen receptor beta (ERβ) mRNA expression along with inflammation inhibition. As a result, the fermentation enhanced the ellagic acid content up to 70% by the synergetic effect of TAH and DCY75. Furthermore, fermented pomegranate (PG-F) increased cellular proliferation as well as upregulated the gene expression of estrogen regulators such as ERα, ERβ, and pS2 in breast cancer cell line (MCF-7), which commonly used to evaluate estrogenic activity. Moreover, to study the inflammation associated with low estrogen in menopause, we have analyzed the inhibition of nitric oxide (NO)/inducible nitric oxide synthase (iNOS) in RAW 264.7 cells. The PG-F juice did not exert any cytotoxicity in RAW 264.7 cells and inhibited NO production along with the downregulation of a major pro-inflammatory cytokine iNOS which indicates the anti-inflammatory potential of it. To sum it up, the fermented commercial pomegranate juice using a novel bacteria strain increased the amount of ellagic acid that the value added bioactive of pomegranate and it has significantly increased the estrogenic activity via upregulating estrogen related biomarkers expression and reduced the risk of related inflammation via NO/iNOS inhibition. This study could be a preliminary study to use fermented pomegranate as a potential health functional food after further evaluation.Entities:
Keywords: Lactobacillus vespulae; fermentation; inflammation; menopause; pomegranate
Year: 2022 PMID: 36249796 PMCID: PMC9558905 DOI: 10.3389/fphar.2022.1010103
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
The conditions of the HPLC system for analyzing phenolic acids.
| System/Condition | Phenolic acids (gallic acid and ellagic acid) |
|---|---|
| Flow rate | 1.0 ml/min |
| Wavelength | 260 nm |
| Injection Volume | 5 µl |
| Solvents | Gradient eluent: A: Methanol B: 0.1% acetic acid in water |
| Column Temperature | 35°C |
The list of primers used for the RT-PCR.
| Genes | Forward primers | Reverse primers |
|---|---|---|
| ERα | CCGCTCATGATCAAACGCTCTAAG | GCCCTCTACACATTTTCCCTGGTT (Farabegoli, Barbi et al., 2007) |
| pS2 | ATGGCCACCATGGAGAACAA | ATAGAAGCACCAGGGGACCC (Farabegoli, Barbi et al., 2007) |
| ERβ iNOS | TTCCCAGCAATGTCACTAACT T ACCCAAGGTCTACGTTCAGG | TTGAGGTTCCGCATACAGA ( |
| GAPDH | AATGGGCAGCCGTTAGGAAA | GCGCCCAATACGACCAAA (Castro-Aceituno, Ahn et al., 2016) |
FIGURE 1Optimization of Tannase treatment. (A) Condition of enzyme percentage (B) incubation time (C) HPLC analysis for Tannase treatment.
FIGURE 2Total amount of ellagic acid in Pomegranate (fermented and unfermented).
Total phenolic and total flavonoid contents.
| Pomegranate | TPC | TFC |
|---|---|---|
| PG-Control | mg GAE/g FW | mg RE/g FW |
| 0.31 ± 0.01 | 0.11 ± 0.04 | |
| PG-F | 0.45 ± 0.01 | 0.18 ± 0.02 |
Potential antioxidant activities of Pomegranate.
| Pomegranate |
| ||||||
|---|---|---|---|---|---|---|---|
| DPPH | Reducing power | ||||||
| PG | mg GAE/g FW | mg RE/g FW | mg AAE/g FW | mg GAE/g FW | mg RE/g FW | mg AAE/g FW | |
| 1.29 ± 0.02 | 3.71 ± 0.04 | 3.71 ± 0.03 | 4.12 ± 0.12 | 12.99 ± 0.12 | 11.13 ± 0.05 | ||
| PG-F | 1.45 ± 0.03 | 3.92 ± 0.03 | 4.15 ± 0.04 | 4.64 ± 0.13 | 13.82 ± 0.02 | 12.45 0.08 | |
FIGURE 3Cell proliferation assessment (A) using MTT in MCF7 cells. The data shown represent the mean values of three experiments ±SD. *p < 0.05, **p < 0.01 as compared with the PG treated group (B) Cell viability of various concentrations of estradiol on MCF7 cells. **p < 0.01, as compared with the non-treated group. (C) Cell viability measurement of RAW 264.7 cells following the incubation of various concentrations of Pomegranate for 24 h.
FIGURE 4Effects of Pomegranate on the NO inhibition. RAW 264.7 cells were pretreated with Pomegranate juice for 1 h and then stimulated with LPS (1 μg/ml) for 24 h. The concentrations of nitrite were measured as described in the materials and methods. The data shown represent the mean values of three experiments ±SD. **p < 0.01, ***p < 0.001 as compared with the group treated with LPS.
FIGURE 5Effect of Pomegranate on the transcriptional activation of the ER α, Erβ, and pS2 genes in MCF7 cells. MCF7 cells were treated with Pomegranate juice for 24 h. Subsequently, total RNAs were extracted, and the mRNA expression levels were determined by RT-PCR analysis and compared with those of GAPDH. The data shown are representative of the mean values of three independent experiments ±SD. *p < 0.05, **p < 0.01, ***p < 0.001 as compared with the group treated with E2, and ###p < 0.001 as compared to the control.
FIGURE 6Effect of Pomegranate on the mRNA expression of iNOS in RAW 264.7 cells. AW 264.7 macrophages were pretreated with Pomegranate juice for 1 h, then stimulated with LPS (1 μg/ml) for 24 h. Finally, total RNA was extracted, and the mRNA expression levels were determined by RT-PCR analysis and compared with those of GAPDH. The data shown are representative of the mean values of three independent experiments ±SD. ***p < 0.001 as compared with the group treated with LPS, and ###p < 0.001 as compared to the control.