Literature DB >> 36230939

Dexras1 Induces Dysdifferentiation of Oligodendrocytes and Myelin Injury by Inhibiting the cAMP-CREB Pathway after Subarachnoid Hemorrhage.

Yuanjun Xin1, Jie Chen2, Hongxia Zhang1, Robert P Ostrowski3, Yidan Liang1, Jun Zhao1, Xiang Xiang1, Fuming Liang1, Wenqiao Fu1, Hao Huang1, Xintong Wu1, Jun Su1, Jiewen Deng1, Zhaohui He1.   

Abstract

White matter damage (WMD), one of the research hotspots of subarachnoid hemorrhage (SAH), mainly manifests itself as myelin injury and oligodendrocyte differentiation disorder after SAH, although the specific mechanism remains unclear. Dexamethasone-induced Ras-related protein 1(Dexras1) has been reported to be involved in nervous system damage in autoimmune encephalitis and multiple sclerosis. However, whether Dexras1 participates in dysdifferentiation of oligodendrocytes and myelin injury after SAH has yet to be examined, which is the reason for creating the research content of this article. Here, intracerebroventricular lentiviral administration was used to modulate Dexras1 levels in order to determine its functional influence on neurological injury after SAH. Immunofluorescence, transmission electron microscopy, and Western blotting methods, were used to investigate the effects of Dexras1 on demyelination, glial cell activation, and differentiation of oligodendrocyte progenitor cells (OPCs) after SAH. Primary rat brain neurons were treated with oxyhemoglobin to verify the association between Dexras1 and cAMP-CREB. The results showed that Dexras1 levels were significantly increased upon in vivo SAH model, accompanied by OPC differentiation disturbances and myelin injury. Dexras1 overexpression significantly worsened OPC dysdifferentiation and myelin injury after SAH. In contrast, Dexras1 knockdown ameliorated myelin injury, OPC dysdifferentiation, and glial cell activation. Further research of the underlying mechanism discovered that the cAMP-CREB pathway was inhibited after Dexras1 overexpression in the in vitro model of SAH. This study is the first to confirm that Dexras1 induced oligodendrocyte dysdifferentiation and myelin injury after SAH by inhibiting the cAMP-CREB pathway. This present research may reveal novel therapeutic targets for the amelioration of brain injury and neurological dysfunction after SAH.

Entities:  

Keywords:  Dexras1; cAMP-CREB pathway; dysdifferentiation; myelin injury; subarachnoid hemorrhage

Mesh:

Substances:

Year:  2022        PMID: 36230939      PMCID: PMC9564295          DOI: 10.3390/cells11192976

Source DB:  PubMed          Journal:  Cells        ISSN: 2073-4409            Impact factor:   7.666


1. Introduction

Aneurysmal subarachnoid hemorrhage (aSAH) is a serious neurosurgical disorder with extremely high mortality and disability [1,2]. Despite intensive investigations, pathological mechanisms underlying aSAH have not yet been fully elucidated. Previous research has shown that while neuronal death plays an important part in neurological injury, it is not the only reason for neurological dysfunction after subarachnoid hemorrhage (SAH) [3,4]. In recent years, white matter damage (WMD) after SAH has rapidly become a research hotspot in neuroscience. Yusuke Egashira et.al. [5] found that white matter fiber damage occurred early after SAH, and that the hemorrhage results in damage to both neuronal axons and oligodendrocytes (OLGs). Unlike gray matter injuries known for a difficult recovery, white matter injuries, such as demyelination and axon damage, are reversible to a certain extent [6]. However, white matter receives less collateral circulation than gray matter and is more sensitive to ischemia [7]. Therefore, it is very meaningful to investigate the underlying mechanisms of white matter damage after subarachnoid hemorrhage. In the central nervous system, only mature OLGs act as myelin-forming cells, and are differentiated from oligodendrocyte progenitor cells (OPCs) [8]. There are many factors affecting OLG differentiation and myelin damage. Khan et al. [9] found the amelioration of myelin damage in experimental optic neuritis after Dexamethasone-induced Ras-related protein 1 (Dexras1) knockdown. However, whether Dexras1 has a similar role in white matter damage after SAH needs to be explored. Dexras1, also known as RASD1, is a guanylate-binding protein abundant in the brain. Earlier reports have highlighted its role in regulating circadian rhythms and tumor cell apoptosis [10]. Recently, it has been found that Dexras1 inhibits adenylyl cyclase activity in vitro, thereby downregulating the cAMP-PKA-CREB signaling pathway [11]. Whether Dexra1 participates in myelin damage and impaired oligodendrocyte differentiation through this pathway has not yet been studied. Therefore, this study explores the role of Dexras1 in oligodendrocyte differentiation disorders and myelin damage after SAH, thus paving the way for further research of new treatments for SAH.

2. Materials and Methods

2.1. Animals and Study Design

One hundred and fifty adult male Sprague–Dawley (SD) rats (280–350 g) and 300 newborn (1-day-old) rat pups were obtained from the Animal Experiment Center of Chongqing Medical University. The rats were maintained in a specific pathogen-free environment under 12 h light/dark cycles with temperature and humidity control. All research-related procedures received approval from the Animal Ethics and Use Committee of Chongqing Medical University. The rats were randomly assigned to the different groups: sham, SAH, SAH+LV-scramble, SAH+LV-Dexras1+ (overexpression of Dexras1 by lentiviral plasmid transfer), and SAH+LV-Dexras1− (depletion of Dexras1 by lentiviral shRNA transduction). Morris Water Maze (MWM) testing was performed on days 8 to 13 after SAH, whereas other main endpoints (involving immunofluorescence, electron microscopy, and neurobehavioral functions) were defined at 24 h post-SAH. The detailed experimental design and molecular interventions are presented in Figure 1.
Figure 1

