Literature DB >> 36227903

Loss of Ecrg4 improves calcium oxalate nephropathy.

Daniela Cabuzu1,2, Suresh K Ramakrishnan1,2, Matthias B Moor1,2, Dusan Harmacek1,2, Muriel Auberson1, Fanny Durussel1,2, Olivier Bonny1,2,3.   

Abstract

Kidney stone is one of the most frequent urinary tract diseases, affecting 10% of the population and displaying a high recurrence rate. Kidney stones are the result of salt supersaturation, including calcium and oxalate. We have previously identified Esophageal cancer-related gene 4 (Ecrg4) as being modulated by hypercalciuria. Ecrg4 was initially described as a tumor suppressor gene in the esophagus. Lately, it was shown to be involved as well in apoptosis, cell senescence, cell migration, inflammation and cell responsiveness to chemotherapy. To the best of our knowledge, nothing is known about ECRG4's function in the renal tissue and its relationship with calciuria. We hypothesized that the increased expression of Ecrg4 mRNA is triggered by hypercalciuria and might modulate intratubular calcium-oxalate precipitation. In this study, we have first (i) validated the increased Ecrg4 mRNA in several types of hypercalciuric mouse models, then (ii) described the Ecrg4 mRNA expression along the nephron and (iii) assessed ECRG4's putative role in calcium oxalate nephropathy. For this, Ecrg4 KO mice were challenged with a kidney stone-inducing diet, rich in calcium and oxalate precursor. Taken together, our study demonstrates that Ecrg4's expression is restricted mainly to the distal part of the nephron and that the Ecrg4 KO mice develop less signs of tubular obstruction and less calcium-oxalate deposits. This promotes Ecrg4 as a modulator of renal crystallization and may open the way to new therapeutic possibilities against calcium oxalate nephropathy.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 36227903      PMCID: PMC9560046          DOI: 10.1371/journal.pone.0275972

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Prevalence of chronic kidney diseases and of kidney stones is constantly increasing [1]. In both conditions, supersaturation of calcium-oxalate salts and crystal formation may result either in obstruction of renal tubules or in stone formation. Thus, hypercalciuria and hyperoxaluria are two major risk factors for crystallogenesis in urine [2]. We have previously identified the Ecrg4 gene as upregulated in hypercalciuric mice. Highly conserved from fish to humans, Ecrg4 encodes a 148 amino acids precursor protein that can be processed into various peptides, without identified regulatory proteases [3]. Ecrg4 mRNA can be found in various tissues, such as brain, esophagus, heart and kidney, whereas, the protein ECRG4 was documented in the heart and adrenal gland [4]. The functions of ECRG4 and derived peptides are still largely unknown. It was first speculated that Ecrg4 might be a tumor suppressor gene, due to its decreased expression in esophageal cell carcinomas, while still detectable in the normal esophageal epithelia surrounding the tumor [5]. Yet, in vivo studies have extended the anti-tumoral role of Ecrg4 to glioma and to prostate, colorectal and breast cancer [6-8]. Further, Ecrg4’s overexpression was shown to affect apoptosis, cell senescence, cell migration, inflammation and cell responsiveness to chemotherapy [3]. Its activity depends on its cellular localization, secretion and processing, which argues for a non-traditional tumor suppressor action, and rather for a role close to a cytokine/chemokine. Downstream genes that were shown to be activated by Ecrg4 include Nfkb1, Nfkb2, P53 and Cox2 [3]. Ecrg4’s role in the kidney and especially in hypercalciuria is unknown. Due to its higher expression in a hypercalciuric mouse model, we hypothesized that Ecrg4 mRNA is triggered by hypercalciuria and might modulate kidney stone formation. In the present work, we first describe Ecrg4 mRNA expression in the kidney. Second, we show that Ecrg4 expression is increased in various hypercalciuric mouse models. Third, we assessed the potential role of Ecrg4 in kidney stone formation by challenging Ecrg4 KO and control mice with a diet inducing hypercalciuria and hyperoxaluria. We found substantial protection against calcium oxalate nephropathy in male mice devoid of Ecrg4. In total, this piece of data points towards Ecrg4 as a potential regulator of calciuria and stone formation.

Materials and methods

Animals

The State veterinarian Office (Office vétérinaire cantonal, Canton de Vaud, Switzerland) approved all animal studies (authorization numbers VD3261 and VD2987). All breeding and cohort colonies were hosted in our animal facility under approved protocols. Mice were housed four to five per cage, with free access to water and food (standard mouse diet #3800, KLIBA, Kaiseraugst, Switzerland), in a temperature and humidity-controlled room with an automatic 12/12-h light/dark cycle. Heterozygous Ecrg4 mice were purchased from the Mutant Mouse Regional Resource Center (B6;129S5-1500015O10Riktm1Lex/Mmucd). In this model, coding exon 1 of the RIKEN cDNA 1500015O10 gene was targeted by homologous recombination. Mice were backcrossed for 10 generations and heterozygous males and females were bred in order to obtain Ecrg4-/- (KO) mice. Littermates Ecrg4+/+ have been used as controls for all experiments. Kidney-specific sodium-calcium exchanger 1 (NCX1) Ncx1-knockout mice (Pax8-LC1-Cre NCX1fl/fl) were also used in the study (unpublished, manuscript in preparation). Claudin-2 (Cldn2) KO mice (B6; 129S5-Cldn2tm1Lex/Mmucd) were purchased from Mutant Mouse Regional Resource center.

Microdissection of nephron segments

Mice were deeply anesthetized by intraperitoneal injection with Ketanarkon (Streuli Pharma AG, Uznach, Switzerland; 100 μg/g body weight) and Rompun (Bayer, Leverkusen, Germany; 10 μg/g body weight), and the left kidney was perfused first with PBS, then with DMEM/F12 (1:1, Life Technologies, Carlsbad, USA) supplemented with 40 mg/ml of Liberase Blendzyme 2 (Roche, Basel, Switzerland). Thin slices of the kidney were cut along the corticomedullary axis and incubated 40–60 min at 37°C in the same DMEM/F12/Liberase medium. Then, the kidney slices were transferred into DMEM/F12 (1:1) alone to stop the digestion, and the microdissection was performed under a magnifier in ice-cold 0.05%BSA/DMEM/F12. The proximal convoluted tubule (PCT), the thick ascending limb (TAL), distal convoluted tubule and cortical connecting tubule (DCT-CNT), and the cortical collecting duct (CD) were isolated based on their specific morphology.

RNA extraction and quantitative PCR

Microdissected tubules

Immediately after microdissection, tubules were subjected to RNA extraction using the RNeasy Micro Kit (# 74004, Qiagen, Hilden, Germany) according to the manufacturer instructions.

Other tissues

RNA from kidneys of mice injected with 1,25(OH)2-vitamin D and PTH as previously described [9], was used to assess the Ecrg4 expression. Tissues were homogenized in TRIzol® Reagent solution (#15596026 Thermo Fisher, Waltham, USA) followed by extraction with 1-bromo-3-chloropropane reagent (BCP, Molecular Research Center, Cincinnati, USA) and isopropanol precipitation. RNA (1 μg) was reverse transcribed using PrimeScript RT reagent kit (#RR037B Takara Biotechnology, Otsu, Japan) according to manufacturer’s guidelines. TaqMan Gene Expression Assays (#4370074, Applied Biosystems, Warrington,UK) was used to detect Ecrg4 (Mm00470447_m1), together with Actb (Mm4351315_m1). Other genes were quantified using SYBR green PCR master Mix (#4367659, Applied Biosystems, Warrington,UK). The primers used are listed in Table 1. Primers were ordered from Microsynth (Balgach, Switzerland). Quantitative real-time PCRs were carried out on an ABI PRISM 7500 equipment (Applied Biosystems, Warrington,UK). If the cycle threshold (CT) were >36, the expression was considered as null. The relative expression of the genes was calculated using the comparative 2−ΔΔCT method.
Table 1

Primers sequences.

Atp2b4 F CTT AAT GGA CCT GCG AAA GC Atp2b4 R ATC TGC AGG GTT CCC AGA TA
Aqp2 F TTC GAG CTG CCT TCT ACG TG Aqp2 R GGA AGA GCT CCA CAG TCA CC
Actb F GTC CAC CTT CCA GCA GAT GT Actb R AGT CCG CCT AGA AGC ACT TGC
Cyp24a1 F GAA GAT GTG AGG AAT ATG CCC TAT TT Cyp24a1 R CCG AGT TGT GAA TGG CAC ACT
Cyp27b1 F ATG TTT GCC TTT GCC CAG AG Cyp27b1 R GAC GGC ATA TCC TCC TCA GG
Calb1 F ATT TCG ACG CTG ACG GAA GT Calb1 R GTG GGT AAG ACG TGA GCC A
Cldn2 F AAG GTG CTG CTG AGG GTA GA Cldn2 R AGT GGC AGA GAT GGG ATT TG
Cldn14 F ACC CTG CTC TGC TTA TCC Cldn14 R GCA CGG TTG TCC TTG TAG
Cldn16 F CAAACGCTTTTGATGGGATTC Cldn16 R TTTGTGGGTCATCAGGTAGG
Casr F CAC AGT TGC CTT GTG ATC CTC Casr R ATG CAG AGG TGT AGG GTG GT
Cox2 F GCC TAC TAC AAG TGT TTC TTT TTG CA Cox2 R CAT TTT GTT TGA TTG TTC ACA CCA T
Nfkb1 F GAA ATT CCT GAT CCA GAC AAA AAC Nfkb1 R ATC ACT TCA ATG GCC TCT GTG TAG
Nfkb2 F CTG GTG GAC ACA TAC AGG AAG AC Nfkb2 R ATA GGC ACT GTC TTC TTT CAC CTC
Pvalb F CAG CGC TGA GGA CAT CAA GA Pvalb R AGT CAG CGC CAC TTA GCT TT
Pthr1 F CAG ACG ATG TCT TTA CCA AAG Pthr1 R TCC ACC CTT TGT CTG ACT CC
Slc9a3 F CTT CAA ATG GCA CCA CGT CC Slc9a3 R AAT AGG GGG CAG CAG GTA GA
Slc8a1 F AGA GCT CGA ATT CCA GAA CGA TG Slc8a1 R TTG GTT CCT CAA GCA CAA GGG AG
Trpv5 F TCC TTT GTC CAG GAC TAC ATC CCT Trpv5 R TCA AAT GTC CCA GGG TGT TTC G
Vdr F GGA TCT GTG GAG TGT GTG GAG ACC Vdr R CTT CAT CAT GCC AAT GTC CAC GCA G

