Literature DB >> 36248425

Mechanism of LncHOTAIR Regulating Proliferation, Apoptosis, and Autophagy of Lymphoma Cells through hsa-miR-6511b-5p/ATG7 Axis.

Fu Gui1, Xinyi Yu1, Yemeng Wu1, Chao Wu1, Yulan Zhang1.   

Abstract

Objective: To explore the role of LncHOTAIR in apoptosis and autophagy in lymphoma.
Methods: The interaction between LncHOTAIR and miR-6511b-5p, as well as between miR-6511b-5p and ATG7, was verified by a dual luciferase assay. LncHOTAIR overexpression lentivirus was transducted and siATG7s were transfected into Raji and BJAB lymphoma cells, and the efficiency was verified by qPCR. Lymphocyte proliferation was detected by the cell counting kit-8 (CCK8) test, and autophagy was detected by transmission electron microscopy. The protein expressions of ULK1, Beclin1, ATG7, LC3, Bax, cleaved-caspase 3, and Bcl-2 were detected using Western blots.
Results: There was a targeting relationship between LncHOTAIR and miR-6511b-5p and between miR-6511b-5p and ATG7. LncHOTAIR overexpression promoted the proliferation and autophagy of Raji and BJAB cells, significantly upregulated ATG7, Beclin1, ULK1, Bcl-2, and LC3-II/LC3-I levels, and downregulated Bax and cleaved-caspase3 levels. siATG7 significantly inhibited the proliferation and autophagy of Raji and BJAB cells and promoted their apoptosis.
Conclusion: LncHOTAIR/hsa-miR-6511b-5p/ATG7 could regulate the proliferation, apoptosis, and autophagy of Raji and BJAB lymphoma cells.
Copyright © 2022 Fu Gui et al.

Entities:  

Year:  2022        PMID: 36248425      PMCID: PMC9560808          DOI: 10.1155/2022/2166605

Source DB:  PubMed          Journal:  Evid Based Complement Alternat Med        ISSN: 1741-427X            Impact factor:   2.650


1. Introduction

Lymphoma is a systemic malignant tumor that originates from the lymphohematopoietic system, accounting for 3%–4% of all malignant tumors. Most lymphomas originate from B cells, whereas other lymphomas are derived from T cells or natural killer (NK) cells [1]. Burkitt lymphoma (BL) belongs to B-cell lymphoma, which leads to poor prognosis due to unclear early symptoms and a lack of effective treatment [2, 3]. Therefore, it is key to explore and identify new biomarkers for early detection and effective treatment. Long noncoding RNA (e.g., LncRNA) is defined as longer than 200 nucleotides, and many lncRNAs are abnormally expressed in different diseases, especially cancer. The imbalance of lncRNA mainly promotes cancer progression by promoting the malignant biological behavior of tumor cells (such as proliferation, invasion, or metastasis). LncRNA can be used as tumor markers to provide a basis for early diagnosis of cancer because some lncRNA have abnormal expression in various types of human tumors. LncHOTAIR is abnormally expressed in solid tumors, acute leukemia, and lymphoma, and is closely related to tumor proliferation, apoptosis, and migration [4, 5]. Autophagy plays a role in “tumor inhibition” in the occurrence, development, and malignant evolution of various cancers, including gastric cancer, glioma, and pancreatic cancer [6]. ATG7 is an E1-likeubiquitin-activating enzyme, and it is needed during autophagy as well as cytoplasmic-to-vacuolar transportation. However, no study has confirmed the regulatory relationship between LncHOTAIR and autophagy. Therefore, to explore the regulatory mechanism between LncHOTAIR and autophagy in BL cells, we predicted that hsa-miR-6511b-5p may be involved in the regulation between LncHOTAIR and ATG7 using bioinformatics. We explored the molecular mechanisms of LncHOTAIR and ATG7 regulating proliferation, apoptosis, and autophagy in Raji and BJAB cells, which provided a theoretical basis for understanding how autophagy is involved in the pathogenesis of BL lymphoma.