Four separated experiments schematic. Experiment 1: To study the temporal expression and cellular localization of Dexras1, 35 rats were randomly divided and assigned to seven groups: Sham (n = 5), SAH-6 h (n = 5), SAH-12 h (n = 5), SAH-24 h (n = 5), SAH-48 h (n = 5), SAH-72 h (n = 5), SAH-7 d (n = 5). Western blot analysis was performed to determine the expression changes of Dexras1 and other proteins. An additional 12 rats in the Sham (n = 3) and SAH-24 h (n = 3) groups were used for double immunofluorescence staining, electron microscopy. Experiment 2: Seven days after lentivirus injection into the lateral ventricle, to evaluate the effects of Dexras1 on short-term outcome after SAH, 40 rats were randomly divided and assigned to eight groups for Western blot and SAH grade: Sham (n = 5), SAH+LV-scramble (n = 5), SAH+LV-Dexras1+ (2 U, n = 5), SAH+LV-Dexras1+ (4 U, n = 5), and SAH+LV-Dexras1+ (6 U, n = 5), SAH +LV-Dexras1−(2 U, n = 5), SAH +LV-Dexras1−(4 U, n = 5), SAH +LV-Dexras1−(6 U, n = 5). Based on the results of Western blot, Sham (n = 3), SAH+LV-scramble (n = 3), SAH+LV-Dexras1+ (6 U, n = 3), and LV-Dexras1−(6 U, n = 3) group rats were used for immunofluorescence staining and electron microscopy to evaluate OPCs differentiation and myelin damage in the ipsilateral hemisphere at 24 h after SAH. To evaluate the effects of Dexras1 on long-term outcome after SAH, Morris water maze of these groups (additional 25 rats, 5 per group) was performed on day 8–13 after SAH. Experiment 3: To explore the effects of Dexras1 on oligodendrocyte differentiation in vitro SAH. Primary cortical neurons transfected with Dexras1 were co-cultured with IGF-I induced differentiated OLN-93 cells. Western blot analysis and immunofluorescence staining was performed to evaluate OPCs differentiation in vitro SAH model. Experiment 4: To explore the mechanism of Dexras1 on oligodendrocyte differentiation in vitro SAH. Primary cortical neurons transfected with Dexras1 were co-cultured with IGF-I-induced differentiated OLN-93 cells, and 8-Bromo-cAMP was added after co-culture for 1 h. Western blot analysis and immunofluorescence staining was performed to evaluate OPCs differentiation in vitro SAH model.

2.2. SAH Model Conducted by Means of Endovascular Perforation

The rat SAH model was established using a previously reported endovascular perforation method [12]. Briefly, the rats were anesthetized via intraperitoneal injection of pentobarbital (50 mg/kg), and the left carotid artery (CA) and its branches were exposed. Then, the distal end of the left external CA was sheared and reflexed to be in line with the left internal CA (ICA). A sharp 4-0 monofilament nylon suture was inserted into the external CA and advanced through the ICA until resistance was felt. The suture was then further advanced for approximately 3 mm to perforate the vessel bifurcation into the anterior and middle cerebral arteries. After puncturing the artery for approximately 10 s, the filament was withdrawn. The sham group underwent identical procedures without the vascular perforation. The severity of SAH was blindly assessed at the time of sacrifice according to the previously described grading system [13]. Rats displaying SAH severity scores between 8–13 were used for further experiments [14].

2.3. Drug and Lentiviral Vector Administration

2.3.1. Lentiviral Transfections for the In Vitro Model of SAH

Lentiviral vectors carrying Dexras1 and GFP were generated by Genepharma (Shanghai, China). The lentivirus concentrations were 109 transducing units/mL and the sequences are included as Supplementary Information S4. Neurons were transfected with Dexras1 knockdown or Dexras1 overexpressing lentiviral vectors at an MOI (multiplicity of infection) of 80 [15]. An RNA duplex with a random sequence was used as the negative control (NC). The transfection efficiency was more than the 90% (0.917 ± 0.005). Puromycin (2 µg/mL) was used to positively identify transfected cells [16] which were then used for the experiments.

2.3.2. Dexras1 Up- and Downregulation in the In Vivo Model of SAH

In this experiment, lentiviral vector-based interventions leading to overexpression and downregulation of Dexras1 were used to verify Dexras1 function in the rat SAH model. Lentivirus-based transfer systems were purchased from Shanghai Genepharma Pharmaceutical Technology Co, Ltd. (the sequences of overexpression and knockdown Dexras1 was showed in Table S1 and S2). The lateral ventricle injection method refers to the procedure introduced by Huang JZ et al. [17] 7 days before the construction of the subarachnoid hemorrhage model. Briefly, anesthetized rats were safely immobilized in a stereotaxic device (Stoelting, Wood Dale, IL, USA). Two to six microliters of the LV-Dexras1+ (109 TU/mL), LV-Dexras1− (109 TU/mL), or control LV-Scramble (109 TU/mL), were slowly injected into the left lateral ventricle of each rat using a stereotactic frame (1.0 mm posterior to bregma, 1.5 mm lateral to midline, 3.5 mm in depth under the surface of the skull) with a sterile 10-μL Hamilton syringe at a rate of 0.5 μL/min at seven days before SAH induction. A burr hole to the skull was also made in the sham rats but they did not receive intracerebroventricular injections. After the injection and wound closure, the rats were placed on an electric blanket for recovery with free access to food and water.

2.4. Evaluation of Short-Term Neurobehavioral Functions and Brain Water Content Detect

The short-term neurobehavioral effects of treatments were assessed by investigators blinded to group ID at 24 h post-SAH according to the updated Garcia scale as previously described [18]. The modified Garcia scoring system includes six subscores. The animals were given an overall score between 0 and 18 after summation of all scores. For brain water content measure as previously described [19], the brains of each group were quickly divided into different portions under deep anesthesia, then weighed immediately (wet weight) and kept in an oven at 105 °C for 72 h (dry weight). The percentage of water content was calculated according to the formula: (wet weight to dry weight)/wet weight × 100%.

2.5. Morris Water Maze (MWM)

The MWM test was employed to assess the spatial learning ability and reference memory as previously described [18]. The cued water maze test was conducted one day before SAH, 5 rats per group with no difference were randomly selected for further experiments, and rats showing sensorimotor and/or motivational deficiencies affecting performance during the MWM test were not included in further trials. The spatial water maze test was conducted on days 8 to 13 after SAH. During each acquisition test, rats were allowed 90 s to find concealed platforms. If a rat was unable to find a platform within 90 s, it was directed there and allowed to rest on the platform for 20 s. On the 14th day, the platform was removed and the animals were observed for 90 s with a video recording system. The swimming pattern was assessed by an automatic image capture system to quantify distance, latency, and swimming speed. The number of times the rat crossed the platform and the time spent in the target quadrant were used for statistical analysis.

2.6. Cell Culture of Primary Cortical Neurons

Primary cortical neurons were obtained from newborn SD rats as previously described [20]. Briefly, cortical tissues were collected following newborn rat decapitation. The tissues were cut into small pieces and dispersed into cells (5 × 104 cells/mL), which were then grown in poly-D-lysine-coated (PDL-C) plates (Sigma, St. Louis, MO, USA) in Dulbecco’s Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS, Gibco, Thermo Fisher Scientific, Waltham, MA, USA) for 4 h. Next, the medium was replaced with neurobasal medium (Thermo Fisher Scientific) with 2% B27 reagent, 0.5 mM glutamine (Thermo Fisher Scientific), 100 U/mL penicillin (P), and 100 μg/mL streptomycin (S) at 37 °C with 5% CO2. The old medium was replaced with fresh medium every 3 days. Primary cortical neurons were used for experiments after culturing for 6 days.