Metabolic and endocrine studies

Male and female mice aged 6 weeks were housed individually in metabolic cages (Tecniplast, Buguggiate, Italy) for 2 days in order to be habituated before baseline urine collection, with free access to water and food. After the habituation period, control and Ecrg4 KO mice were fed either the chow diet or the crystal forming diet CaOx (1.5% Calcium Chloride and 2% Hydroxyl-L-proline) for 8 days. Twenty-four hour urine collection was repeated on day 1 and day 8, by housing the mice in metabolic cages. Urine sodium and potassium concentrations were determined by flame photometry (Instrumentation laboratory), while the urine creatinine, calcium and magnesium concentrations were measured in the Laboratoire Central de Chimie Clinique, Lausanne University Hospital (Lausanne, Switzerland). Urine osmolality was measured with an automated freezing point osmometer (Advanced model 2020 Multi-Sample Osmometer, Advanced Instruments, Norwood, USA) and the urine pH using a pH-meter (#6.0224.100, Metrohm, Herisau, Switzerland). The Laboratoire Central de Chimie Clinique, Lausanne University Hospital (Lausanne, Switzerland), measured all the blood parameters unless otherwise specified. Creatinine concentration was measured using the enzymatic method. For the dihydrotachysterol experiment, the chow diet of control male mice was supplemented with 1.5 mg/kg dihydrotachysterol (D9257, Merk, Kenilworth, USA) during 7 consecutive days. Treatments with 1,25(OH)2-vitamin D or PTH were previously reported in [9]. In brief, male C57BL/6N mice aged 13 to 15 weeks received a subcutaneous injection of 2 μg/kg body weight 1,25(OH)2‐vitamin D3 (#D1530, Sigma Aldrich, St. Louis, USA), dissolved in ethanol 1% and 99% of NaCl 0.9%. Control mice were injected with 1% (v/v) ethanol in NaCl 0.9%. The mice were dissected 6 hr after injection. For the analysis of organs from PTH-treated animals, material harvested from a previous study was used [9]. In this study, male 12–13 weeks old C57BL/6N mice received a subcutaneous injection of 80 μg/kg body weight human PTH 1–34 (#P3796, Sigma Aldrich, St. Louis, USA) dissolved in NaCl 0.9% or NaCl 0.9% alone as vehicle. Animals were dissected 2 hours after injection. For the acute furosemide experiment, male C57BL/6N mice aged 12 weeks received a single intraperitoneal injection (Lasix, Sanofi-Aventis, Switzerland; 20mg/kg body weight) diluted in saline solution. The control group received an intraperitoneal injection of NaCl 0.9%. The mice were sacrificed after 15min, 30min, 60min or 240min and the kidneys were immediately harvested. For the chronic furosemide experiment, male C57BL/6N mice aged 12 weeks received a daily intraperitoneal injection for 6 days of either furosemide diluted in saline solution (20mg/kg body weight), or saline solution for the control mice. The mice were sacrificed at day 7 and the kidneys were harvested.

Kidney histology and crystals

Left kidneys were fixed in 4% paraformaldehyde, embedded in paraffin and 5μm sections were cut. Sections were then stained with Pizzolato and H&E. Images were taken on Leica DMi8 microscope. To determine the area of calcium oxalate crystals (stained in black by Pizzolato) over the kidney’s surface area, images were obtained at x10, and analyzed with ImageJ. The result was expressed as percentage of black area over the whole kidney area. Similarly, ImageJ software was used for the analysis of tubular dilatation on H&E-stained kidney sections. The investigator was blinded of the code when analysis were performed.

Western blot and immunostaining

Antibodies against ECRG4 used in the study were from the following sources: Santa Cruz Biotechnology (H-118, USA), Sigma Aldrich (HPA008546, St. Louis, USA), LS Bio (LS-C172856, Seattle, USA), Phoenix Pharmaceuticals (012–25, Mannheim, Germany) and actin (#A2066, Sigma Aldrich, St. Louis, USA). For each of the antibodies, we have used dilutions in the range of 1:500 to 1:50. Each of the primary antibody was used for Western blot, immunohistochemistry and immunofluorescence. Secondary antibodies used were Jackson Immuno Research Anti/Rabbit (111-035-003) or Anti-Mouse (115-035-003), AlexaFluor488 (1:2000 diluted in blocking buffer without BSA, Invitrogen, Carlsbad, USA). Antibodies against PTHR1 (#sc-12722, Santa Cruz Biotechnology, USA), TRPV5 (developed in house and validated in PMID: 24557712), CLDN2 (#32–5600, Thermo Scientific, Rockford, USA), PVALB, CASR (#MA1-934, Thermo Scientific, Rockford, USA) were used as 1:500 dilution. For protein extraction, tissues were homogenized in RIPA buffer (Tris pH 7.2 50 mM, NaCl 150 mM, NP40 1%, SDS 0.1%, Na-deoxycholate 0.5% with proteases inhibitor), using TissueLyser (Qiagen, Hilden, Germany). Following the centrifugation (12,000 rpm for 15 min) and supernatants collection, total protein concentration was determined using a BCA protein assay kit (#23227, Thermo Fisher, Waltham, USA). Protein separation was done on 10% and 13% respectively, SDS polyacrylamide gels and blotted onto nitrocellulose membrane (Whatman, Dassel, Germany). Detection was done by chemiluminescence (#34579, Super Signal West Pico, Thermo Scientific, Rockford, USA).

Immunohistochemistry

Organs were fixed in 4% paraformaldehyde in Phosphate Buffer Solution and then embedded in paraffin before being cut as 5μm-thick sections. Sections were first hydrated gradually through decreasing concentrations of ethanol and then washed in deionized water. Antigen unmasking was done in 10mM sodium citrate buffer, pH 6.0, for 1h at 96°C, followed by incubation in 0.3% hydrogen peroxide for 10 min at room temperature, and by 1h in blocking buffer (NP-40 0.5%, BSA 2%, normal goat serum (NGS) 3% in PBS). Sections were incubated with primary antibodies for 1h at room temperature. Primary antibodies were washed in PBS three times for 5 min, followed by incubation with anti-mouse or anti-rabbit serum as appropriate for 30 min and developed in 3,3’-diaminobenzidine (DAB substrate kit, #ab64238, Abcam, Cambridge, UK). Lastly, they were counterstained with Nuclear Fast Red Solution (6409-77-4, Merck, Kenilworth, USA).

Immunofluorescence

Deeply anesthetized mice were perfused via cardiac puncture with 4% paraformaldehyde in PBS. Harvested organs were incubated in 30% sucrose in PBS for at least 24 h before being embedded in Tissue-Tek OCT compound (#4583,Sakura Finetek, Alphen aan den Rijn, The Netherlands) and cut as 7μm-thick sections. Sections were incubated 1 h with blocking buffer (NP-40 0.5%, BSA 2%, normal goat serum (NGS) 3% in PBS) at room temperature, followed by primary antibody incubation overnight at 4°C. After washing three times with PBS, sections were incubated 1 h at room temperature with secondary antibodies and then washed four times with PBS. The sections were then mounted using Fluoromount-G mounting medium (#0100–01, Southern Biotech, Birmingham, USA). Fluorescent images were visualized using a laser scanning confocal microscope (SP5 AOBS Confocal Microscope, Leica Microsystems, Wetzlar, Germany).

mCCD cell culture

Mouse cortical collecting duct cells (mCCD) [10] were grown in 6-well plates (#CLS3335, Corning, New York, USA) in growth medium DMEM/F12 1:1 Glutamax (#10565018, Gibco, Waltham, USA) supplemented with insulin (5 ug/ml), human apotransferrin (5 ug/ml), Na-selenate (60 nM), EGF (10 ng/ml), triiodothyronine (1 nM), dexamethasone (50 nM), 1% penicillin/strepromycin, and 2% FCS. Cells were grown to 100% confluence; medium was then exchanged for growth medium containing calcium oxalate monohydrate crystals (#C0350000, Merk, Kenilworth, USA) in a final concentration of 300 or 600 ug/ml; the same volume of PBS 1x was used as a control. Cells were treated over 16 hours, then washed three times with PBS 1x and RNA was isolated using TRIzol®.

Statistical analyses

Comparisons between groups were conducted using GraphPad Prism software (version 9.0.0). Results are presented, as means ± SD, unless otherwise stated. Statistical analyses were performed using Student’s t tests (2-tailed), one-way ANOVA, or two-way ANOVA, using Tukey correction for multiple comparison. Values of p < 0.05 were considered statistically significant.