2. Materials and Methods

2.1. Cell Culture

The Raji and BJAB cells (cultured in RPMI1640 + 10% FBS) and 293T cells (cultured in DMEM + 10% FBS) were obtained from ATCC and cultured at 37°C with 5% CO2.

2.2. Dual Luciferase Reporter Gene Assay

miR-6511b-5p′s interaction with LncHOTAIR and ATG7 were tested using pRL-SV40 containing LncHOTAIR and ATG7 3′-UTR luciferase reporter gene plasmids as a previously publication [7]. Sea kidney luciferase was used for standardization. miR-6511b-5P mimic sequences CUGCAGGCAGAAGUGGGGCUGACA,UGUCAGCCCCACUUCUGCCUGCAG and NC sequences UCACAACCUCCUAGAAAGAGUAGA,UCUACUCUUUCUAGGAGGUUGUGA.

2.3. Quantitative Rt-PCR

Total RNA was extracted from cells using the RNeasy kit (Qiagen) and reverse transcribed into cDNA according to the kit's instructions. The rt-PCR was performed on an ABI StepOne Plus system using SYBR Green qPCR Master Mix (Thermo Fisher Scientific, USA). The reaction was set at 95°C for 10 min for activation, then 95°C for 5 s, and 60°C for 40 s, with 40 cycles. β-Actin or U6 were employed as internal controls, and the amount of mRNA was calculated by the 2−ΔΔCT method. The primer sequences were summarized in Table 1.
Table 1

Primers in this study.

GeneSequences (5′-3′)
LncHOTAIR FGGTAGAAAAAGCAACCACGAAGC
LncHOTAIR RACATAAACCTCTGTCTGTGAGTGCC
ATG7 FAGCAGCTCATCGAAAGCCAT
ATG7 RAGTGCAGGGTCCGAGGTATT
β-actinFTGGCACCCAGCACAATGAA
β-actinRCTAAGTCATAGTCCGCCTAGAAGCA
U6 FCTCGCTTCGGCAGCACA
U6 RAACGCTTCACGAATTTGCGT
miR-6511b-5P FCTGCAGGCAGAAGTGGGG
miR-6511b-5P RAGTGCAGGGTCCGAGGTATT
miR-6511b-5PGTCGTATCCAGTGCAGGGTCCGAGG
RTTATTCGCACTGGATACGACTGTCAG

2.4. Cell Proliferation

The logarithmic growth phase cells were harvested from plates by trypsin digestion, added into plates (1 × 104 cells per well of 96-well) for overnight incubation, then 10 μl of cell counting kit-8 (CCK8) solution, which was purchased from Beyotime (Shanghai, China), was added, followed by a 4 h incubation [8]. The OD450 was measured with a SmartReader 96 Microplate Absorbance Reader (Benchmark Scientific, USA; n = 6 per group).

2.5. Apoptosis Determination

The cells were collected and washed with ice-coldphosphate-buffered saline (PBS), followed by apoptosis detection by the AnnexinV-FITC Analysis Kit on a NovoCyte™ flow cytometry according to the instructions.

2.6. Cell Cycle Analysis

The cells were collected, washed with PBS, fixed with 70% ethanol at 4°C, followed by ribonuclease treatment, and 200 μl of 50 μg/ml of propidium iodide (PI) were added. After 30 minutes of incubation in the dark, samples were loaded for flow cytometry analysis [9].

2.7. Transmission Electron Microscope (TEM)

The samples were fixed and dehydrated, embedded with acetone embedding solution, and solidified in an oven. The blocks were cut into 70 nm slices with an ultramicrotome. The slices were observed after 7.3% uranium acetate-lead citrate double staining under JEOL JEM-1230 (80 KV) TEM.

