| Literature DB >> 36225304 |
Gaëlle Boudry1, Armelle Cahu1, Véronique Romé1, Régis Janvier1, Margaux Louvois1, Daniel Catheline1,2, Vincent Rioux1,2, Isabelle Le Huërou-Luron1, Sophie Blat1.
Abstract
The ghrelin-ghrelin receptor (GHSR1) system is one of the most important mechanisms regulating food intake and energy balance. To be fully active, ghrelin is acylated with medium-chain fatty acids (MCFA) through the ghrelin-O-acetyl transferase (GOAT). Several studies reported an impact of dietary MCFA on ghrelin acylation in adults. Our study aimed at describing early post-natal development of the ghrelin system in mini-pigs as a model of human neonates and evaluating the impact of dietary MCFA. Suckled mini-pigs were sacrificed at post-natal day (PND) 0, 2, 5, and 10 or at adult stage. In parallel, other mini-pigs were fed from birth to PND10 a standard or a dairy lipid-enriched formula with increased MCFA concentration (DL-IF). Plasma ghrelin transiently peaked at PND2, with no variation of the acylated fraction except in adults where it was greater than during the neonatal period. Levels of mRNA coding pre-proghrelin (GHRL) and GOAT in the antrum did not vary during the post-natal period but dropped in adults. Levels of antral pcsk1/3 (cleaving GHRL into ghrelin) mRNA decreased significantly with age and was negatively correlated with plasma acylated, but not total, ghrelin. Hypothalamic ghsr1 mRNA did not vary in neonates but increased in adults. The DL-IF formula enriched antral tissue with MCFA but did not impact the ghrelin system. In conclusion, the ghrelin maturation enzyme PCSK1/3 gene expression exhibited post-natal modifications parallel to transient variations in circulating plasma ghrelin level in suckling piglets but dietary MCFA did not impact this post-natal development.Entities:
Keywords: caprylic (C8:0) and capric acid (C10:0); convertase 3; ghrelin; ghrelin-ghrelin O-acyltransferase system; neonate
Year: 2022 PMID: 36225304 PMCID: PMC9549131 DOI: 10.3389/fphys.2022.1010586
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Fatty acid composition (% of total fatty acid) of infant formula (IF) and infant formula formulated with dairy lipids (DL-IF).
| IF | DL-IF | |
|---|---|---|
| C6:0 | 0.03 | 0.6 |
| C8:0 | 0.02 | 0.5 |
| C10:0 | 0.02 | 1.2 |
| C12:0 | 0.1 | 1.6 |
| C14:0 | 0.4 | 5.6 |
| C14:1 n-5 | 0.0 | 0.5 |
| C15:0 | 0.0 | 0.5 |
| C16:0 | 31.9 | 20.6 |
| C16:1 n-9 | 0.0 | 0.1 |
| C16:1 n-7 | 0.09 | 0.9 |
| C18:0 | 4.1 | 5.9 |
| C18:1 n-9 | 46.7 | 44.2 |
| C18:1 n-7 | 1.8 | 1.7 |
| C18:2 n-6 | 13.3 | 14.7 |
| C18:3 n-6 | 0.0 | 0.0 |
| C18:3 n-3 | 1.0 | 1.2 |
| C20:0 | 0.2 | 0.1 |
| C20:1 n-9 | 0.2 | 0.2 |
| C20:2 n-6 | 0.0 | 0.0 |
| C20:4 n-6 | 0.0 | 0.0 |
| C22:6 n-3 | 0.0 | 0.0 |
Primer sequences.
| Forward | Reverse | Accession number | Efficiency (%) | |
|---|---|---|---|---|
|
| Caagaagccagcagccaaac | gaagccaggtgagcccttag | NM_213807.2 | 98.1 |
|
| Ctgggctcttcaaactcacc | gtctgcatcagggacaaaac | NM_001190423.1 | 102.1 |
|
| acaggggagacaaggaaagg | tgatggagatggtgtagatgc | NM_214038.1 | 103.6 |
|
| cagggaccagaaccacaa | aagaggacaaaggacacgag | NM_214180.1 | 95.6 |
|
| aaacggaaagccaaattacc | atccacagcgttaggagtga | NM_213978 | 97.5 |
|
| cctttcctcagctgcccacta | cgtgcaaaatgagggcagag | NM_001129964.2 | 98.8 |
|
| agataacgaacaaccagagg | tgtcaggcatagggatacc | NM_001099932.2 | 102.0 |
FIGURE 1Neonatal development of the ghrelin system in mini-pigs. Pre-pro-ghrelin (ghrl) mRNA levels in the antrum (A), density of acylated ghrelin immuno-reactive (IR) cells in the antrum (B), total (C) and acylated (D) ghrelin plasma level, plasma acylated-to-total ghrelin ratio (E) and ghrelin receptor (ghsr1a) mRNA levels in the hypothalamus were measured in neonatal suckled mini-pigs (post-natal days (PND) 0–10) and in adult ones (A). Data are means +/− sem. Means with different letters are significantly different (p ≤ 0.05, One-way ANOVA followed by Tukey test, n = 9 per group during the post-natal period and n = 6 for adults).