2.7. Incubation of Neuronal Cells with Oxyhemoglobin for the Model of SAH In Vitro

To establish in vitro neural cell-based SAH model, primary cortical neurons were treated with 10 μ M oxyhemoglobin (OxyHb, O7109, Sigma, USA) in 1% DMSO for 24 h [21]. Control group cells were treated with 1% DMSO only. Treatment groups (SAH+LV-scramble, SAH +LV-Dexras1+, and SAH +LV-Dexras1−) were prepared with primary cortical cells then exposed to OxyHb for 24 h. In addition, an activator of the cAMP-CREB pathway, 8-Bromo-cAMP sodium salt (MCE, Shanghai, China, HY-12306), was used to verify the effect of Dexras1 on cAMP-CREB pathway in SAH model. After these treatments, each measurement was conducted thrice to enhance the accuracy of the results.

2.8. In Vitro Culture of OLN-93 Rat Oligodendroglia Cells

OLN-93 rat oligodendroglial cells were purchased from Shanghai Binsui Biological Technology Co., Ltd. (Shanghai, China). The cells were cultured in DMEM with 10% heat-inactivated FBS, 100 U/mL P, and 100 µg/mL S. Cells were passaged once every 3 days and grown in an incubator at 37° with 5% CO2.

2.9. Differentiation of OLN-93 Cells

The differentiation of OLN-93 cells into mature oligodendrocytes was performed as described by Van Meeteren et al. [22]. OLN-93 cells were plated at 24 mm diameter dishes in DMEM with 0.5% FBS. After overnight (O/N) incubation, the medium was replaced with serum-free DMEM and incubated for 3 days, following which the medium was replaced again with a fresh medium with 100 ng/mL IGF-I. Total protein was harvested for Western blot (WB) after 6 days. In addition, IGF-I-induced differentiated OLN-93 cells were seeded on PDL-C-coated 14 mm slides (Nest, China) before immunostaining with fluorescent maturation markers and comparative analysis against non-treated samples.

2.10. OLN-93 Cell Differentiation in Co-Culture with Neurons in an In Vitro Model of SAH

Primary neurons were isolated as previously described and were seeded on 24 mm inserts with 0.4 µm pore size (Transwell-Clear Polyester Membrane; Corning Inc., Corning, NY, USA) at a density of 0.5·106 cells with pre-suit corresponding medium, and incubated for 6 days. Then, IGF-I-treated differentiated OLN-93 cells were seeded below the neurons. Samples from each of the treatment groups were collected for protein analysis after co-culture for 3 days. For immunofluorescence staining, IGF-I-differentiated cells were also plated on PDL-C-coated 14 mm slides and co-cultured for 3 days with each of the neuron treatment groups.

2.11. Western Blot Analysis

WB analysis was performed as previously described [18]. The left cerebral hemispheres of rats were extracted and flash-frozen in liquid nitrogen before storing at −80 °C until further analysis. Cellular proteins were collected by cell scraping. The protein samples were then homogenized in RIPA lysis buffer and centrifuged for 15 min at 12,000× g at 4 °C. Equal quantities of proteins (50 μg) were then separated on 8–15% SDS-PAGE gels and transferred to polyvinylidene fluoride (PVDF) membranes (0.2–0.4 μm). After blocking in 5% nonfat milk for 3 h at room temperature (RT), the membranes were incubated O/N at 4 °C with individual primary antibodies as follows: anti-CNPase (1:250, Abcam, ab6319, Waltham, MA, USA), anti-Iba-1 (1:1000, Abcam, ab15690), anti-GFAP (1:1000, Abcam, ab10062), anti-myelin basic protein (MBP, 1:1000, Abcam, ab62631), anti-Dexras1 (1:1000, Abcam, ab78459), anti-CREB (1:1000, Cell Signaling, #9197, Danvers, MA, USA), anti-pCREB (1:500, Abcam, ab32096),anti-NG2 (1:500, Biorbyt, orb382135, Cambridge, UK) and anti-β-actin (1:1000, Cell Signaling, #4970), followed by corresponding secondary antibodies (1:5000, Biorbyt, orb572747/ orb557249) for 1 h at RT, and lastly, protein detection with a chemiluminescent reagent kit (ECL, Engreen Biosystem, Auckland, New Zealand). Non-saturated bands were selected to perform densitometry quantification using Fusion imaging system (Fusion fx 7 Spectra, Paris, France and the results were presented as a percentage, relative to the β-actin levels.

2.12. Double Immunofluorescence Staining

Samples were collected from animals at 24 h after perforation for double-fluorescence staining, performed as previously described [18]. The steps of cells immunofluorescence refer to the experimental method reported by Elliot H Choi et al. [23]. In brief, rat brains were perfused with 0.9 % saline first, and next the 4% paraformaldehyde, then fixed with 4% paraformaldehyde, dehydrated, and frozen at −80 °C. The samples were then sliced into 10 μm thick frozen sections, which were exposed O/N at 4 °C to the individual primary antibodies as follows: anti-CNPase (1:50, Abcam, ab6319), anti-Iba-1 (1:50, Abcam, ab15690), anti-GFAP (1:50, Abcam, ab10062), anti-myelin basic protein (MBP, 1:50, Abcam, ab62631), anti-Dexras1 (1:50, Abcam, ab78459), anti-NG2 (1:50, Biorbyt, orb382135), anti-NEUN (1:50, Merck Millipore, Burlington, MA, USA). The appropriate secondary antibody (Proteintech, SA00003-1/SA00009-2, Wuhan, China) was incubated with the brain sections at RT for 2 h, and the sections were observed and photographed using a fluorescence microscope (FV1200, Olympus, Tokyo, Japan). The main brain region we looked at was the subcortical area of the left cerebral hemisphere that was enriched for Dexras1 after subarachnoid hemorrhage.