2.8. Western Blot

RIPA buffer was used for cell lysis. Lysates were centrifuged at 4°C (10000 rpm) for 10 min, and a BCA Protein Assay Kit (ThermoFisher, USA) was used to measure concentrations of the supernatant. Protein lysates were mixed with loading buffer, denatured at 95°C for 10 minutes, and separated (50 μg/lane) by electrophoresis in SDS-PAGE. Then, proteins were transferred to a PVDF membrane, which was washed and blocked using blocking buffer, followed by primary antibody incubation at 4°C overnight, rinsed, and the secondary antibody incubation for 1 h at room temperature, then immunoblotted by an enhanced chemiluminescence kit (Perkin-Elmer Inc.), and finally the Quantity One software was used for quantification.

2.9. Transduction and Transfection

The LncHOTAIR overexpression and control lentivirus were prepared by [7] and were transduced as previously described [10]. The transfection was conducted with the Lipofectamine 3000 kit (Thermo Fisher Scientific) in a control group, an siATG7 NC group, and an siATG7 group. The siRNA sequences are shown in Table 2.
Table 2

siRNA sequences.

siRNASequences
siATG7-1CCAACACACUCGAGUCUUUTT
AAAGACUCGAGUGUGUUGGTT

siATG7-2GCUCUUCCUUACUUCUUAATT
UUAAGAAGUAAGGAAGAGCTT

siATG7-3GCGUGAGACACAUCACAUUTT
AAUGUGAUGUGUCUCACGCTT

siATG7 NCUUCUCCGAACGUGUCACGUTT
ACGUGACACGUUCGGAGAATT

2.10. Statistical Analyses

The data were analyzed by SPSS 20.0 (IBM, Armonk, NY, USA). One-way ANOVA was used to calculate the differences among groups. A 2-sidedP < 0.05 was used to determine statistical significance.

3. Results

3.1. Targeting Relationship of LncHOTAIR/miR-6511b-5p/ATG7

LncHOTAIR WT bound with miR-6511b-5p mimic and significantly reduced luciferase activity (Figure 1(a)), ATG7 WT bound with miR-6511b-5p mimic and also significantly reduced luciferase activity (Figure 1(b)). These showed that LncHOTAIR and miR-6511b-5p, and miR-6511b-5p and ATG7 had a targeting relationship, respectively.
Figure 1

The targeting relationship between LncHOTAIR and miR-6511b-5p, miR-6511b-5p, and ATG7 was verified by dual luciferase assay. (a) Verification of LncHOTAIR and miR-6511b-5p targeting relationship; (b) Verification of miR-6511b-5p and ATG7 targeting relationship. P < 0.05 vs. LncHOTAIR WT or ATG 7; #P < 0.05 vs. LncHOTAIR WT + mimic NC or ATG7 WT + mimic NC.

3.2. Verification of LncHOTAIR Lentivirus Overexpression

In Figure 2, in Raji and BAJB cells, the level of LncHOTAIR increased significantly after transduction with the LncHOTAIR overexpression lentivirus vector compared with those in the control group and empty NC group (P < 0.05), which suggested that LncHOTAIR overexpression lentivirus transduction was successful.
Figure 2

The expression level of LncHOTAIR in Raji and BAJB cells was detected by RT-qPCR. (a) Raji cell; (b) BAJB cell. P < 0.05 LncHOTAIR overexpression (OE) vs. control; #P < 0.05 LncHOTAIR OE vs. LncHOTAIR OE negative control (NC).

3.3. Effect of LncHOTAIR Overexpression on the Viability of Lymphoma Cells

As shown in Figure 3, LncHOTAIR overexpression significantly promoted the proliferation of Raji and BJAB cells compared to that of the control group and NC group (P < 0.05).
Figure 3

The proliferation of Raji and BAJB cells was detected by CCK8. (a) Raji cells; (b) BAJB cells. P < 0.05 vs. control; #P < 0.05 vs. LncHOTAIR OE NC.

