| Literature DB >> 36246605 |
Zhijing Song1,2,3, Haoling Zhang4, Yuhang Jiang5, Rui Zhao1, Xuedong Pei1, Haochi Ning1, Hailiang Chen1, Jing Pan1, Yanlong Gong2, Min Song1, Wei Wang6.
Abstract
Osteoporosis is a serious threat to human life. Guben Zenggu Granule is an empirical prescription for clinical treatment of osteoporosis. MC3T3-E1 cells are mouse osteogenic precursor cells with osteogenic differentiation, and are classic cells for studying bone metabolism and osteogenic mechanism, as well as mechanical stimulation sensitive cells. Therefore, it can be inferred that Guben Zenggu granule can repair MC3T3-E1 cells under continuous static pressure overload. This study aims to through the network of pharmacology and gene sequencing method, reveal thrift increase bone particles under the condition of continuous static pressure overload on osteogenesis mechanism of MC3T3-E1 cells. In the process of analysis, from a variety of 98 compounds was predicted in the database, a collection of 474 goals, a total of 29,164 difference between two groups of genes. Then, construction of composite targets between cells and predict targets and protein - protein interaction networks, and through the cluster analysis to further explore the relationship between the target. In addition, linkages between target proteins and cells were further identified using Gene Ontology (GO) and Pathways (KEGG Pathway). Finally, the repair effect of Guben Zenggu granule on MC3T3-E1 cells under continuous static pressure overload was verified through experiments, so as to accurately explain the pharmacodynamic mechanism of Traditional Chinese medicine.Entities:
Keywords: MC3T3-E1 cells; continuous static pressure; gene sequencing; guben zenggu granules; network pharmacology
Year: 2022 PMID: 36246605 PMCID: PMC9557205 DOI: 10.3389/fgene.2022.941098
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
FIGURE 1Shows the experimental design route in this paper.
FIGURE 2(A) Volcanic diagram between two groups of samples; (B) Scatter plot between two groups of samples; (C) Drug-cell gene common targets; (D) Drug-component-target-gene interaction network diagram; (E) Protein interaction network.
Drug composition of Guben Zenggu granule.
| Seractial number | OB(%) | DL | herbs |
|---|---|---|---|
| MOL000358 | 36.91 | 0.75 | DG、RCR、WY |
| MOL000449 | 43.83 | 0.76 | DG、DS、SDH |
| MOL001006 | 42.98 | 0.76 | DS |
| MOL002140 | 65.95 | 0.27 | DS |
| MOL002879 | 43.59 | 0.39 | DS |
| MOL003036 | 43.83 | 0.76 | DS |
| MOL003896 | 42.56 | 0.20 | DS |
| MOL004355 | 42.98 | 0.76 | DS |
| MOL004492 | 38.72 | 0.58 | DS |
| MOL005321 | 65.90 | 0.34 | DS |
| MOL000006 | 36.16 | 0.25 | DS、HYH |
| MOL006554 | 38.40 | 0.77 | DS |
| MOL006774 | 37.42 | 0.75 | DS |
| MOL007059 | 32.16 | 0.41 | DS |
| MOL007514 | 39.67 | 0.23 | DS |
| MOL008391 | 33.12 | 0.79 | DS |
| MOL008393 | 38.33 | 0.29 | DS |
| MOL008397 | 50.37 | 0.77 | DS |
| MOL008400 | 50.48 | 0.24 | DS |
| MOL008406 | 39.97 | 0.40 | DS |
| MOL008407 | 45.40 | 0.76 | DS |
| MOL008411 | 40.00 | 0.66 | DS |
| MOL000211 | 55.38 | 0.78 | HQ |