2.13. RNA Isolation and Quantitative RT-PCR

Total RNA was isolated from cultured neurons with RNAiso Plus reagent (TaKaRa, 9108, Dalian, China), following the kit operational guidelines. cDNA was prepared from mRNA with the PrimeScript® RT reagent Kit With gDNA Eraser, following the kit operational guidelines (TaKaRa, RR047A). The relative expression of the genes of interest was determined by quantitative PCR using SYBR® Premix Ex Taq™ II (TaKaRa, RR820A) and Premix Ex Taq RR390A (TaKaRa, RR390A). qPCR was performed with the BioMark HD Real-Time PCR System (Fluidigm). Thermal cyclic conditions were set to 2 min at 50 °C, 10 min at 95 °C, 30 s at 95 °C (denaturation), 30 s at 58–60 °C (annealing), and 30 s at 72 °C (extension) for 40 cycles. The overall volume per reaction was 10 μL, which consisted of 1 μL diluted cDNA (10 ng/μL), 5 μL Roche SYBR Green Master Mix, 0.5 μL double-distilled water, and 0.5 μL of relevant primers (10-mmol/L concentration). For primer sequences see the following: Dexras1 ((Sense primer) 5′GGACGCTTACACCCCTACCAT3′, (Anti-sense primer) 5′ GGAAACGGATGATTGCCAGA 3′). The β-actin (Forward:5′-TGTCACCAACTGGGACGATA-3′, Reverse:5′-GGGGTGTTGAAGGTCTCAAA-3′) was used as an endogenous control gene. Data analysis was done with the Bio-Rad CFX3.0 Manager software (California, USA).

2.14. Enzyme-Linked Immunosorbent Assay (ELISA)

The culture medium was retrieved from all primary neuron cultures and the IL-1β and TNF-α levels measured using an ELISA assay kit (Multisciences, Hangzhou, China), following the manufacturer’s instructions.

2.15. Transmission Electron Microscopy (TEM)

TEM was performed as described previously [24]. Twenty-four hours after SAH, the deeply anesthetized rats of each group were sacrificed by intracardial perfusion with 0.9% saline followed by 4% paraformaldehyde. Then, the brain tissues were removed and post-fixed with 2% formaldehyde and 2% glutaraldehyde for 30 min. Next, the corpus callosum was minced into 1 mm3 pieces and maintained O/N at 4 °C in the same fixation mixture, as described earlier. Following dehydration, samples were impregnated with epoxy resin and sectioned, before incubation with uranyl acetate and lead citrate. Finally, the electron micrographs were viewed using the Hitachi-7500 (Hitachi, Tokyo, Japan). Six random visual fields were imaged per section by means of TEM at magnification ×12,000.

2.16. Statistical Analysis

Data were expressed as means ± SD and analyzed with GraphPad Prism 8 (GraphPad Prism, San Diego, CA, USA). Unpaired t-tests or one-way ANOVAs were employed to analyze significance among the groups. p < 0.05 was considered significant.

3. Results

3.1. Differentiation Disorders of Oligodendrocyte Precursor Cells and Myelin Damage after Subarachnoid Hemorrhage

First, we successfully established an in vivo animal model of SAH (Figure 2A). In this study, 23 rats died out of 132 SAH rats in total, hence the mortality rate is 17.4% (23/132). The myelin marker protein MBP in the subcortex (corpus callosum) of the left hemisphere was detected by WB, and it was found that MBP expression was significantly reduced after SAH (Figure 2B,C). The electron microscopy results showed significant loss and dissolution of myelin sheaths and even axonal injury after SAH (Figure 2F). Next, immunofluorescence and Western blot were used to verify OPC differentiation dysfunction after SAH. The immunofluorescence results showed that the levels of mature oligodendrocyte marker CNPase were decreased and the levels of oligodendrocyte precursor cell marker NG2 were increased after SAH (Figure 2G). The WB results confirmed the decreased CNPase and increased NG2 levels, showing gradual changes peaking at 24 h (Figure 2B,D,E).
Figure 2

(A) Differential severity of bleeding in the endovascular perforation SAH model. Only rats with equivalent hemorrhage scores were used for further experiments; (B) representative Western blots of MBP, CNPase, and NG2; (C–E) protein quantification for MBP and associated proteins, analyzed by Fusion (fx 7 Spectra, Vilber, Collégien, France). Results are presented as percentages in relation to β-actin levels; (F) myelin sheaths at 24 h after SAH evaluated by means of transmission electron microscopy, showing significant loss and fracture damage (red arrow) and clearly disordered axonal structure and damage (yellow arrow); scale bar = 1 µm (n = 3). (G) histological fluorescence staining for CNPase and NG2 in cortices of the sham group and 24 h after SAH. NG2 (labels oligodendrocyte precursor cells, red); DAPI (the nucleus, blue), CNPase (labels mature oligodendrocyte cells, green); (n = 3). scale bars: ea = 50 μm, 0.05, ** p < 0.01, *** p < 0.001 vs. sham.

3.2. Dexras1, TNF-α, and IL-1β Brain Expression Was Raised along with Glial Cell Activation after SAH In Vivo

Immunofluorescence staining was applied to determine the histological localization of Dexras1 in neurons, astrocytes, oligodendrocytes, and microglia, after SAH. Based on our data, Dexras1 was ubiquitous in neuronal cytoplasm in the neocortex and hippocampus after SAH, with no conspicuous expression in microglia, astrocytes, and oligodendrocytes (Figure 3D). Next, the Dexras1, TNF-α, and IL-1β levels, in the subcortex of the left hemisphere at different time intervals after SAH in vivo were examined by WB and ELISA. Compared with the sham group, the expression of Dexras1 after SAH clearly increased, peaking at 24 h (Figure 3A,B, p < 0.01). Relative to the control values, the expression levels of TNF-α (Figure 3G p < 0.001) and IL-1β (Figure 3H p < 0.001) were raised to different degrees. At the same time, the expression of GFAP (astrocyte marker) was also clearly enhanced after SAH (Figure 3A,C). The analysis of immunofluorescence results showed that the abundance of astrocytes and microglia was clearly increased as compared to the sham, and that astrocyte cell bodies were visibly thicker (Figure 3E,F).
Figure 3

(A). Representative Western blots of Dexras1 and GFAP; (B,C) protein quantification of Dexras1 and GFAP, analyzed by Fusion (fx 7 Spectra, Vilber, France). Results are presented as percentages in relation to β-actin levels. ** p < 0.01, *** p < 0.001 vs. sham.; (D) represeantative histological immunofluorescence staining results showing co-localization of Dexras1 in neurons, astrocytes, microglia, and oligodendrocytes in the neocortex and hippocampus of sham and 24 h post-SAH. Dexras1 (red) was detected with NeuN (neurons, green), Iba-1 (microglia, green), GFAP (astrocytes, green), and CNPase (oligodendroglia, green) in the cortex and hippocampus after SAH, DAPI (nucleus, blue), (n = 3); scale bars: ea = 50 μm; (E) fluorescent staining for GFAP and MBP in the cortex of the sham group and 24 h after SAH. (GFAP labels astrocytes, red), DAPI (nucleus, blue), MBP (labels myelin, green) (n = 3)). Scale bars: ea = 25 μm. (F) fluorescent staining of Iba-1 in the cortex of the sham group and 24 h after SAH. (Iba-1 labels microglia, green) and DAPI (nucleus, blue). Scale bars: ea = 25 μm. *** p < 0.001 vs. sham; and (G,H) representative ELISA of TNF-α and IL-1β.

