| Literature DB >> 36230897 |
Ju-Yong Song1, Jae-Suh Park2, Joo-Hwan Kim3, Joon-Ho Wang3, Holly C Heck4,5, Bruce E Heck4,5, Dong-Hyun Kim2,4, Keon-Hee Yoo1,2.
Abstract
Osteoarthritis (OA) is a chronic degenerative joint disease accompanied by an inflammatory milieu that results in painful joints. The pathogenesis of OA is multifactorial, with genetic predisposition, environmental factors, and traumatic injury resulting in the direct or indirect loss of cartilage. The articular cartilage can also be damaged by direct focal traumatic injury. Articular cartilage provides a smooth, deformable bearing surface with a low coefficient of friction, increased contact area, and reduced contact stress. Articular type II hyaline cartilage lines the synovial joints and, when injured, has a limited ability for repair, except for the most superficial layers via diffusion from the synovial fluid, secondary to no blood supply, a complex structure, and a low metabolic rate. Restoring the articular surface can relieve pain and restore function. Although many strategies have been developed to regenerate type II collagen based on the extent of the lesion, surgical treatments are still evolving. The peroxisome proliferator-activated receptor delta (PPARδ) agonist and collagen treatment of mesenchymal stem cells (MSCs) enhance the chondrogenic capacity in vitro. We present a novel technique for cartilage restoration in a rabbit cartilage osteochondral defect model using a PPARδ agonist (GW0742)-infused 3D collagen scaffold to induce type II cartilage from MSCs.Entities:
Keywords: 3D collagen scaffold; mesenchymal stem cells; osteoarthritis; peroxisome proliferator-activated receptor delta; type II collagen; type II hyaline cartilage
Mesh:
Substances:
Year: 2022 PMID: 36230897 PMCID: PMC9564068 DOI: 10.3390/cells11192934
Source DB: PubMed Journal: Cells ISSN: 2073-4409 Impact factor: 7.666
Sequence of primers used for RT-PCR studies.
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| COL2A1 | GGCAATAGCAGGTTCACGTACA | CGATAACAGTCTTGCCCCACTT |
| GAPDH | TCAACGGATTTGGTCGTATTGGG | TGATTTTGGAGGGATCTCGC |
Figure 1Generation and observation of cartilage-implantable bio-printed scaffolds. (a) Schematic showing a generation of the MSC scaffold with the presence or absence of TGF-β or GW0742; (b) representative image of macroscopic and microscopic observations of bio-printed scaffolds on day 0 and day 15; (c) representative image of microscopic observations of bio-printed scaffolds on days 0, 7, and 15, with alcian blue staining of chondrogenic differentiation on day 15; and (d) representative image of bio-printed scaffold and alcian blue staining after chondrogenesis.
Figure 2Ex vitro evaluation of chondrogenic differentiation capacity. (a) Illustrative scheme describing the experimental design; (b) macroscopic observation of collagen-based scaffolds seeded with WJ-MSCs with the presence or absence of TGF-β or GW0742; (c) alcian blue staining of the scaffolds cultured with chondrogenic differentiation medium for 28 days; (d) reverse-transcription PCR analysis of type II collagen expression from MSCs derived from 2 different donors in the scaffold presence or absence of chondrogenesis inducers (10 ng/mL of TGF-β or 1 μM/mL of GW0742).
Figure 3Gross observations of cartilage defect and regeneration by bio-printed scaffolds. (a) Scheme of cartilage defect generation and constitution of experimental group. Eight- to nine-week-old New Zealand white rabbits were divided into four groups (defect, scaffold, scaffold with TGF-β, and scaffold with GW0742). Cartilage defects with a 5 mm diameter and 3 mm depth at the trochlear groove and distal femur were generated by surgery. The same size of bio-printed scaffold was implanted at the defect. At 12 weeks of implantation, rabbits were sacrificed to analyze cartilage regeneration. (b) Macroscopic observations of repaired defects in the four groups at 12 weeks after implantation (i. defect, ii. WJ-MSCs, iii. TGF-β, iv. GW0742; the yellow circle indicates the site of the defect); scale bar: 10 mm. (c) Macroscopic ICRS scores and comparison of each group at 12 weeks after implantation. ICRS macroscopic scoring was of cartilage regeneration presence or absence on bio-printed scaffold. Data are represented as means ± SD.
Figure 4Histological analysis of repaired cartilage by bio-printed scaffold. Representative image of repaired cartilage at 12 weeks. (a) Histological observation of cartilage repair of a representative sample in each group at 12 weeks after implantation (a. defect, b. WJ-MSCs, c. TGF-β, d. GW0742; H&E staining); scale bar: 400 µm and 100 µm for each. (b) Histological evaluation of cartilage recovery using the ICRS Visual Histological Assessment Scale and group comparisons at 12 weeks. Data are represented as means ± SD.
Figure 5Immunohistology staining of collagen II. (a) Immunohistological observations of cartilage repair for a representative sample in each group after 12 weeks. Scale bar: 2 mm and 100 µm for each type II collagen staining. (b) Histological observations of each layer of the groups. The figure shows a representative sample in each group after 12 weeks. Scale bar: 100 µm; type II collagen staining.