Results

Ecrg4 is expressed in the kidney and along the distal part of the nephron

The expression of Ecrg4 mRNA in male kidney was analyzed and compared to other organs, including adrenal glands, brain, heart and esophagus. Ecrg4 mRNA was detected in all tissues tested (Fig 1A). Female kidney and heart tissues have an increased Ecrg4 expression compared to male mice (S1 Fig). Substantial efforts have been done to identify ECRG4 protein in the same tissues by Western blot or immunostaining. However, none of the antibodies showed specificity in the tested mouse tissues when compared to the same tissues obtained from Ecrg4 KO mice (S2–S7 Figs).
Fig 1

Ecrg4 is expressed in the kidney and along the distal part of the nephron.

(A) Ecrg4 mRNA expression in the indicated organs relative to Actb and to the expression in the esophagus (dotted line) in control male mice (n = 3). (B) Ecrg4 mRNA expression in microdissected renal tubular segments related to Actb and to the expression in the DCT-CNT segment (dotted line) in control male mice (n = 3). Data are shown as individual dots and mean ± SD. Stars indicate *p<0.05, calculated using t-test. PROX: proximal tubule; TAL: thick ascending limb; DCT-CNT: distal convoluted tubule and connecting tubule; CD: collecting duct.

Ecrg4 is expressed in the kidney and along the distal part of the nephron.

(A) Ecrg4 mRNA expression in the indicated organs relative to Actb and to the expression in the esophagus (dotted line) in control male mice (n = 3). (B) Ecrg4 mRNA expression in microdissected renal tubular segments related to Actb and to the expression in the DCT-CNT segment (dotted line) in control male mice (n = 3). Data are shown as individual dots and mean ± SD. Stars indicate *p<0.05, calculated using t-test. PROX: proximal tubule; TAL: thick ascending limb; DCT-CNT: distal convoluted tubule and connecting tubule; CD: collecting duct. After confirming the presence of Ecrg4 mRNA in extracts obtained from the whole kidney, we looked whether Ecrg4 expression was restricted to certain segmental parts of the nephron or if it was ubiquitous. We microdissected the tubular segments from the kidney of wildtype mice and found that Ecrg4’s presence was limited to the thick ascending limb (TAL), distal convoluted tubule/connecting tubule (DCT/CNT) and cortical collecting duct (CD) segments, while no expression was found in the proximal (PROX) tubule (Fig 1B).

Ecrg4 transcript is upregulated in hypercalciuric mouse models

We identified Ecrg4 as an upregulated gene in a RNA-sequencing screen of kidneys from mice devoid of the sodium-calcium exchanger NCX1 and which are hypercalciuric. We wondered whether Ecrg4 mRNA levels would be increased in other models of hypercalciuria. We analyzed Ecrg4’s expression, compared to control littermates in kidney from Ncx1-kidney-specific KO mice, Claudin-2 (Cldn2) KO mice and mice fed the vitamin D analog, dihydrotachysterol (DHTS). Ncx1-kidney-specific KO mice and Cldn2 KO mice are genetic mouse models of hypercalciuria due to a primary defect in renal tubular (respectively DCT and proximal tubule) calcium transport [11]. DHTS, the vitamin D analogue, is a pharmacological model due to increased intestinal absorption, plasma Ca2+ levels and urinary Ca2+ excretion [12]. Ecrg4 mRNA expression was substantially increased in these three chronic hypercalciuric mouse models, as depicted in Fig 2A. We also tested the effect of furosemide—which induces hypercalciuria by blocking calcium reabsorption in the thick ascending limb of Henle- for six consecutive days. No effect of furosemide on Ecrg4 mRNA level was observed. Considering a possible tubular adaptation to hypercalciuria in the case of chronic furosemide treatment, we checked for renal Ecrg4 mRNA expression after single furosemide treatment. Again, we did not find any change in Ecrg4’s expression after acute furosemide, compared to vehicle, up to 240 minutes after furosemide injection (Fig 2B). Hypercalciuria was however substantial only after 15min following the furosemide administration (S8 Fig).
Fig 2

Ecrg4 transcript is upregulated in several hypercalciuric mouse models.

(A) Ecrg4 mRNA expression (related to Actb and appropriate control mice for each condition, dotted line) was found increased in the kidneys of mice issued from several established hypercalciuric models (n = 4 males/condition), but not in mice exposed to chronic furosemide (injected with 20mg furosemide/kg body weight for 6 consecutive days). Ncx1 KO: Ncx1 KO mice. Cldn2 KO: Claudin-2 KO mice. DHTS: Dihydrotachysterol-treated mice (1,5mg/kg food) for 7 days. (B) Renal Ecrg4 expression after acute furosemide injection relative to renal expression of vehicle-injected male mice (dotted line). The mice were injected with 20mg furosemide/kg body weight and kidneys were harvested after 15, 30, 60 or 240min (n = 3–5 animals/group). (C) Renal Ecrg4 mRNA expression is not changed by the calcitropic hormones PTH or 1,25(OH)2-vitamin D. The kidneys were harvested 6h after calcitriol injection (n = 5), and 2h after PTH injection (n = 6). The dotted line at 1 represents renal Ecrg4 mRNA expression of vehicle-treated male mice. (D) Ecrg4’s regulation along the nephron of the hypercalciuric Ncx1 KO mouse model compared to control littermates (dotted line) (n = 3 males/condition). Data are shown as individual dots and mean ± SD. Stars indicate *p<0.05, calculated using t test and Dunnett’s multiple correction.

Ecrg4 transcript is upregulated in several hypercalciuric mouse models.

(A) Ecrg4 mRNA expression (related to Actb and appropriate control mice for each condition, dotted line) was found increased in the kidneys of mice issued from several established hypercalciuric models (n = 4 males/condition), but not in mice exposed to chronic furosemide (injected with 20mg furosemide/kg body weight for 6 consecutive days). Ncx1 KO: Ncx1 KO mice. Cldn2 KO: Claudin-2 KO mice. DHTS: Dihydrotachysterol-treated mice (1,5mg/kg food) for 7 days. (B) Renal Ecrg4 expression after acute furosemide injection relative to renal expression of vehicle-injected male mice (dotted line). The mice were injected with 20mg furosemide/kg body weight and kidneys were harvested after 15, 30, 60 or 240min (n = 3–5 animals/group). (C) Renal Ecrg4 mRNA expression is not changed by the calcitropic hormones PTH or 1,25(OH)2-vitamin D. The kidneys were harvested 6h after calcitriol injection (n = 5), and 2h after PTH injection (n = 6). The dotted line at 1 represents renal Ecrg4 mRNA expression of vehicle-treated male mice. (D) Ecrg4’s regulation along the nephron of the hypercalciuric Ncx1 KO mouse model compared to control littermates (dotted line) (n = 3 males/condition). Data are shown as individual dots and mean ± SD. Stars indicate *p<0.05, calculated using t test and Dunnett’s multiple correction. Next, we checked if renal Ecrg4’s expression was influenced by the calcitropic hormones 1,25(OH)2-vitamin D and PTH under acute stimulating conditions. No effect of these hormones on the renal Ecrg4 mRNA level was observed (Fig 2C). After having observed a response of Ecrg4’s expression to chronically induced hypercalciuria, we wondered if the increase in gene expression was segment-specific or was concerning all tubular segment in which Ecrg4 was found to be expressed. We microdissected the renal tubules of the hypercalciuric kidney-specific Ncx1 KO mice and found that Ecrg4 is significantly increased in the TAL, DCT-CNT and CD but not in the proximal tubule compared to control littermates (Fig 2D). In total, we found that Ecrg4 expression is increased in the kidneys of several chronic hypercalciuric mouse models and concerns all segments in which Ecrg4 was found to be expressed, namely TAL, DCT and CD.

Ecrg4 KO male mice, but not females, are resistant to induced hypercalciuria

In order to get more insights into the role of Ecrg4 in calcium handling by the kidney, we obtained Ecrg4 KO mice and backcrossed them in the C57BL/6 background (Fig 3A). No obvious phenotype (fertility, weight, size, behavior, macroscopic appearance and fur) was observed in KO mice compared to littermate controls. Similarly, no difference in the tested blood and urine parameters was observed (Tables 2 and 3).
Fig 3

Ecrg4 KO male mice are resistant to induced hypercalciuria.

(A) Ecrg4 mRNA expression in the kidney of Ecrg4 KO mice. P value was calculated using t-test. (B) Schematic representation of the experimental plan. Male mice were habituated in metabolic cages for 2 days. Then, control and Ecrg4 KO mice were exposed to either the regular chow diet or to a diet enriched in calcium (1.5%) and the oxalate precursor hydroxyproline (2%) (CaOx diet) for 8 days. The mice were housed individually in metabolic cages for urine collection at baseline, day 1 and day 8. (C) Increase in the urinary calcium-creatinine ratio in both control and Ecrg4 KO mice under CaOx diet. The ratios were calculated from the urine collected at baseline, day 1 and 8 under chow diet or CaOx diet. At 8 days of the CaOx diet, the Ecrg4 KO male mice had a significantly lower calcium-creatinine excretion compared to control mice. (D) Urinary sodium-creatinine ratio in both control and Ecrg4 KO male mice. (E) Urinary calcium/sodium ratio after 8 days of CaOx diet. Data are shown as individual points and mean ± SD (n = 4). For data B-D, p value was calculated using two-way ANOVA with Tukey correction for multiple comparisons. Stars indicate * p<0.05 between control and Ecrg4 KO mice; § indicates p<0.05 for comparison of control mice in the two different diets (chow vs. CaOx); # indicates p<0.05 of Ecrg4 KO mice in the two different diets (chow vs. CaOx).