3.3. The Role of Dexras1 in Glial Cell Activation, Cerebral White Matter Demyelination, and Differentiation of Oligodendrocyte Precursor Cells after SAH In Vivo

After the confirmation of effective sequences used for Dexras1 overexpression and knockdown in vitro (Figures S1 and S2), lentiviral vectors carrying respective plasmids were injected into the lateral ventricles of SD rats. It was found that six U lentivirus Dexras1+ and Dexras1− reagents could significantly increase or decrease the expression of Dexras1 after SAH, respectively (Figure 4A,B). At the same time, the rat myelin marker—myelin basic protein (MBP) expression level was further reduced in the SAH+LV- Dexras1+ rats (p < 0.05, Figure 4A,D), as compared to that in the SAH+LV-Scramble rats. However, after down-regulation by LV-Dexras1−, relative to the SAH+LV-Scramble rats, the expression of MBP significantly increased (p < 0.05, Figure 4A,D). In the rat brain cortex of the left hemisphere the immunofluorescence staining results showed that MBP expression was further reduced and the texture of the myelin sheath became weaker in the SAH +LV-Dexras1+ group (Figure 4J). In contrast, MBP expression was markedly increased and the myelin texture was clearer in the SAH +LV-Dexras1− group relative to the SAH+LV-Scramble rats (Figure 4J). Structural alterations of myelin sheaths in the corpus callosum were examined by electron microscopy. The results showed that myelin sheaths in the SAH+LV-Dexras1+ group were more severely damaged or even broken, and the axon separation became more evident when compared to alterations in the SAH+LV-Scramble rats (Figure 4H). However, the myelin sheath swelling and axon separation were clearly alleviated in the SAH +LV-Dexras1− group (Figure 4H).
Figure 4

(A) Representative Western blots of Dexras1, MBP, CNPase, NG2, GFAP, and Iba1 expression in each group (sham, SAH+LV-scramble, SAH+LV-Dexras1+ and the SAH+LV-Dexras1− with different concentrations of viral vector); (B–G) Western blot semi-quantitative analysis. Results are expressed as percentages in relation to β-actin levels. (* p < 0.05, ** p < 0.01, *** p < 0.001); (H) the loss of myelin sheaths in SAH+LV-Scramble, SAH +LV-Dexras1+ and SAH +LV-Dexras1− rats was evaluated by transmission electron microscopy. Demyelination (red arrow) and disordered axonal structure and damage (yellow arrow) were found. Scale bar = 1 µm (n = 3 for electron microscopy analysis). (* p < 0.05, ** p < 0.01); (I) histological fluorescent staining for CNPase and NG2 in the cortex of SAH+LV-Scramble, SAH +LV-Dexras1+ and SAH +LV-Dexras1− rats; NG2 (labels oligodendrocyte precursor cells, red), DAPI (labels nucleus, blue), CNPase (labels mature oligodendrocyte cells, green). Scale bar = 25 μm. (** p < 0.01, *** p < 0.001); (J) histological fluorescence staining of GFAP and MBP in the cortex of the SAH+LV-Scramble group, SAH+LV-Dexras1+, and SAH+LV-Dexras1− group. GFAP (labels astrocytes, red), DAPI (labels nucleus, blue), MBP (labels myelin, green) (n = 3), detected by fluorescence microscopy. Scale bars: ea = 25 μm. (* p < 0.05, ** p < 0.01, *** p < 0.001); (K) histological fluorescent staining for Iba-1 in the cortex of the SAH+LV-Scramble group, SAH+LV-Dexras1+, and SAH+LV-Dexras1− group; Iba-1 (labels microglia, green), DAPI (labels nucleus, blue); detected by fluorescence microscopy. Scale bars: ea = 25 μm. (* p < 0.05, *** p < 0.001); (L,M) representative ELISA of TNF-α and IL-1β. (*** p < 0.001).

Next, marker proteins for astrocyte (GFAP) and microglial (Iba1) activation were detected by WB. It was found that the expression of GFAP and Iba1 significantly increased after SAH (p < 0.05, Figure 4A,C,E). The expression of GFAP, Iba1, TNF-α, and IL-1β, was elevated in SAH+LV-Dexras1+ rats, as compared to the SAH+LV-Scramble rats, whereas this expression was significantly decreased in SAH +LV-Dexras1− group (p < 0.05, Figure 4A,C,E,L,M). In addition, the astrocyte and microglial activation marker proteins, GFAP and Iba1, respectively, were detected by immunofluorescence staining in the rat brain cortices. Astrocytic and microglial activation was increased in the SAH+LV-Dexras1+ group, relative to that in the SAH+LV-Scramble rats (Figure 4J,K). In contrast, the astrocyte and microglial activation was reduced in the SAH +LV-Dexras1− group relative to the SAH+LV-Scramble rats (Figure 4J,K). Then, the changes of CNPase (oligodendrocyte marker) and NG2 (OPC marker) levels after Dexras1 lentivirus-based interventions were investigated by WB and immunofluorescence staining. The results showed that CNPase levels in the SAH +LV-Dexras1+ group were decreased (p < 0.05, Figure 4A,G), while there was a significant increase in NG2 levels (p < 0.05, Figure 4A,F), as compared to the levels in the SAH+LV-Scramble rats. However, there was a recovery of CNPase levels in the SAH +LV-Dexras1− rats (p < 0.05, Figure 4A,G), while NG2 levels were significantly decreased in comparison to the levels in the SAH+LV-Scramble rats (p < 0.05, Figure 4A,F). The immunofluorescence results also showed that the cerebral expression of CNPase was reduced in the SAH +LV-Dexras1+ rats, accompanied with significantly disordered myelin texture. In addition, NG2 was elevated in the SAH +LV-Dexras1+ rats (Figure 4I). However, in the SAH +LV-Dexras1− rats, NG2 expression was significantly reduced relative to the SAH+LV-Scramble rats, whereas CNPase expression was elevated, accompanied with the restoration of myelin structure (Figure 4I).