| MOL000239 | 50.83 | 0.29 | HQ |
| MOL000296 | 36.91 | 0.75 | HQ |
| MOL000033 | 36.23 | 0.78 | HQ |
| MOL000354 | 49.60 | 0.31 | HQ |
| MOL000371 | 53.74 | 0.48 | HQ |
| MOL000374 | 41.72 | 0.69 | HQ |
| MOL000378 | 74.69 | 0.30 | HQ |
| MOL000379 | 36.74 | 0.92 | HQ |
| MOL000380 | 64.26 | 0.42 | HQ |
| MOL000387 | 31.10 | 0.67 | HQ |
| MOL000392 | 69.67 | 0.21 | HQ |
| MOL000398 | 109.99 | 0.30 | HQ |
| MOL000417 | 47.75 | 0.24 | HQ |
| MOL000422 | 41.88 | 0.24 | HQ、HYH |
| MOL000433 | 68.96 | 0.71 | HQ |
| MOL000438 | 67.67 | 0.26 | HQ |
| MOL000439 | 49.28 | 0.62 | HQ |
| MOL000442 | 39.05 | 0.48 | HQ |
| MOL000098 | 46.43 | 0.28 | HQ、RCR、WY、HYH |
| MOL005320 | 45.57 | 0.20 | RCR |
| MOL005384 | 57.52 | 0.56 | RCR |
| MOL007563 | 57.53 | 0.81 | RCR |
| MOL008871 | 37.05 | 0.69 | RCR |
| MOL000359 | 36.91 | 0.75 | SDH、WY、HYH |
| MOL010495 | 31.93 | 0.30 | WY |
| MOL010496 | 32.38 | 0.39 | WY |
| MOL010907 | 40.92 | 0.46 | WY |
| MOL010913 | 77.09 | 0.25 | WY |
| MOL010916 | 42.55 | 0.19 | WY |
| MOL010917 | 31.18 | 0.51 | WY |
| MOL001510 | 37.58 | 0.71 | HYH |
| MOL001645 | 42.10 | 0.20 | HYH |
| MOL001771 | 36.91 | 0.75 | HYH |
| MOL001792 | 32.76 | 0.18 | HYH |
| MOL003044 | 35.85 | 0.27 | HYH |
| MOL003542 | 38.04 | 0.39 | HYH |
| MOL004367 | 62.23 | 0.41 | HYH |
| MOL004373 | 45.41 | 0.44 | HYH |
| MOL004380 | 39.14 | 0.49 | HYH |
| MOL004382 | 56.96 | 0.77 | HYH |
| MOL004384 | 45.67 | 0.50 | HYH |
| MOL004386 | 51.63 | 0.55 | HYH |
| MOL004388 | 60.64 | 0.66 | HYH |
| MOL004391 | 48.54 | 0.25 | HYH |
| MOL004394 | 41.58 | 0.61 | HYH |
| MOL004396 | 52.31 | 0.22 | HYH |
| MOL004425 | 41.58 | 0.61 | HYH |
| MOL004427 | 31.91 | 0.86 | HYH |
| MOL000622 | 63.71 | 0.19 | HYH |
| The active ingredient | herbs | ||
| Corylifolinin | BGZ | ||
| Sophoracoumestan A | BGZ | ||
| Isopsoralidin | BGZ | ||
| Bavachin | BGZ | ||
| Bakuchiol | BGZ | ||
| Isobavachin | BGZ、GJ | ||
| Bavachalcone | BGZ | ||
| Bavachromene | BGZ | ||
| Psoralidin | BGZ | ||
| stigmasterol | BGZ | ||
| Xanthotoxin | BGZ | ||
| Backuchiol | BGZ | ||
| Angelicin | BGZ | ||
| Isobavachalcone | BGZ | ||
| Cudraphenone D | GJ | ||
| Kaempferol | GJ | ||
| Cudraphenone A | GJ | ||
| Bergapten | GJ | ||
| Naringenin | GJ | ||
| Aspidinol | GJ | ||
| Cudraphenone C | GJ | ||
| Cudraphenone B | GJ | ||
| Cudraflavanone B | GJ | ||
| Calcium Phosphate | LJJ | ||
| Calcium Carbonate | LJJ | ||
| Cholesterol | TBC | ||
Note:DG:Angelica, RCR:Cistanche, WY:aconite, DS: Dangshen, SDH:cooked rehmannia glutinosa,RYH:epimedium,HQ:The root of remembranous milk vetch,BGZ:Psoraleae, GJ:dog spine,;LJJ:Antler glue,TBC:Ground beetle.
Primer sequence table.
| Gene | Primer | Sequence (5′-3′) | PCR Products |
|---|---|---|---|
| b-actin | Forward | CACGATGGAGGGGCCGGACTCATC | 240bp |
| Reverse | TAAAGACCTCTATGCCAACACAGT | ||
|
| Forward | GACTACACCCACTCCATTCC | 233bp |
| Reverse | GCAGGTTCCGAGTAAGTAA | ||
|
| Forward | AGATGGGACTGTGGTTACCG | 203bp |
| Reverse | TAGCTCTGTGGTAAGTGGCC |
FIGURE 3(A) GO Functional analysis (CC); (B) GO functional analysis (MF); (C) GO Functional analysis (BP); (D) KEGG analysis.