Table 2

Plasma chemistry of control and Ecrg4 KO MALE mice after 8 days of CaOx diet or chow diet.

Chow diet CaOx diet
PlasmaControlEcrg4 KOControlEcrg4 KO
Ca2+, mM2,19±0,06 (4)2,21±0,01 (4)2,51±0,01 (4) §2,42±0,08 (4)
Na+, mM147,00±2,04 (4)150,00±0,70 (4)155,75±0,47 (4) §155,00±0,70 (4) #
K+, mM5,00±0,22 (4)5,07±0,15 (4)4,55±0,09 (4)5,12±0,25 (4)
PO43-, mM3,25±0,21 (4)3,02±0,14 (4)1,51±0,15 (4) §2,30±0,31 (4)
Creatinine, μM 3,75±0,36 (4)5,15±0,95 (4)9,50±0,64 (4) §8,87±1,68 (4)
Ca FE, % 0,07±0,01 (4)0,05±0,00 (4)2,48±0,23 (4) §1,33±0,31 (4) *#
Pi FE, % 2,16±0,36 (4)3.84±0,53 (4)3,09±1.09 (4)2,61±2,08 (3)

Data are means ± SEM (n). P values are calculated using one-way ANOVA test, with Tukey correction for multiple comparison.

* indicates p<0.05 between control and Ecrg4 KO mice;

§ indicates p<0.05 between the two diets for control mice;

# indicates p<0.05 between the two diets for Ecrg4 KO mice.

Table 3

Plasma chemistry of control and Ecrg4 KO FEMALE mice after 8 days of CaOx diet or chow diet.

Chow diet CaOx diet
PlasmaControlEcrg4 KOControlEcrg4 KO
Ca2+, mM2,28 ± 0,02 (5)2,13 ± 0,03 (4)2,49 ± 0,04 (4)2,36 ± 0,06 (7) #
Na+, mM149,00 ± 0,44 (5)150,00 ± 0,49 (5)151,00 ± 0,70 (4)151,20 ± 0,28 (5)
K+, mM4,40± 0,19 (5)4,00 ± 0,31 (5)4,47 ± 0,29 (4)4,08 ± 0,23 (5)
PO43-, mM2,76 ± 0,13 (5)3,02 ± 0,09 (5)2,72 ± 0,04 (4)2,70 ± 0,17 (7)
Creatinine, μM 5,20 ± 0,58 (5)6,40 ± 0,40 (5)6,25 ± 0,47 (4)4,70 ± 0,60 (4)
Ca FE, % 0,09 ± 0,01 (5)0,14 ± 0,01 (4)2,45 ± 0,31 (4) §2,50 ± 0,23 (4) #
Pi FE, % 6,72 ± 2,36 (5)4,83 ± 0,54 (5)0,21 ± 0,02 (4) §0,16 ± 0,02 (4)

Data are means ± SEM (n). P values are calculated using one-way ANOVA test, with Tukey correction for multiple comparison.

* indicates p<0.05 between control and Ecrg4 KO mice;

§ indicates p<0.05 between the two diets for control mice;

# indicates p<0.05 between the two diets for Ecrg4 KO mice.

Ecrg4 KO male mice are resistant to induced hypercalciuria.

(A) Ecrg4 mRNA expression in the kidney of Ecrg4 KO mice. P value was calculated using t-test. (B) Schematic representation of the experimental plan. Male mice were habituated in metabolic cages for 2 days. Then, control and Ecrg4 KO mice were exposed to either the regular chow diet or to a diet enriched in calcium (1.5%) and the oxalate precursor hydroxyproline (2%) (CaOx diet) for 8 days. The mice were housed individually in metabolic cages for urine collection at baseline, day 1 and day 8. (C) Increase in the urinary calcium-creatinine ratio in both control and Ecrg4 KO mice under CaOx diet. The ratios were calculated from the urine collected at baseline, day 1 and 8 under chow diet or CaOx diet. At 8 days of the CaOx diet, the Ecrg4 KO male mice had a significantly lower calcium-creatinine excretion compared to control mice. (D) Urinary sodium-creatinine ratio in both control and Ecrg4 KO male mice. (E) Urinary calcium/sodium ratio after 8 days of CaOx diet. Data are shown as individual points and mean ± SD (n = 4). For data B-D, p value was calculated using two-way ANOVA with Tukey correction for multiple comparisons. Stars indicate * p<0.05 between control and Ecrg4 KO mice; § indicates p<0.05 for comparison of control mice in the two different diets (chow vs. CaOx); # indicates p<0.05 of Ecrg4 KO mice in the two different diets (chow vs. CaOx). Data are means ± SEM (n). P values are calculated using one-way ANOVA test, with Tukey correction for multiple comparison. * indicates p<0.05 between control and Ecrg4 KO mice; § indicates p<0.05 between the two diets for control mice; # indicates p<0.05 between the two diets for Ecrg4 KO mice. Data are means ± SEM (n). P values are calculated using one-way ANOVA test, with Tukey correction for multiple comparison. * indicates p<0.05 between control and Ecrg4 KO mice; § indicates p<0.05 between the two diets for control mice; # indicates p<0.05 between the two diets for Ecrg4 KO mice. To further test the hypothesis that Ecrg4 modulates calcium-oxalate crystal nephropathy, we fed the mice a diet enriched in calcium (1.5%) and in the oxalate precursor, hydroxyproline (2%), further referred to as the CaOx diet (Fig 3B). Ecrg4 KO male mice fed the CaOx diet had a significantly lower fractional excretion of calcium compared to control mice fed the same diet, despite comparable calcemia and blood creatinine values (Table 2). Such finding was not observed in females (Table 3). Under the CaOx diet, urinary calcium/creatinine ratio was increasing between baseline and day 8 (Fig 3C). Interestingly, after 8 days of treatment, urinary calcium excretion of Ecrg4 KO male mice was significantly lower compared to control male mice fed the same diet (Fig 3C). As differences of sodium excretion was observed between the groups under CaOx diet (Fig 3D), the urinary calcium/sodium ratio was calculated (Fig 3E) and showed that the lower calciuria observed in Ecrg4 KO mice is independent of sodium. Female data are provided in supplemental material, but did not show difference in renal calcium handling between Ecrg4 KO and controls (S9–S11 Figs). Altogether, this data shows that Ecrg4 KO male mice have lower fractional excretion and lower calciuria than controls while exposed to the CaOx diet.

Ecrg4 KO male mice, but not females, have less renal tubular obstruction under CaOx diet

Control male mice exposed to the CaOx crystal forming diet exhibited intraluminal crystal deposits, clearly detected by Pizzolato staining (Fig 4A) already after 8 days of treatment. The crystals were localized predominantly in the papilla, with fewer crystals observed in the kidney cortex or medulla.
Fig 4

Ecrg4 KO male mice have less renal tubular obstruction after 8 days of CaOx diet.

(A) Representative pictures of renal papilla stained by Pizzolato (left panels) or Hematoxylin-eosin (HE, right panels) at 20x magnification. Intraluminal crystals and tubular dilation are visible in control mice but not in Ecrg4 KO mice. Bars represent 100um. (B) HE staining of sections of the cortex of kidneys from control and Ecrg4 KO male mice kidneys, after 8 days of CaOx diet, at 20x magnification. Bars represent 100um. The black arrows indicate the intraluminal crystals (A), as well as the tubular dilatation (B) in the control mice. (C) Quantification of the CaOx crystals in kidney tissue expressed as percentage of crystal surface over the kidney section (n = 7). (D) Quantification of tubular dilation of the cortex expressed as percentage of surface dilated over the whole surface (5 sections/mouse; n = 7). Data are shown individually and as mean ± SD. P values are calculated using t-test.

Ecrg4 KO male mice have less renal tubular obstruction after 8 days of CaOx diet.

(A) Representative pictures of renal papilla stained by Pizzolato (left panels) or Hematoxylin-eosin (HE, right panels) at 20x magnification. Intraluminal crystals and tubular dilation are visible in control mice but not in Ecrg4 KO mice. Bars represent 100um. (B) HE staining of sections of the cortex of kidneys from control and Ecrg4 KO male mice kidneys, after 8 days of CaOx diet, at 20x magnification. Bars represent 100um. The black arrows indicate the intraluminal crystals (A), as well as the tubular dilatation (B) in the control mice. (C) Quantification of the CaOx crystals in kidney tissue expressed as percentage of crystal surface over the kidney section (n = 7). (D) Quantification of tubular dilation of the cortex expressed as percentage of surface dilated over the whole surface (5 sections/mouse; n = 7). Data are shown individually and as mean ± SD. P values are calculated using t-test. In line with the observed decrease in calcium excretion, Ecrg4 KO male mice developed less intratubular deposits compared to control mice, with an important inter-individual variability (Fig 4C). Moreover, the tubules were significantly less dilated in Ecrg4 KO mice compared to control animals (Fig 4B and 4D). Of note, and as often observed in the field, females were completely resistant to crystal formation (S12 Fig). Overall, male mice devoid of Ecrg4 had less crystal deposits and less tubular dilation, indicative of less tubular plugging. In order to get more insights into calcium handling by the kidneys of Ecrg4 KO mice, mRNA expression levels of genes involved in transepithelial calcium transport or its regulation were assessed. No change in Slc9A3, Pthr1, Cldn14, Cldn2, Cldn16, Atp2b4, Trpv5, Calb1, Slc8A1, Aqp2, Pvalb, Casr, Vdr was found between the kidneys of Ecrg4 KO and control mice exposed to the CaOx diet (S13 Fig). However, a marked increase of PTHR1 can be seen in the kidney tissue of Ecrg4 KO mice compared to controls (S14 Fig). In addition, genes involved in Ecrg4-dependent downstream pathways (Nfkb1, Nfkb2, P53 and Cox2) were unchanged, with the notable exception of P53, which was less expressed in the KO mice (S15A Fig). Finally, we exposed mouse cortical collecting duct cells (mCCD) to different calcium oxalate crystal concentrations (0, 300 or 600 ug of crystal/ml) and Ecrg4 mRNA level was measured by qPCR (S15B Fig). We observed a dose-dependent decrease of Ecrg4 mRNA upon treatment with higher crystal concentrations, as well as a decrease in Nfkb1 expression when cells were exposed to the highest calcium oxalate crystal concentration (S15C Fig). No other change in the expression levels of the Ecrg4 downstream genes (Nfkb1, Nfkb2, P53 and Cox2) was observed.