3.4. Dexras1 Significantly Aggravated Neurological Deficits after SAH In Vivo

The neurological scores of rats at 24 h after SAH (24 h = 10.40 ± 0.55, n = 5, Figure 5A, p < 0.05) were drastically reduced, relative to the sham rats (18.00 ± 0.00). The scores of the SAH+LV-Dexras1+ rats (8.20 ± 0.84) were lower than those of the SAH+LV-Scramble rats (10.60 ± 0.55) (p < 0.05, Figure 5A). However, the scores of the SAH+LV-Dexras1− rats (14.20 + 0.23) were improved, relative to the SAH+LV-Scramble rats (10.60 ± 0.55) (p < 0.05, Figure 5A). Moreover, the water content of brain tissue is also an important indicator for evaluating brain damage post-SAH. Relative to the sham rats, brain tissue water content increased after SAH at 24 h (p < 0.05, Figure 5B). Relative to the SAH+LV-Scramble rats, the brain edema in the SAH +LV-Dexras1+ rats were elevated (p < 0.05, Figure 5B), while it was significantly reduced in the SAH +LV-Dexras1−rats (p < 0.05, Figure 5B).
Figure 5

(A) Analysis of neurological deficits at 24 h in each group; * p < 0.05 sham vs. SAH rats, * p < 0.05, SAH+LV-Dexras1+ vs. SAH+LV-Scramble rats, * p < 0.05 SAH+LV-Dexras1− vs. SAH+LV-Scramble rats; (B) evaluation of water content in brain tissue in each group after SAH, * p < 0.05 sham vs. SAH rats, * p < 0.05 SAH+LV-Dexras1+ vs. SAH+LV-Scramble rats, * p < 0.05 SAH+LV-Dexras1− vs. SAH+LV-Scramble rats; (C) day 6 tracks of all rats; recording was done for 90 s after training platform removal; (D) representative images of the shortest path of each group to the platform during the acquisition trials in the MWM examination; (E) the number of times each group crossed the platform; recording was done for 90 s after training platform removal, (* p < 0.05, ** p < 0.01); (F) analysis of the percentage of time rats remained in the target quadrant during the spatial exploratory test, (** p < 0.01); (G) 7 days post-SAH, rats were allowed to search for the hidden platform for 90 s; each acquisition trial was part of 4 trials, one per day, for 5 days. Data represent mean ± SD, n = 5, * p < 0.05 sham vs. SAH rats, * p < 0.05 SAH+LV-Dexras1+ vs. SAH+LV-Scramble rats, * p < 0.05 SAH+LV-Dexras1− vs. SAH+LV-Scramble rats.

The escape latencies (EL) of all five groups of rats that went through acquisition training (5 days) are illustrated in Figure 5G. All rats exhibited sizeable enhancements in the EL after 5 days of training (F (4, 76)6.063, p = 0.002, repeated measures ANCOVA), suggesting that they retained the memory of the escape platform (EP). Repeated measures ANCOVA suggested no relationship between training days and groups (F (4, 76)329.454, p = 0.003). Hence, all the animals had learned the task adequately. Moreover, the EL of the SAH rats was significantly longer, relative to the sham rats (F (4, 76)14.78, p < 0.0001, Figure 5G). In addition, the SAH+ LV-Dexras1+ group showed clearly aggravated learning deficiencies (F (4, 76)2.955, p = 0.0252, Figure 5G) while the SAH +LV-Dexras1− group did not (F (4, 76)3.732, p = 0.0079, Figure 5G). After the platform was removed, the results indicated that the residence time and the number of platform crossings of the SAH rats were markedly reduced as compared to those of the sham rats (p < 0.01, Figure 5C–F). The SAH+ LV-Dexras1+ rats showed further reductions relative to the SAH+LV-Scramble rats (p < 0.01, Figure 5C–F). However, in the SAH +LV-Dexras1− group, the residence time, distance, and the number of crossing the platform increased after SAH (p < 0.01, Figure 5C–F).

3.5. Dysdifferentiation of Oligodendrocyte Precursor Cells Occurred in the In Vitro SAH and Was Susceptible to Dextras1 Modulation

In the experiments that followed, we tested the differentiation of oligodendrocyte precursor cells in the model of SAH in vitro and in co-culture with IGF-treated cells. The results showed that the differentiation and maturation of OLN-93 oligodendrocyte precursor cells were inhibited after SAH (Figure 6A). WB also revealed that NG2 expression was markedly elevated and CNPase was clearly reduced post-SAH in IGF−1-co-cultured cells (p < 0.05, Figure 6B,C).
Figure 6

(A) Immunofluorescence detection of oligodendrocyte precursor cell differentiation after in vitro subarachnoid hemorrhage, serum-free culture of oligodendrocyte cell line (a), IGF−1 and serum-free medium promote oligodendrocyte cell line differentiation (b), co-culture of sham group neurons and oligodendrocyte cell line treated with IGF−1 (c), co-culture of SAH group neurons and oligodendrocyte cell line treated with IGF−1 (d). OPCs (NG2, red), OLGs (CNPase, green). Scale bars ea = 25 μm. (** p < 0.01, *** p < 0.001); (B) protein expression of NG2 and CNPase after 24 h in vitro co-culture with oligodendrocyte cell treated with IGF−1; (C) NG2 and CNPase protein quantification via Fusion (fx 7 Spectra, Vilber, France). Data are given as percentages relative to the β-actin level. (* p < 0.05, ** p < 0.01, *** p < 0.001); (D) immunofluorescence detection of oligodendrocyte precursor cell line differentiation in vitro IGF−1 and serum-free medium with SAH, SAH+LV-Scramble, SAH+LV-Dexras1+, and SAH+LV-Dexras1− rats. Co-culture of SAH group neurons and oligodendrocyte cells treated with IGF−1 (a), co-culture of SAH+LV-Scramble group neurons and oligodendrocyte cells treated with IGF−1 (b), co-culture of SAH+LV-Dexras1+ group neurons and oligodendrocyte cell line treated with IGF−1 (c), co-culture of SAH+LV-Dexras1− group neurons and oligodendrocyte cells treated with IGF−1 (d). OPCs (NG2, red), OLGs (CNPase, green), Scale bars: ea = 25 μm. (** p < 0.01, *** p < 0.001); (E) protein expression of NG2 and CNPase after 24 h in vitro co-culture of each group with oligodendrocyte cells treated with IGF−1 (** p < 0.01, *** p < 0.01); (F) NG2 and CNPase protein quantification via Fusion (fx 7 Spectra, Vilber, France.) Data are percentages relative to the β-actin level. (* p < 0.05, ** p < 0.01).