The effect of different concentrations of Gubenzenggu granule medicated serum on the proliferation of MC3T3-E1 cells.
| Group | OD | Proliferation rate (%) |
|---|---|---|
| blank | 0.0777 ± 0.0022 | |
| The control group | 1.0259 ± 0.0082 | 100 ± 0.01 |
| 5% Blank serum | 1.0041 ± 0.0048 | 98 ± 0.02 |
| 10% Blank serum | 1.0873 ± 0.0169 | 106 ± 0.01 |
| 20%Blank serum | 0.9499 ± 0.0123 | 92 ± 0.01 |
| 1% Low concentration of drug-containing serum | 1.0118 ± 0.0055 | 99 ± 0.04 |
| 5% Low concentration of drug-containing serum | 1.0495 ± 0.0342 | 102 ± 0.02 |
| 10% Low concentration of drug-containing serum | 1.1247 ± 0.0162 | 110 ± 0.03 |
| 15% Low concentration of drug-containing serum | 1.0179 ± 0.0270 | 99 ± 0.01 |
| 20% Low concentration of drug-containing serum | 0.8874 ± 0.0141 | 85 ± 0.01 |
| 1% Medium concentration drug containing serum | 1.0357 ± 0.0123 | 101 ± 0.04 |
| 5% Medium concentration drug containing serum | 1.0529 ± 0.0364 | 103 ± 0.03 |
| 10% Medium concentration drug containing serum | 1.1456 ± 0.0288 | 113 ± 0.02 |
| 15% Medium concentration drug containing serum | 1.0394 ± 0.0157 | 101 ± 0.02 |
| 20% Medium concentration drug containing serum | 0.8950 ± 0.0147 | 86 ± 0.01 |
| 1% High concentration of drug serum | 1.0115 ± 0.0071 | 98 ± 0.02 |
| 5% High concentration of drug serum | 1.0554 ± 0.0155 | 103 ± 0.03 |
| 10% High concentration of drug serum | 1.1748 ± 0.0279 | 116 ± 0.01 |
| 15% High concentration of drug serum | 0.9971 ± 0.0097 | 97 ± 0.02 |
| 20% High concentration of drug serum | 0.8651 ± 0.0214 | 83 ± 0.01 |
Continuous static pressure damage model index WB detection (n = 3).
| Blank control group | Model group | Blank serum group | Drug containing serum group | |
|---|---|---|---|---|
| OC/β-actin | 0.793 ± 0.023 | 0.459 ± 0.053 | 0.498 ± 0.053 | 0.634 ± 0.082* |
| ColⅠ/β-actin | 0.633 ± 0.063 | 0.337 ± 0.050 | 0.359 ± 0.042 | 0.484 ± 0.020* |
| OPN/β-actin | 0.466 ± 0.027 | 0.199 ± 0.043 | 0.247 ± 0.043 | 0.361 ± 0.052* |
| Rankl/β-actin | 0.316 ± 0.033 | 0.915 ± 0.021 | 0.869 ± 0.040 | 0.413 ± 0.043* |
| Nox4/β-actin | 0.829 ± 0.045 | 1.569 ± 0.069 | 1.309 ± 0.042 | 0.974 ± 0.061* |
| OPG/β-actin | 0.937 ± 0.063 | 0.863 ± 0.25 | 0.746 ± 0.046 | 0.850 ± 0.050 |
*Represents p < 0.05.
FIGURE 4Continuous static pressure damage model index WB detection. Note:1:Blank control group 2:Model group3:Blank serum group 4:Drug containing serum group.(A):OC/β-actin,(B):CoⅡ/β-actin,(D):OPN/β-actin,(E):Rankl/β-actin,(F):Nox4/β-actin,(G):OPG/β-actin;(H):RT-QPCR was used to detect TGF-β/BMP signaling pathway Smad2 in MC3T3-E1 cells. (I)Rt-qpcr was used to detect runx2 gene expression of TGF-β/BMP signaling pathway in MC3T3-E1 cells.
FIGURE 5Image of trabecular bone.
FIGURE 6Bone mineral density index and bone trabecular index. Note: (A)TV MM3 (selected volume of ROI),(B):BV MM3 (bone volume),(C):BV/TV % (bone volume fraction),(D):Tb.Th mm (bone trabecular thickness),(E):Tb.N 1/mm (bone trabecular number),(F):Tb (Bone trabecular separation), (G)BMD G/cm3 (bone density),1. Normal rats group,2. Rat model + placebo group, 3. Rat model + low dose,4. Rat model + medium dose5. Rat model + high dose* *represents p < 0.05.
FIGURE 7HE staining of bone tissue with different doses of drugs.