3.4. Effect of LncHOTAIR Overexpression on the Autophagy of Lymphoma Cells

The autophagy of Raji and BAJB cells was observed by TEM (Figure 4). Compared with the control group and NC group, the autophagy bodies significantly increased in the LncHOTAIR overexpression group. These results suggested that LncHOTAIR overexpression promoted autophagy in Raji and BAJB cells.
Figure 4

Effect of LncHOTAIR overexpression on the autophagy of lymphoma cells.

3.5. Effects of LncHOTAIR Overexpression on Autophagy and Apoptosis Related Proteins

The LncHOTAIR overexpression significantly increased the levels of autophagy related proteins ATG7, Beclin1, LC3-II/LC3-I, ULK1 and the antiapoptotic protein Bcl-2 in Raji and BAJB cells, and the levels of proapoptotic proteins were significantly decreased, such as Bax and cleaved-caspase3 (Figure 5).
Figure 5

Western blotting results of autophagy and apoptosis related proteins in Raji and BAJBcells. (a) Raji cells; (b) BAJB cells. P < 0.05 vs. control; #P < 0.05 vs. LncHOTAIR OE NC.

3.6. ATG7 Interference Verification

The expression level of ATG7 in the siATG7-1, siATG7-2 and siATG7-3 groups decreased significantly in Raji and BAJB cells compared with that of the control group and NC group (P < 0.05), especially in the siATG7-1 group (Figure 6). Therefore, siATG7-1 was selected as the interference vector of ATG7 in subsequent experiments.
Figure 6

ATG7 expression in Raji and BAJB cells after siATG7 treatment. (a) Raji cells; (b) BAJB cells. P < 0.05 vs. control; #P < 0.05 vs. siATG7 NC.

3.7. Effect of siATG7 on the Viability of Lymphoma Cells

ATG7 significantly decreased the viability of Raji and BAJB cells (Figure 7, P < 0.05).
Figure 7

The viability of Raji and BAJB cells was detected by CCK8. (a) Raji cells; (b) BAJB cells. P < 0.05 vs. control; #P < 0.05 vs. siATG7 NC.

3.8. Effect of siATG7 on Apoptosis and Cell Cycle

In Raji and BAJB cells, siATG7 significantly promoted cell apoptosis. It blocked BJAB and Raji cells in G0/G1 phase, which indicates that siATG7 could affect G0/G1 phase and then affect apoptosis (Figure 8).
Figure 8

The apoptosis and cell cycle detected by flow cytometry. (a) Raji cells; (b) BAJB cells. P < 0.05 vs. control; #P < 0.05 vs. siATG7 NC.

3.9. Effect of siATG7 on the Autophagy of Lymphoma Cells

The autophagy of Raji and BAJB cells was observed by TEM after siATG7 treatment (Figure 9). The autophagy bodies significantly decreased in the siATG7 group. These results suggested that siATG7 inhibited the autophagy of Raji and BAJB cells.
Figure 9

Effect of siATG7 on the autophagy of lymphoma cells.

3.10. Effects of siATG7 on Autophagy and Apoptosis Related Proteins

The siATG7 significantly inhibited autophagy-related proteins and antiapoptotic proteins in Raji and BAJB cells, and significantly increased proapoptotic proteins (Figure 10).
Figure 10

Western blotting results of autophagy and apoptosis related proteins in Raji and BAJBcells. (a) Raji cells; (b) BAJB cells. P < 0.05 vs. control; #P < 0.05 vs. siATG7 NC.