Additionally, the immunofluorescence data revealed that after upregulation of Dexras1, CNPase levels were reduced and NG2 was further increased in the SAH +LV-Dexras1+ rats (Figure 6D). In contrast, CNPase was elevated, while NG2 was significantly reduced in the SAH +LV-Dexras1− rats relative to the SAH+LV-Scramble rats (Figure 6D). Moreover, the WB results also showed that the CNPase levels were further decreased (p < 0.05, Figure 6E,F), while NG2 levels were further significantly increased in the SAH +LV-Dexras1+ rats, relative to the SAH+LV-Scramble rats (p < 0.05, Figure 6E,F). On the contrary, in the SAH +LV-Dexras1− group, the expression of CNPase increased (p < 0.05, Figure 6E,F), whereas NG2 expression significantly decreased, as compared to SAH+LV-Scramble group levels (p < 0.05, Figure 6E,F).

3.6. Dexras1 May Inhibit the Differentiation of Oligodendrocyte Precursor Cells through the cAMP-CREB Pathway

After up-regulation of Dexras1, the expression of IL-1β and TNF-α was elevated in the SAH+LV-Dexras1+ rats relative to the SAH+LV-Scramble rats (p < 0.05, Figure 7A,B,D), accompanied by significant decreases in CREB and pCREB protein levels (p < 0.05, Figure 7A,C). In addition, the expression of IL-1β and TNF-α was significantly lower in the SAH +LV-Dexras1− rats, relative to the SAH+LV-Scramble rats (p < 0.05, Figure 7A,B,D), accompanied with significantly increased CREB and pCREB protein levels (p < 0.05, Figure 7A,C). Similar to previous experimental results from the in vivo SAH model, it was found that CREB expression was significantly reduced in the SAH in vitro, and IL-1β and TNF-a levels were significantly increased (Figure 7A–D).
Figure 7

(A) Western blot detection of Dexras1, CREB, and pCREB protein expression after intervention with LV-Dexras1+ or LV-Dexras1−; (B,C) Western blot analysis (* p < 0.05, *** p < 0.001); (D) ELISA analysis of the expression of IL−1β and TNF-α(* p < 0.05).

In contrast, CREB and pCREB expression was significantly elevated after administering 8-Bromo-cAMP sodium salt, while the IL-1β and TNF-α levels were drastically decreased (p < 0.05, Figure 8A–C). These results indicate that 8-Bromo-cAMP sodium salt activates the expression and signaling activity of the cAMP-CREB pathway. Next, we found that the levels of CREB and pCREB in the Dexras1+ (overexpression)+8-Bromo-cAMP group were significantly lower than in the SAH+8-Bromo-cAMP group, accompanied with a reduction in CNPase (p < 0.05, Figure 8D,E,F). However, the levels of CREB and pCREB in the Dexras1− (knockdown)+8-Bromo-cAMP group were significantly higher than in the SAH+8-Bromo-cAMP group, accompanied by an increase in CNPase (p < 0.05, Figure 8D,E,F). Further investigation revealed that TNF-α, IL-1β, and NG2 levels were elevated in the SAH+8-Bromo-cAMP+Dexras1+ group, relative to the SAH+8-Bromo-cAMP-group (p < 0.05, Figure 8D,G). However, TNF-α, IL-1β, and NG2 levels in the cells of SAH+8-Bromo-cAMP+Dexras1− group were considerably reduced as compared to the levels in SAH+8-Bromo-cAMP-treated cells (p < 0.05, Figure 8D,G).
Figure 8

(A) Representative Western blots of Dexras1, CREB, and pCREB expression after in vitro subarachnoid hemorrhage with the activation by different 8-Bromo-cAMP sodium salts; (B) Western blot analysis of Dexras1, CREB, and pCREB. Results are percentages relative to β-actin levels. (* p < 0.05); (C) the results of ELISA used to detect IL-1β and TNF-α levels, (** p < 0.01); (D) immunofluorescence detection of oligodendrocyte precursor cell line differentiation after in vitro subarachnoid hemorrhage in each group, co-culture of SAH+8-Bromo-cAMP group neurons and oligodendrocyte cells treated with IGF−1 (a), co-culture of SAH+8BMP+Dexras1+group neurons and oligodendrocyte cells treated with IGF−1 (b), co-culture of SAH+8-Bromo-cAMP+Dexras1−group neurons and oligodendrocyte cells treated with IGF−1 (c), OPCs (NG2, red), OLGs (CNPase, green). Scale bars: ea = 25 μm. (* p < 0.05, ** p < 0.01); (E) representative Western blots of Dexras1, CREB, and pCREB after 8-Bromo-cAMP sodium salt treatment combined with Dexras1 overexpression or knockdown after subarachnoid hemorrhage in vitro; (F) Western blot semi-quantitative analysis of Dexras1, CREB, and pCRE. Results are percentages relative to β-actin levels. (* p < 0.05, ** p < 0.01, *** p < 0.001) (G). ELISA results show IL-1β and TNF-α levels. (** p < 0.01).

4. Discussion

A growing body of research evidence demonstrates the presence of demyelination injury after SAH [25], but there is only a limited number of studies on the underlying mechanism. In this study, we found morphological myelin damage and dysdifferentiation of oligodendrocytes after SAH. Simultaneously, Dexras1 levels increased significantly, and further functional research showed that Dexras1 is related to myelin damage and the impaired oligodendrocyte differentiation. Further research revealed that Dexras1 may cause the impairment of oligodendrocyte differentiation by inhibiting the cAMP-CREB pathway after SAH (Figure 9).
Figure 9

Schematic diagram of the regulatory role of Dexras1 in SAH.