Discussion

This study investigated the expression of Ecrg4 in the renal tissue, its regulation and its potential role in the development of kidney stones. We found expression of Ecrg4 along the distal tubules, showed upregulation of Ecrg4 mRNA expression in several chronic hypercalciuric mouse models and showed less signs of tubular obstruction in Ecrg4 KO mice fed a calcium-oxalate rich diet. This promotes Ecrg4 as a modulator of renal crystallization.

Ecrg4’s expression in renal tissue

We detected the presence of Ecrg4 mRNA in the distal segments of the nephron (TAL, DCT/CNT and CD), while the proximal tubule was negative for Ecrg4’s expression, in line with a recently published mouse single-cell RNA-seq analysis [13]. We spent substantial energy to detect and quantify ECRG4’s protein expression in the kidney and other organs (S2–S7 Figs), but were unsuccessful to detect any specific signal. This could be explained by the fact that the specificity of the commercial antibodies used in this study has been tested only a minima by the providing companies, usually only in cell lines overexpressing ECRG4, and were not validated in native tissues obtained from control and Ecrg4 KO mice. An alternative explanation for the lack of detection might be that ECRG4 is processed very quickly in vivo or that posttranslational modifications might prevent its detection. Indeed, the 148 amino acids full-length protein was shown to be cleaved into at least eight peptides of varying molecular weight, ranging from ~ 17 kDa to 2 kDa [14]. This process might render ECRG4’s detection difficult with antibodies developed against full-length ECRG4. We thus looked for alternative methods that could help us identify the ECRG4 protein. A mass spectrometry analysis was performed on various protein extracts, from heart, brain, and Ecrg4-transfected HEK cells (S1 and S2 Tables). However, the detection level of ECRG4 fragments was discouragingly low, even in the overexpressing HEK cell system. We thus concluded that the ECRG4 protein expression is too low to be identified by the available tools or that only fragments of ECRG4 should be looked for. We thus continued our study only by interpreting the mRNA level of expression of Ecrg4.

Ecrg4 is regulated in models of hypercalciuria

We have previously identified Ecrg4 as an mRNA upregulated in the hypercalciuric kidney-specific Ncx1 KO mouse model. Here, we confirmed that Ecrg4 expression is higher in the kidney of Ncx1 KO mice compared to controls in all tubular segments expressing Ecrg4. We looked whether this regulation was observed in other models of hypercalciuria. We used the hypercalciuric Cldn2 KO mouse model [11], lacking proximal tubule calcium reabsorption, and mice fed the vitamin D analog, DHTS, which causes hypercalcemia and hypercalciuria. In these two models, up to 2.5 times increase in renal Ecrg4 mRNA expression was observed compared to controls. By contrast, no change in the Ecrg4 level was found when mice were injected acutely or for six consecutive days with furosemide, a known inducer of calciuria. We speculate that this discrepancy might be due to the relative short term and transient hypercalciuria induced by furosemide compared to chronic and sustained hypercalciuria of the other models. Thus, we propose that Ecrg4’s increased expression is triggered only by chronic and sustained hypercalciuria. The mechanism by which Ecrg4 is regulated by urine calcium remained undetermined. We explored whether the calcitropic hormones, PTH or 1,25(OH)2-vitamin D, might have a direct effect on Ecrg4’s expression. We did not observe any change in Ecrg4 renal expression after short term exposure to the two hormones. This might be due to the relative short stimulation time (2h for PTH and 6h for 1,25(OH)2-vitamin D), even if Cyp24a1 and Cyp27b1 transcript expression, used as controls, showed substantial increase after exposure to either of these hormones [9]. As previously noted, long-term exposure to the vitamin D analog, DHTS, induced a strong Ecrg4 upregulation. Based on this piece of data, we conclude that Ecrg4 is regulated by long term exposure to sustained hypercalciuria, with no direct short-term effect of furosemide, PTH or 1,25(OH)2-vitamin D. The precise mechanism by which tubular calcium regulates Ecrg4 expression remains to be identified.

Loss of Ecrg4 protects against tubular calcifications in male mice

We used a diet rich in calcium and in the oxalate precursor, hydroxyproline, for 8 days to induce hypercalciuria, hyperoxaluria, and calcium-oxalate nephropathy. In agreement with previous studies [15], we showed that kidneys of male mice developed a CaOx crystal nephropathy, while females were resistant, despite similar high urinary calcium excretion. Of note, sex differences in stone formation have been observed in humans and were attributed to sex hormones [16-20]. These differences seem to be more pronounced in mice and will need further studies to be deciphered. On the same note, our results show a gender-specific difference in Ecrg4`s expression in the renal tissue, under control conditions (S1 Fig). Consistent with previously published evidences, increased Ecrg4 expression inhibits cell proliferation [21], which was found to account for renal crystal deposits in the setting of supersaturated urines [22, 23]. Further studies should assess if the difference in Ecrg4 levels is directly involved in the different outcome in calcium-oxalate nephropathy between male and female mice. To our surprise, we found that male mice devoid of Ecrg4 and exposed to the CaOx diet had less tubular dilation and intra-renal calcifications. In these mice, we also found a preserved renal function, indicating that overall the mice were protected from tubular obstruction by calcium oxalate crystals. This protection could be due to the role of Ecrg4 in the kidney or in other organs. The whole body constitutive knockout mouse model we used did not allow us to discriminate between the two possibilities. However, some observations suggest that the loss of Ecrg4 may play a protective role by both renal and extra-renal effects. Hence, when exposed to the CaOx diet, control male mice had increased calcemia and calciuria compared to Ecrg4 KO male mice. This suggests that Ecrg4 KO mice adapt to the CaOx challenge by controlling their calcemia and calciuria by an unknown mechanism, potentially by decreasing their intestinal calcium absorption. Moreover, Ecrg4 KO mice displayed lower fractional excretion of calcium, indicative of a direct effect of ECRG4 on the tubular calcium reabsorption. In an attempt to understand the mechanisms by which Ecrg4 KO mice might have a different renal calcium handling, we analyzed the mRNA expression (S13 Fig), as well as protein level (S14 Fig) of several renal genes and proteins involved in calcium homeostasis. We found similar levels between KO and control mice for all the tested candidates, except for the PTHR1 which was significantly increased in the Ecrg4 KO mice. In these mice, this might indicate a possible adaptive mechanism to regulate calcium homeostasis that involves PTH/PTHR1 signaling pathway in the distal segment of the nephron. Altogether, systemic as well as renal mechanisms could concur to alleviate crystal formation in Ecrg4 KO mice under enriched calcium and hydroxyproline diet. As Ecrg4 is a tumor suppressor gene involved in the p53 and NFKB pathways [24-26], we wondered whether Ecrg4 might be involved in mediating inflammation or tubular cell renewal, explaining the attenuated damages seen in the kidneys of Ecrg4 KO mice. First, we found decreased expression of p53 mRNA in the kidneys of Ecrg4 KO mice (S15A Fig). This suggests that under the setting of CaOx diet challenge, male mice might have more cellular proliferative capacity to cope with crystal-induced injuries. Second, we found a down-regulation of the Nfkb1 gene in the mouse cortical collecting duct cell line (mCCD cells) exposed to calcium-oxalate monohydrate crystals (S15B and S15C Fig). In this system, the decrease of Nfkb1 expression might indicate that crystal-induced inflammation is reduced in the absence of Ecrg4. Indeed, it was previously shown that ECRG4 peptide induces the expression of proinflammatory factors via a variety of intracellular signaling pathways. For example, increased reactive oxygen species levels, activated NFkB signaling pathway and interaction with the innate immunity receptor complex TLR4/CD14/MD2 complex, was demonstrated upon ECRG4 binding to LOX-1, and other scavenger receptors, such as Sccarf1, Cd36 and Stabili-1 [27, 28]. Altogether, deletion of Ecrg4 might limit the defense mechanisms against crystal-induced injuries. However, how cells sense hypercalciuria and increase Ecrg4 expression still remains to be identified.

Strengths and limitations

We are not aware of any other study addressing the role of Ecrg4 in the kidney and showing that Ecrg4 is involved in renal calcium handling and in the risk of calcification. However, several limitations warrant mention. First, our evidence is mainly based on mRNA expression levels. As discussed previously, we were not able to detect ECRG4 full-length protein or fragments with the available anti-ECRG4 antibodies. Second, the mechanisms by which loss of Ecrg4 reduces tubular calcifications remain open. We observed lower calciuria in male mice under CaOx diet compared to controls, but whether this might be sufficient to decrease intratubular crystal formation or retention remains unsolved. Finally, further studies will need to examine whether the limited renal insufficiency and hypercalciuria in the Ecrg4 KO mice is rather time dependent, or if there is a long-term adaptation mechanism, which might involve some other organs than the kidney. By showing that Ecrg4 is involved in urine calcium handling and crystal nephropathy, we hope to open new perspectives of research in the field.