4. Discussion

Lymphoma is a malignant tumor that is primarily located in lymph nodes or extranodal lymphoid tissue. Its incidence rate is increasing and seriously threatens human health. In B-cell lymphoma, the content of BIC RNA/miR-155 increased significantly, and it was different among patients, suggesting that miR-155 may be transcribed and regulated by BIC RNA [11]. LncHOTAIR was upregulated in diffuse large B-cell lymphoma (DLBCL). Its expression level was significantly correlated with tumor characteristics. Knockdown of LncHOTAIR in vitro may lead to tumor cell growth inhibition, cell cycle arrest, and apoptosis through the PI3K/AKT/NF-κB pathway [12]. LncHOTAIR expression in DLBCL may induce H3K27me3 through EZH2-related PRC2 activation [13]. In this study, LncHOTAIR overexpression could significantly promote the proliferation of Raji and BAJB cells, which is consistent with Yan et al.'s results [12]. Bax promotes apoptosis, whereas Bcl-2 inhibits apoptosis [14]. When Bax expression increases, a large number of Bax homodimers are formed, which induces the release of Cyt-C into the cytoplasm and activates caspase-9. Then, caspase-9 digests caspase-3 zymogen and activates caspase-3, promotes the cleavage of caspase-3, starts a caspase cascade reaction, and induces apoptosis [15]. In colorectal cancer (CRC), siLncHOTAIR could significantly bring down Bcl-2 and bring up Bax and cleaved-caspase 3 protein expression [7], which was confirmed in our study in Raji and BAJB lymphoma cells. Autophagy, also known as a special type of programmed cell death, participates in many pathological processes as well as biological growth and development. LncHOTAIR and ATG7 were upregulated and autophagy was significantly increased during liver injury. However, after LncHOTAIR expression was knocked down, autophagy induced by hydrogen peroxide in isolated hepatocytes was attenuated, and LncHOTAIR regulated autophagy in liver injury [16]. This study predicted that hsa-miR-6511b-5p may be involved in the regulation of LncHOTAIR and ATG7 using the bioinformatic databases of TargetScan and Starbase, and proved that hsa-miR-6511b-5p had target sites for LncHOTAIR and ATG7 by dual luciferase reporter gene assay. Overexpression of LncHOTAIR could significantly upregulate ATG7 and increase the number of autophagy bodies in Raji and BAJB cells. Autophagy is related to nutritional status, energy status, oxidative stress, ischemia, and hypoxia. It is regulated by multiple mechanisms, such as the ULK1 pathway, Beclin1 pathway, p53 pathway, AMP-activated protein kinase AMPK pathway, and so on. The Beclin1 pathway is the downstream regulatory signal of ULK1. ULK1 complex can phosphorylate Beclin1-Ser14 and Vps34Ser249, promote Beclin1-Vps34 complex formation, and thus promote the occurrence of autophagy [17]. LC3 is the earliest marker for autophagy, whose precursor excises the carboxyl terminal to generate LC3I, followed by covalent binding with phospholipids on the autophagy body membrane to form LC3II [18]. In this study, LncHOTAIR overexpression significantly promoted the expression levels of proteins related to autophagy, such as LC3-II/LC3-I, Beclin-1, and ULK1, which was consistent with the previous results [12, 16]. ATG7 is closely related to abnormal proliferation and drug resistance of a variety of tumors [19-24]. ATG7 deficiency completely inhibited the occurrence and development of mouse intestinal epithelial cell tumors and promoted the body's antitumor immune response [25]. In the mouse model, knockout of the ATG7 gene significantly reduced the tumorigenicity of tumor cells and promoted the transformation of lung cancer cells into benign tumors [26]. In this study, siATG7 significantly inhibited Raji and BAJB lymphoma cell proliferation. In bladder cancer, ATG7 played a role in cell invasion, and ATG7-specific therapy had certain development potential [27]. ATG7 can also promote angiogenesis in the brain [28], regulate the activity of caspase-9, and regulate the process of apoptosis [29]. In SH-SY5Y cells, knockdown of ATG7 significantly decreased Bcl-2 while increasing Bax and Caspase-3, which proved that ATG7-mediated autophagy could not only promote cell proliferation but also inhibit cell apoptosis [30]. In this study, siATG7 significantly downregulated Bcl-2 and upregulated Bax and caspase3. The knockdown of the ATG7 gene could inhibit the conversion from LC3-I to LC3-II [30], which was consistent with the results of this study.