The damage caused by SAH includes neuronal necrosis and apoptosis, delayed cerebral ischemia, and the disruption of the blood-brain barrier. The difference between this present and previously reported research approach is that we focus on white matter damage, which is mainly manifested by myelin damage and oligodendrocyte differentiation disorder. As opposed to gray matter damage, white matter injury is more sensitive to ischemia although being reversible after the brain insult. This reminds us not only to pay attention to neuronal injury, but also to take into account the myelin damage when conducting research on SAH. Oligodendrocyte precursor cells (OPCs) are the main source of mature oligodendrocytes in CNS, and their impaired differentiation is one of the main causes of demyelination in diseases such as multiple sclerosis and autoimmune encephalitis [8,26]. However, there are few studies dealing with the role of oligodendrocyte differentiation disorders in neurological dysfunction after SAH. This study showed that OPC differentiation disorder took place after SAH, although it could resolve over time. In a previous study, Joseph, M.J [27] showed that the differentiation of OPCs was hindered after intracerebral hemorrhage. We have found that the OPC differentiation disorder occurs acutely, in the early stage after SAH, thus being different from the oligodendrocyte differentiation disorder caused by multiple sclerosis. This may suggest that effective intervention in the early stage of SAH will help to improve the outcome and further prognosis. Moreover, previous studies have found an evident inflammatory response in the early stages after SAH. Our study likewise found that TNF-a and IL-1β brain levels increased significantly at 24 h after SAH, accompanied with the impairment of oligodendrocyte differentiation. Therefore, these results show that inflammatory factors may play a pivotal role in inhibiting the differentiation of OPCs. Hence anti-inflammatory interventions in addition to those based on stem cells, biomaterials, and nanoparticles, may become viable therapeutic options for OPC differentiation disorders [28] and should be studied for the treatment of SAH in the future. Dexras1 is a small G protein activated by nitric oxide (NO), which is excessively produced in activated microglia/macrophages as well as in neurons [29]. The research done so far on Dexras1 mainly focused on regulating circadian rhythms, tumor cell apoptosis, and calcium ion channels [30,31]. However, Khan et al. [9] found an improvement to myelin damage in experimental optic neuritis after Dexras1 knockdown, which may suggest that Dexras1 modulates myelin damage. We hypothesize that Dexras1 can be also involved in the myelin damage after SAH. Interestingly, in this present study we found that Dexras1 levels significantly increased after subarachnoid bleeding. Further investigations revealed that Dexras1 was involved in WMD after SAH, by mediating the mechanism of OPC differentiation impairment and a subsequent myelin damage. These findings further support the notion that Dexras1 is involved in white matter damage after SAH. Although in this study we provided a novel insight into the mechanisms of brain injury after SAH, several shortcomings still remain in this regard. For example, we found that there was a positive correlation between the intensity of inflammation and oligodendrocyte differentiation disorder, as well as myelin damage after SAH. However, in order to establish the direct relationship between inflammation, oligodendrocyte differentiation disorder, and myelin damage after SAH, further study is required. In addition, we have investigated the role of Dexras1 only in WMD after SAH. Importantly, the mechanisms of Dexras1−mediated modes of cell death after SAH, such as apoptosis, ferroptosis, and pyroptosis, still need to be explored in future studies, which we are planning to pursue.

5. Conclusions

In summary, in this study we found that Dexras1 may mediate oligodendrocyte differentiation impairment and myelin damage after SAH, and explored the underlying mechanisms. These results may pave the way for further studies of WMD after SAH and provide the molecular basis for novel therapeutic interventions.
  31 in total

1.  GluR1 protects hypoxic ischemic brain damage via activating Akt signaling pathway in neonatal rats.

Authors:  J-Z Huang; Y Ren; Y Jiang; S-Y Shen; J Ding; F Hua
Journal:  Eur Rev Med Pharmacol Sci       Date:  2018-12       Impact factor: 3.507

Review 2.  Subarachnoid Hemorrhage.

Authors:  Michael T Lawton; G Edward Vates
Journal:  N Engl J Med       Date:  2017-07-20       Impact factor: 91.245

3.  White Matter Injury After Subarachnoid Hemorrhage: Role of Blood-Brain Barrier Disruption and Matrix Metalloproteinase-9.

Authors:  Yusuke Egashira; Hao Zhao; Ya Hua; Richard F Keep; Guohua Xi
Journal:  Stroke       Date:  2015-09-15       Impact factor: 7.914

4.  Controversies and evolving new mechanisms in subarachnoid hemorrhage.

Authors:  Sheng Chen; Hua Feng; Prativa Sherchan; Damon Klebe; Gang Zhao; Xiaochuan Sun; Jianmin Zhang; Jiping Tang; John H Zhang
Journal:  Prog Neurobiol       Date:  2013-09-25       Impact factor: 11.685

Review 5.  Dexras1: shaping the responsiveness of the circadian clock.

Authors:  Hai-Ying Mary Cheng; Karl Obrietan
Journal:  Semin Cell Dev Biol       Date:  2006-04-03       Impact factor: 7.727

Review 6.  Small G Proteins Dexras1 and RHES and Their Role in Pathophysiological Processes.

Authors:  Ashish Thapliyal; Rashmi Verma; Navin Kumar
Journal:  Int J Cell Biol       Date:  2014-03-20

7.  Rasd1, a small G protein with a big role in the hypothalamic response to neuronal activation.

Authors:  Michael P Greenwood; Mingkwan Greenwood; Andre S Mecawi; José Antunes-Rodrigues; Julian F R Paton; David Murphy
Journal:  Mol Brain       Date:  2016-01-07       Impact factor: 4.041

8.  AVE 0991 attenuates oxidative stress and neuronal apoptosis via Mas/PKA/CREB/UCP-2 pathway after subarachnoid hemorrhage in rats.

Authors:  Jun Mo; Budbazar Enkhjargal; Zachary D Travis; Keren Zhou; Pei Wu; Guangyu Zhang; Qiquan Zhu; Tongyu Zhang; Jianhua Peng; Weilin Xu; Umut Ocak; Yili Chen; Jiping Tang; Jianmin Zhang; John H Zhang
Journal:  Redox Biol       Date:  2018-09-28       Impact factor: 11.799

9.  CIRBP Ameliorates Neuronal Amyloid Toxicity via Antioxidative and Antiapoptotic Pathways in Primary Cortical Neurons.

Authors:  Fang Su; Shanshan Yang; Hongcai Wang; Zhenkui Qiao; Hong Zhao; Zhengyi Qu
Journal:  Oxid Med Cell Longev       Date:  2020-02-26       Impact factor: 6.543

10.  Nimodipine Reduces Dysfunction and Demyelination in Models of Multiple Sclerosis.

Authors:  Roshni A Desai; Andrew L Davies; Natalie Del Rossi; Mohamed Tachrount; Alex Dyson; Britta Gustavson; Pardis Kaynezhad; Lewis Mackenzie; Marieke A van der Putten; Daniel McElroy; Dimitra Schiza; Christopher Linington; Mervyn Singer; Andrew R Harvey; Ilias Tachtsidis; Xavier Golay; Kenneth J Smith
Journal:  Ann Neurol       Date:  2020-05-06       Impact factor: 10.422

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.