Ecrg4 mRNA expression is higher in female tissues compared to male tissues.

Ecrg4 mRNA expression in the indicated organs relative to Actb (n = 2–3). Data are shown as individual dots and mean ± SD. Stars indicate *p<0.05, calculated using Student t-test. (TIF) Click here for additional data file.

Antibodies tested on total brain extract.

The equivalent of 50ug of protein was loaded on 13% SDS gel. The LS-Bio antibody (diluted 1:500, #LS-C172856), the Phoenix antibody (diluted 1:300, #012–25), the Sigma antibody (diluted 1:500, #HPA008546) and the Santa Cruz antibody (diluted 1:500, # H-118) were used. Actin (diluted 1:500, #A2066) was used as loading control. (TIF) Click here for additional data file.

Antibodies tested on total heart extract.

The equivalent of 50ug of protein was loaded on 13% SDS gel. The LS-Bio antibody (diluted 1:500, #LS-C172856), the Phoenix antibody (diluted 1:300, #012–25), the Sigma antibody (diluted 1:500, #HPA008546) and the Santa Cruz antibody (diluted 1:500, # H-118) were used. Actin (diluted 1:500, #A2066) was used as loading control. (TIF) Click here for additional data file.

Antibodies tested on total esophagus extract.

100ug of protein was loaded on 13% SDS gel. The LS-Bio antibody (diluted 1:500, #LS-C172856), the Phoenix antibody (diluted 1:300, #012–25), the Sigma antibody (diluted 1:500, #HPA008546) and the Santa Cruz antibody (diluted 1:500, # H-118) were used. Actin (diluted 1:500, #A2066) was used as loading control. (TIF) Click here for additional data file.

Antibodies tested on total kidney extract.

30ug of protein was loaded on 13% SDS gel. The LS-Bio antibody (diluted 1:500, #LS-C172856), and the Santa Cruz antibody (diluted 1:500, # H-118) were used. Actin (diluted 1:500, #A2066) was used as loading control. (TIF) Click here for additional data file.

Immunofluorescence staining on kidney tissue using different antibodies.

Scale bars represent 200um. The LS-Bio antibody (diluted 1:100, #LS-C172856), the Sigma antibody (diluted 1:100, #HPA008546) and the Santa Cruz antibody (diluted 1:100, # H-118) were used. (TIF) Click here for additional data file.

Immunohistochemistry staining on different organ`s tissue.

The Sigma antibody (diluted 1:50, #HPA008546) was used. (TIF) Click here for additional data file.

Calcium excretion after acute furosemide injection.

Mice were injected with 20mg/kg body weight furosemide or vehicle, and sacrificed after 15, 30, 60 and 240 min. P values are calculated using one-way ANOVA test, with Dunnett correction for multiple comparison. Each time point was compared to the vehicle. Data are shown as mean ± SD. Stars indicate * p<0.05. (TIF) Click here for additional data file.

Female Ecrg4 KO mouse model characterization.

(A) Increase in the urinary calcium-creatinine ratio in both control and Ecrg4 KO female mice upon CaOx diet. The ratios were calculated from the urine collected at baseline, and after 1 day and 8 days of exposure to either chow diet or the CaOx diet. (B) Urinary sodium-creatinine ratio in both control and Ecrg4 KO female mice. (C) Urinary calcium/sodium excretion at day 8 of the CaOx diet. Data are shown as mean ± SD. p value was calculated using two-way ANOVA with Tukey correction for multiple comparison. Stars indicate * p<0.05 between the control and Ecrg4 KO, § indicates p<0.05 between the controls of different diets, # indicates p<0.05 between the Ecrg4 KO of different diets. (TIF) Click here for additional data file.

Mouse parameters during metabolic cages.

(A) Body weight, (B) food and (C) water intake parameters were measured over 24h period for males and females. At baseline, all mice were fed the chow diet and then exposed to either CaOx diet or chow diet (n = 4–5). Data are shown as mean ± SD. p value was calculated using two-way ANOVA with Tukey correction for multiple comparison. Stars indicate * p<0.05 between the control and Ecrg4 KO, § indicates p<0.05 between the controls of different diets, # indicates p<0.05 between the Ecrg4 KO of different diets. (TIF) Click here for additional data file.

24h urinary parameters.

Urinary phosphate (A), potassium (B) excretion, osmolality (C) and pH (D). Mice were individually housed in metabolic cages, after exposure to chow or CaOx diet (n = 4–5). Data are shown as mean ± SD. p value was calculated using two-way ANOVA with Tukey correction for multiple comparison. Stars indicate * p<0.05 between the control and Ecrg4 KO, § indicates p<0.05 between the controls of different diets, # indicates p<0.05 between the Ecrg4 KO of different diets. (TIF) Click here for additional data file.

No calcium oxalate crystals in the kidney of female mice.

Representative pictures of the Pizzolato staining of the (A) control and (B) Ecrg4 KO female mice kidneys, under the CaOx. No calcium oxalate crystals can be observed in either of the kidney samples. Scale bars represent 1mm. (TIF) Click here for additional data file.

Genes involved in calcium handling are unchanged between control and Ecrg4 KO male mice.

Relative expression of several renal genes involved calcium handling following the CaOx diet in Ecrg4 KO mice is illustrated relative to Actb and to controls (1, dashed line) (n = 4). Data are shown as mean ± SD. (TIF) Click here for additional data file.

Relative quantification of selected proteins from kidney extracts.

Western blot analysis of (A) CLDN2, TRPV5, PVALB, CASR proteins in male mice kidney tissue (n = 3). Mice were fed either the chow diet or challenged with the CaOx diet. Western blot analysis of (B) PTHR1 protein in control vs Ecrg4 KO male mice kidney tissue (n = 4–5). Mice were challenged with the CaOx diet. Quantities represented by the gel bands are expressed as intensity relative to β-Actin. Quantities represented by the gel bands are expressed as intensity relative to β-actin. All relative intensity results are presented as the means ± SD. Stars indicates * p<0.05. P values are calculated using two-way ANOVA test, with Sidak’s correction for multiple comparison (A) or Student t-test (B). (TIF) Click here for additional data file.

mCCD cells stimulated with CaOx monohydrate crystals.

(A) The downstream genes that are activated upon ECRG4 signaling were quantified by qPCR in kidney extracts from control and Ecrg4 KO male mice. Stars indicates * p<0.05. P values are calculated using Student t-test (n = 4). (B) mCCD cells were incubated with CaOx monohydrate crystals for 16h. The Ecrg4 mRNA expression is shown as response to different crystals concentrations. (C) The downstream genes that are activated upon ECRG4 signaling were quantified in the mCCD cells upon calcium-oxalate monohydrate crystals incubation. Stars indicates * p<0.05. P values are calculated using one-way ANOVA comparing the mean of each CaOx crystal dosage (300 and 600 ug/ml CaOx) with the mean of the control column at 0 ug/ml CaOx crystal dosage (n = 3). Data are shown as mean ± SD. (TIF) Click here for additional data file.

Identified proteins by mass spectrometry in control heart and brain tissues.

(DOCX) Click here for additional data file.

Identified proteins by mass spectrometry in transfected HEK cells.