5. Conclusions

In conclusion, this study found that the proliferation, apoptosis, and autophagy of Raji and BJAB lymphoma cells induced by the LncHOTAIR overexpression may be realized by autophagy-related protein ATG7. In BL lymphoma cells, ATG7 may promote abnormal cell proliferation and inhibit apoptosis by mediating autophagy.
  30 in total

1.  LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing.

Authors:  Y Kabeya; N Mizushima; T Ueno; A Yamamoto; T Kirisako; T Noda; E Kominami; Y Ohsumi; T Yoshimori
Journal:  EMBO J       Date:  2000-11-01       Impact factor: 11.598

Review 2.  The prognostic impact of long noncoding RNA HOTAIR in leukemia and lymphoma: a meta-analysis.

Authors:  Yun Lin; Zhihong Fang; Zhijuan Lin; Zhifeng Li; Jintao Zhao; Yiming Luo; Bing Xu
Journal:  Hematology       Date:  2018-03-07       Impact factor: 2.269

3.  miRNA analysis in B-cell chronic lymphocytic leukaemia: proliferation centres characterized by low miR-150 and high BIC/miR-155 expression.

Authors:  M Wang; L P Tan; M K Dijkstra; K van Lom; J-L Robertus; G Harms; T Blokzijl; K Kooistra; M B van T'veer; S Rosati; L Visser; M Jongen-Lavrencic; P M Kluin; A van den Berg
Journal:  J Pathol       Date:  2008-05       Impact factor: 7.996

Review 4.  Lymphoma.

Authors:  Emiliano N Mugnaini; Nilanjan Ghosh
Journal:  Prim Care       Date:  2016-12       Impact factor: 2.907

5.  Atg7 suppression enhances chemotherapeutic agent sensitivity and overcomes stroma-mediated chemoresistance in acute myeloid leukemia.

Authors:  Sujan Piya; Steven M Kornblau; Vivian R Ruvolo; Hong Mu; Peter P Ruvolo; Teresa McQueen; R Eric Davis; Numsen Hail; Hagop Kantarjian; Michael Andreeff; Gautam Borthakur
Journal:  Blood       Date:  2016-06-07       Impact factor: 22.113

6.  Long noncoding RNA HOTAIR regulates autophagy via the miR-20b-5p/ATG7 axis in hepatic ischemia/reperfusion injury.

Authors:  Bing Tang; Naren Bao; Guannan He; Junke Wang
Journal:  Gene       Date:  2018-10-24       Impact factor: 3.688

Review 7.  LncRNA HOTAIR in Tumor Microenvironment: What Role?

Authors:  Gerardo Botti; Giosuè Scognamiglio; Gabriella Aquino; Giuseppina Liguori; Monica Cantile
Journal:  Int J Mol Sci       Date:  2019-05-08       Impact factor: 5.923

8.  Architecture and dynamics of the autophagic phosphatidylinositol 3-kinase complex.

Authors:  Sulochanadevi Baskaran; Lars-Anders Carlson; Goran Stjepanovic; Lindsey N Young; Do Jin Kim; Patricia Grob; Robin E Stanley; Eva Nogales; James H Hurley
Journal:  Elife       Date:  2014-12-09       Impact factor: 8.140

Review 9.  Cancer Immunotherapy in Diffuse Large B-Cell Lymphoma.

Authors:  Jun Zhang; L Jeffrey Medeiros; Ken H Young
Journal:  Front Oncol       Date:  2018-09-10       Impact factor: 6.244

10.  Long non-coding RNA HOTAIR knockdown enhances radiosensitivity through regulating microRNA-93/ATG12 axis in colorectal cancer.

Authors:  Yingqiang Liu; Xijuan Chen; Xiling Chen; Junqi Liu; Hao Gu; Ruitai Fan; Hong Ge
Journal:  Cell Death Dis       Date:  2020-03-06       Impact factor: 8.469

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.