(DOCX) Click here for additional data file. (DOCX) Click here for additional data file. (PDF) Click here for additional data file. (PDF) Click here for additional data file. (PDF) Click here for additional data file. (PDF) Click here for additional data file. 30 May 2022
PONE-D-22-06861
Loss of Ecrg4 improves calcium oxalate nephropathy
PLOS ONE Dear Dr. Bonny, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
Please address the questions raised be the two reviewers. Please submit your revised manuscript by 15h july. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Franziska Theilig Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: 1.The paper may open a new way to explore the etiology of calcium oxalate nephropathy and maybe provide a new therapeutic strategy in Kidney stones.Fluent writing and correct grammar.The manuscript presented in an intelligible fashion and written in standard English. 2.The most regret is that we cannot detect ECRG4 protein expression in kindey.ECRG4 is a secreted protein that undergoes cleavage after secretion.The protein is specifically expressed in a manner dependent on differentiation status.Some paper found that Anti-ECRG4 immunohistochemical staining of rat genitourinary system, some tubular and glomerular epithelial cells show faint or moderate immunostaining(Eur J Histochem. 2015 May 18;59(2):2458;Gene. 2009 Dec 1;448(1):7-15).How to explain these differences? 3.Fig1-3 should indicate the number of samples in ordinate,Fig4 should indicate the magnification,and mark where is the crystal in Fig4A 4.in 358 line, in male mice not in male 5.Is there gender differences in the expression of ECRG4 in mice , except for hormonal in the part of discusson in 362 line? 6.How is upregulation of ECRG4 gene?It maybe better if we had experiments that upregulated Ecrg4 genes . Reviewer #2: This study characterized the expression of Ecrg4 mRNA in different tissues as well as the expression pattern along the renal segment. The manuscript is very well written. The experimental approach is straightforward and clearly described. By in vivo and in vitro studies, authors reported the potential role of Ecrg4 in calcium oxalate nephropathy. Although there are several interesting concepts put forward by the data, there remains several unanswered questions and the underlying mechanisms are elusive. For this reason, I have some suggestions to improve the manuscript: Major: 1. In response to hypercalciuria, Ecrg4 mRNA is upregulated, however this is not seen in furosemide-induced calciuria. In addition, renal Ecrg4 mRNA is not changed by PTH or 1,25(OH)3-VD. Therefore, it is speculated that beside directly sensing urine Ca concentration, renal Ecrg4 mRNA can also respond to other unknown local or systemic factors. Discussion about the underlying mechanisms for different hypercalciuric models and the resulting possible systemic changes could help to explain the discrepancy in renal Ecrg4 mRNA response to various hypercalciuric models. In addition, have author measured the Ecrg4 mRNA expression in control mice on calcium-oxalate diet, which induces hypercalciuria. 2. Is there sex difference in Ecrg4 mRNA expression, given that female mice are resistant to crystal formation in all conditions? 3. Plasma Ca concentration is comparable between the genotypes on calcium-oxalate diet, Ecrg4 KO shows lower urinary Ca excretion, which might indicate higher renal Ca reabsorption, meanwhile, mice might have lower intestinal Ca absorption to maintain the plasma Ca homeostasis. The authors measured mRNA expression of genes related to renal calcium handling, and found no differences between genotypes. mRNA expression is not always consistent with the protein abundance, therefore, WB to check the protein levels should provide more precise information. In addition, have the authors checked the hormone levels related to Ca homeostasis, PTH, VD3, FGF23, in the plasma of KO mice on calcium-oxalate diet compared to control mice? 4. in the line 358, the subhead “Ecrg4 protects against tubular calcification in males”. Here the conclusion is confusing. It is Ecrg4 KO mice show lower tubular dilation and nephrocalcinosis, means that loss of Ecrg4 has protective effect but not Ecrg4 itself. Same problem occurs in the later discussion section, in line 397 “Second, the mechanism by which Ecrg4 reduces tubular calcifications remains open”. Loss of Ecrg4 reduces injury rather Ecrg4 itself; In line 385-386, “In this system, the decrease of Nfkb1 expression might indicate that crystal-induced inflammation is reduced in presence of Ecrg4”, based on current results that decrease in Nfkb1 expression is in parallel with reduced Ecrg4 mRNA expression, so precisely, the possibly reduced inflammation (no evidence here) is due to decreased Ecrg4 mRNA expression rather “in presence of Ecrg4”. In contrast, the absence of Ecrg4 might have anti-inflammatory effect based on authors’ conclusions in this study, which is consistent with the following discussion that ECRG4 peptide is proinflammatory. Minor 5. Y axis legend of S13A Fig is wrong, please correct it. It is not Ecrg4 expression. 6. In result section, line 313-314, “without major changes in the expression levels of 314 the ECRG4 downstream genes Nfkb1, Nfkb2, P53 and Cox2”. However, Nfkb1 mRNA expression is significantly reduced on 600 ug crystal and author should make it clear and clarify it because authors used this result in later discussion. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Jianxiang Xue [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
Submitted filename: REVIEW_JX.docx Click here for additional data file. 8 Aug 2022 Dear Editor, Dear Reviewers, We are pleased to provide a revised version of our manuscript based on the constructive comments received. We think that the manuscript improved substantially now and we are thankful for the suggestions. We performed additional experiments as suggested: we compared the expression levels of Ecrg4 mRNA in male and female tissues and we measured the protein level of calcium transport proteins by WB. This strengthened our conclusions. We hope the manuscript is now in a shape allowing its publication. Please find hereafter the detailed responses to the Reviewers’comments. Best regards O. Bonny Reviewer #1: 1. The paper may open a new way to explore the etiology of calcium oxalate nephropathy and maybe provide a new therapeutic strategy in Kidney stones. Fluent writing and correct grammar. The manuscript presented in an intelligible fashion and written in standard English. Answer: Many thanks for your appreciation and positive comment. 2. The most regret is that we cannot detect ECRG4 protein expression in kidney. ECRG4 is a secreted protein that undergoes cleavage after secretion. The protein is specifically expressed in a manner dependent on differentiation status. Some paper found that Anti-ECRG4 immunohistochemical staining of rat genitourinary system, some tubular and glomerular epithelial cells show faint or moderate immunostaining (Eur J Histochem. 2015 May 18;59(2):2458;Gene. 2009 Dec 1;448(1):7-15). How to explain these differences? Answer: This was indeed a strong concern during the whole study and we tried to address this issue by different ways. We have actually followed the protocol published in the Eur J Histochem. 2015 May 18;59(2):2458 on different rat tissues. However, using the Ecrg4 KO mouse model we could not see any specific immunostaining on esophagus and kidney tissues. We infer that the antibody may not cross-react between mouse and rat. Regarding the other publication (Gene 2009 Dec 1;448(1):7-15), the authors used 293T cells transfected with lentiviruses expressing myc-tagged ECRG4. An anti-myc antibody was used to detect the ECRG4 protein. No native ECRG4 protein was detected with specific antibody in this study. Therefore, these differences can be explained by the different animal model/system used and by the lack of negative control to validate the antibodies used. 3. Fig1-3 should indicate the number of samples in ordinate, Fig4 should indicate the magnification, and mark where is the crystal in Fig4A Answer: We changed the figure and legends according to the reviewer`s suggestion. 4. in 358 line, in male mice not in male Answer: We changed the text according to the reviewer`s comment. 5. Is there gender differences in the expression of ECRG4 in mice, except for hormonal in the part of discussion in 362 line? Answer: We performed this experiment as suggested by this reviewer. We found that female mice have 2 times more Ecrg4 mRNA expression in the kidney and heart tissues compared to male mice. We now introduced this data in the manuscript (Supplemental material, S1 Fig) and discussed it. Here is the modified text in the Discussion section: ``Of note, sex differences in stone formation have been observed in humans and were attributed to sex hormones (1-5). These differences seem to be more pronounced in mice and will need further studies to be deciphered. On the same line, our results show a gender-specific difference in Ecrg4`s expression in the renal tissue, under control conditions (S1 Fig). Further studies are needed to assess if the sex-difference in Ecrg4 expression level might be directly involved in the different outcome in calcium-oxalate nephropathy observed between male and female mice.`` 6. How is upregulation of ECRG4 gene? It maybe better if we had experiments that upregulated Ecrg4 genes. Answer: The precise mechanism by which tubular calcium regulates Ecrg4 expression remains to be identified. Based on our findings, we conclude that Ecrg4 is regulated only by long term exposure to sustained hypercalciuria, with no short-term effect of furosemide, PTH or 1,25(OH)2-vitamin D. Reviewer #2: This study characterized the expression of Ecrg4 mRNA in different tissues as well as the expression pattern along the renal segment. The manuscript is very well written. The experimental approach is straightforward and clearly described. By in vivo and in vitro studies, authors reported the potential role of Ecrg4 in calcium oxalate nephropathy. Although there are several interesting concepts put forward by the data, there remains several unanswered questions and the underlying mechanisms are elusive. For this reason, I have some suggestions to improve the manuscript: Major: 1. In response to hypercalciuria, Ecrg4 mRNA is upregulated, however this is not seen in furosemide-induced calciuria. In addition, renal Ecrg4 mRNA is not changed by PTH or 1,25(OH)3-VD. Therefore, it is speculated that beside directly sensing urine Ca concentration, renal Ecrg4 mRNA can also respond to other unknown local or systemic factors. Discussion about the underlying mechanisms for different hypercalciuric models and the resulting possible systemic changes could help to explain the discrepancy in renal Ecrg4 mRNA response to various hypercalciuric models. In addition, have author measured the Ecrg4 mRNA expression in control mice on calcium-oxalate diet, which induces hypercalciuria. Answer: We showed that Ecrg4’s expression is upregulated in hypercalciuric mice when hypercalciuria is chronic and sustained (in the Ncx1 KO and Cldn2 KO mouse models or in mice under Vitamin D analog treatment), as opposed to transient hypercalciuria (furosemide treatment) or short-term exposure to calcitropic hormones (PTH, vitamin D injection). When quantifying the Ecrg4 mRNA expression in the kidney of mice fed the diet inducing hypercalciuria and hyperoxaluria compared to the chow diet, we observed a significant decrease in Ecrg4 expression. Given that hypercalciuria alone does not induce nephrocalcinosis, as in the case of the CaOx diet, we speculate that the difference in Ecrg4 expression could be explained by the differences in the mouse models. Indeed, we showed that the loss of Ecrg4 protects against calcium-oxalate nephropathy. Moreover, there is published evidence that Ecrg4 may play a role in coordinating the inflammatory and proliferative cell response that could help maintain epithelium integrity, as seen by gene downregulation in traumatic brain injury rat model (6), as well as in human lung epithelial injury (7). Thus, the decreased Ecrg4 expression in the kidney of control mice challenged with the CaOx diet compared to chow diet may suggest a defense mechanisms against crystal-induced injuries. 2. Is there sex difference in Ecrg4 mRNA expression, given that female mice are resistant to crystal formation in all conditions? Answer: We performed this experiment and found that female mice have 2 times more Ecrg4 mRNA expression in the kidney and heart tissues compared to male mice. We now introduced this data in the manuscript (figure in the Supplemental material, S1 Fig) and discussed it. Here is the modified text in the Discussion section: ``Of note, sex differences in stone formation have been observed in humans and were attributed to sex hormones (1-5). These differences seem to be more pronounced in mice and will need further studies to be deciphered. On the same line, our results show a gender-specific difference in Ecrg4`s expression in the renal tissue, under control conditions (S1 Fig). Further studies are needed to assess if the sex-difference in Ecrg4 expression level might be directly involved in the different outcome in calcium-oxalate nephropathy observed between male and female mice.`` 3. Plasma Ca concentration is comparable between the genotypes on calcium-oxalate diet, Ecrg4 KO shows lower urinary Ca excretion, which might indicate higher renal Ca reabsorption, meanwhile, mice might have lower intestinal Ca absorption to maintain the plasma Ca homeostasis. The authors measured mRNA expression of genes related to renal calcium handling, and found no differences between genotypes. mRNA expression is not always consistent with the protein abundance, therefore, WB to check the protein levels should provide more precise information. In addition, have the authors checked the hormone levels related to Ca homeostasis, PTH, VD3, FGF23, in the plasma of KO mice on calcium-oxalate diet compared to control mice? Answer: We thank the reviewer for this excellent suggestion. We are now providing the WB quantification for TRPV5, PVALB, PTHR1, CLND2 and CASR on kidney extract from control and Ecrg4 KO mice challenged with the CaOx diet. The Ecrg4 KO mice show lower urinary Ca excretion and comparable plasma Ca levels. While at the mRNA level we did not find any changes in renal calcium handling genes, at the protein level, we found a significant increase in PTHR1’s expression and a non-significant decrease in CASR between the control and Ecrg4 KO mice fed the CaOx diet. This might indicate a possible Ecrg4-mediated Ca reabsorption via the PTH/PTHR1signaling pathway in the distal parts of the nephron, with no impact on the renal reabsorption of Ca in the proximal tubule, given the CLDN2 unchanged levels. We introduced this data in the manuscript (Supplemental material, S14 Fig) and discussed it. No hormones (PTH, VD3, FGF23) could be measured in the plasma of Ecrg4 KO mice and controls due to unavailability of blood samples during the revision period. 4. In the line 358, the subhead “Ecrg4 protects against tubular calcification in males”. Here the conclusion is confusing. It is Ecrg4 KO mice show lower tubular dilation and nephrocalcinosis, means that loss of Ecrg4 has protective effect but not Ecrg4 itself. Same problem occurs in the later discussion section, in line 397 “Second, the mechanism by which Ecrg4 reduces tubular calcifications remains open”. Loss of Ecrg4 reduces injury rather Ecrg4 itself; In line 385-386, “In this system, the decrease of Nfkb1 expression might indicate that crystal-induced inflammation is reduced in presence of Ecrg4”, based on current results that decrease in Nfkb1 expression is in parallel with reduced Ecrg4 mRNA expression, so precisely, the possibly reduced inflammation (no evidence here) is due to decreased Ecrg4 mRNA expression rather “in presence of Ecrg4”. In contrast, the absence of Ecrg4 might have anti-inflammatory effect based on authors’ conclusions in this study, which is consistent with the following discussion that ECRG4 peptide is proinflammatory. Answer: We thank the reviewer for pointing an important misunderstanding. We corrected the text accordingly in the Discussion. Minor 5. Y axis legend of S13A Fig is wrong, please correct it. It is not Ecrg4 expression. Answer: We corrected it. Thank you for pointing this issue. 6. In result section, line 313-314, “without major changes in the expression levels of 314 the ECRG4 downstream genes Nfkb1, Nfkb2, P53 and Cox2”. However, Nfkb1 mRNA expression is significantly reduced on 600 ug crystal and author should make it clear and clarify it because authors used this result in later discussion. Answer: We corrected the text accordingly. Here is the modified text: “Finally, we exposed mouse cortical collecting duct cells (mCCD) to different calcium oxalate crystal concentrations (0, 300 or 600 ug of crystal/ml) and Ecrg4 mRNA level was measured by qPCR. We observed a dose-dependent decrease of Ecrg4 mRNA upon treatment with higher crystal concentrations, as well as a decrease in Nfkb1 expression when cells were exposed to the highest calcium oxalate crystal concentration. No other changes in the expression levels of the ECRG4 downstream genes (Nfkb1, Nfkb2, P53 and Cox2) was observed (S15B and C Fig).” References 1. Scales CD, Jr., Curtis LH, Norris RD, Springhart WP, Sur RL, Schulman KA, et al. Changing gender prevalence of stone disease. J Urol. 2007;177(3):979-82. 2. Schwille PO, Manoharan M, Schmiedl A. Is idiopathic recurrent calcium urolithiasis in males a cellular disease? Laboratory findings in plasma, urine and erythrocytes, emphasizing the absence and presence of stones, oxidative and mineral metabolism: an observational study. Clin Chem Lab Med. 2005;43(6):590-600. 3. Fan J, Chandhoke PS, Grampsas SA. Role of sex hormones in experimental calcium oxalate nephrolithiasis. J Am Soc Nephrol. 1999;10 Suppl 14:S376-80. 4. Yagisawa T, Ito F, Osaka Y, Amano H, Kobayashi C, Toma H. The influence of sex hormones on renal osteopontin expression and urinary constituents in experimental urolithiasis. J Urol. 2001;166(3):1078-82. 5. Ko B, Bergsland K, Gillen DL, Evan AP, Clark DL, Baylock J, et al. Sex differences in proximal and distal nephron function contribute to the mechanism of idiopathic hypercalcuria in calcium stone formers. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology. 2015;309(1):R85-R92. 6. Podvin S, Roberton A, Johanson C, Stopa E, Eliceiri B, Baird A. Augrin, Ecilin and Argilin: Characterization of neuropeptide candidates encoded by the esophageal cancer related Gene-4 (ecrg4) and their localization in the mouse choroid plexus. JSfNP 2009;85. 7. Kao S, Shaterian A, Cauvi DM, Dang X, Chun HB, De Maio A, et al. Pulmonary preconditioning, injury, and inflammation modulate expression of the candidate tumor suppressor gene ECRG4 in lung. Experimental Lung Research. 2015;41(3):162-72. Submitted filename: Response to Reviewers.docx Click here for additional data file. 27 Sep 2022 Loss of Ecrg4 improves calcium oxalate nephropathy PONE-D-22-06861R1 Dear Dr. Bonny, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Franziska Theilig Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Thw authors had already addressed my comments raised in a previous round of review and revised the manuscript .I recommend to accept the manuscript and had no further suggestion for the authors . Reviewer #2: The authors fully addressed the raised comments by revision, therefore, I have no more comments or concerns on the manuscript. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No ********** 4 Oct 2022 PONE-D-22-06861R1 Loss of Ecrg4 improves calcium oxalate nephropathy Dear Dr. Bonny: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Franziska Theilig Academic Editor PLOS ONE
  24 in total

1.  Is idiopathic recurrent calcium urolithiasis in males a cellular disease? Laboratory findings in plasma, urine and erythrocytes, emphasizing the absence and presence of stones, oxidative and mineral metabolism: an observational study.

Authors:  Paul Otto Schwille; Mahimaidos Manoharan; Angelika Schmiedl
Journal:  Clin Chem Lab Med       Date:  2005       Impact factor: 3.694

2.  Open reading frame mining identifies a TLR4 binding domain in the primary sequence of ECRG4.

Authors:  Xitong Dang; Raul Coimbra; Liang Mao; Sonia Podvin; Xue Li; Hua Yu; Todd W Costantini; Xiaorong Zeng; Dana Larocca; Brian P Eliceiri; Andrew Baird
Journal:  Cell Mol Life Sci       Date:  2019-06-12       Impact factor: 9.261

3.  The influence of sex hormones on renal osteopontin expression and urinary constituents in experimental urolithiasis.

Authors:  T Yagisawa; F Ito; Y Osaka; H Amano; C Kobayashi; H Toma
Journal:  J Urol       Date:  2001-09       Impact factor: 7.450

4.  Mineralocorticoid versus glucocorticoid receptor occupancy mediating aldosterone-stimulated sodium transport in a novel renal cell line.

Authors:  Hans-Peter Gaeggeler; Elena Gonzalez-Rodriguez; Nicole Fowler Jaeger; Dominique Loffing-Cueni; Rikke Norregaard; Johannes Loffing; Jean-Daniel Horisberger; Bernard C Rossier
Journal:  J Am Soc Nephrol       Date:  2005-03-02       Impact factor: 10.121

5.  Targeted Single-Cell RNA-seq Identifies Minority Cell Types of Kidney Distal Nephron.

Authors:  Lihe Chen; Chun-Lin Chou; Mark A Knepper
Journal:  J Am Soc Nephrol       Date:  2021-03-04       Impact factor: 10.121

6.  Down-regulation of ECRG4, a candidate tumor suppressor gene, in human breast cancer.

Authors:  Renaud Sabatier; Pascal Finetti; José Adelaide; Arnaud Guille; Jean-Paul Borg; Max Chaffanet; Lydie Lane; Daniel Birnbaum; François Bertucci
Journal:  PLoS One       Date:  2011-11-16       Impact factor: 3.240

7.  Ecrg4 peptide is the ligand of multiple scavenger receptors.

Authors:  Tetsuo Moriguchi; Shuji Takeda; Shinzo Iwashita; Kei Enomoto; Tatsuya Sawamura; Uichi Koshimizu; Toru Kondo
Journal:  Sci Rep       Date:  2018-03-06       Impact factor: 4.379

8.  ECRG4 is a candidate tumor suppressor gene frequently hypermethylated in colorectal carcinoma and glioma.

Authors:  Silke Götze; Valeska Feldhaus; Thilo Traska; Marietta Wolter; Guido Reifenberger; Andrea Tannapfel; Cornelius Kuhnen; Dirk Martin; Oliver Müller; Sonja Sievers
Journal:  BMC Cancer       Date:  2009-12-17       Impact factor: 4.430

9.  Memo1 gene expression in kidney and bone is unaffected by dietary mineral load and calciotropic hormones.

Authors:  Matthias B Moor; Olivier Bonny
Journal:  Physiol Rep       Date:  2020-04
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.