FIGURE 2Neonatal development of ghrelin maturation enzymes in mini-pigs. Convertase 3 (pcsk1/3) (A) and ghrelin-O-acetyl transferase (goat) (B) mRNA levels in the antrum were measured in neonatal suckled mini-pigs (post-natal days (PND) 0–10) and in adult ones (A). Pearson correlation between pcsk1/3 (C) or goat (D) mRNA levels in the antrum and plasma acylated ghrelin.
Fatty acid composition (µg/g) of gastric content of suckled piglets.
| PND0 | PND2 | PND5 | PND10 | Age effect | |
|---|---|---|---|---|---|
| C8:0 | 37 ± 16 a | 43 ± 20 ab | 111 ± 38 ab | 144 ± 22 b | 0.03 |
| C10:0 | 54 ± 16 a | 280 ± 106 a | 930 ± 87 b | 913 ± 120 b | <0.0001 |
| C12:0 | 56 ± 10 a | 278 ± 77 b | 628 ± 19 c | 625 ± 42 c | <0.0001 |
| C14:0 | 753 ± 178 a | 4958 ± 1052 b | 8380 ± 233 c | 7808 ± 635 c | <0.0001 |
| C14:1 n-5 | 16 ± 5 a | 216 ± 69 a | 521 ± 65 b | 484 ± 73 b | 0.0002 |
| C15:0 | 98 ± 27 a | 407 ± 56 c | 302 ± 36 bc | 210 ± 21 b | 0.0005 |
| C16:0 | 8731 ± 1787 a | 46322 ± 7208 b | 65709 ± 2371 c | 56678 ± 4631 bc | <0.0001 |
| C16:1 n-9 | 368 ± 53 a | 1447 ± 126 b | 1467 ± 218 b | 1156 ± 124 b | 0.0005 |
| C16:1 n-7 | 1023 ± 222 a | 11913 ± 2659 b | 20886 ± 1581 c | 17734 ± 2039 bc | <0.0001 |
| C17:0 | 248 ± 65 a | 975 ± 143 c | 683 ± 65 bc | 532 ± 46 ab | 0.0007 |
| C18:0 | 2013 ± 324 a | 9952 ± 870 b | 10111 ± 876 b | 9543 ± 834 b | <0.0001 |
| C18:1 n-9 | 8322 ± 1053 a | 52164 ± 3357 b | 73897 ± 3021 b | 58894 ± 2557 b | 0.004 |
| C18:1 n-7 | 841 ± 95 a | 4696 ± 447 b | 6581 ± 755 b | 5197 ± 1649 b | 0.006 |
| C18:2 n-6 | 6701 ± 1314 a | 28487 ± 3357 b | 29243 ± 3021 b | 28188 ± 2557 b | 0.0001 |
| C18:3 n-3 | 561 ± 113 a | 3060 ± 501 b | 3673 ± 358 b | 3616 ± 393 b | 0.0002 |
| C20:0 | 58 ± 10 a | 289 ± 31 b | 312 ± 27 b | 295 ± 29 b | <0.0001 |
| C20:1 n-9 | 69 ± 9 a | 455 ± 48 ab | 681 ± 103 b | 682 ± 234 b | 0.02 |
| C20:2 n-6 | 85 ± 28 a | 493 ± 29 b | 522 ± 89 b | 693 ± 60 b | <0.0001 |
| C20:3 n-6 | 78 ± 19 | 220 ± 59 | 256 ± 46 | 252 ± 50 | n.s. |
| C20:4 n-6 | 285 ± 51 a | 1212 ± 95 b | 1329 ± 153 b | 955 ± 205 b | 0.0008 |
| C22:0 | 30 ± 8 a | 158 ± 23 b | 148 ± 13 b | 151 ± 18 b | 0.0003 |
Data are means +/− sem. Means with different letters are significantly different (p ≤ 0.05, One-way ANOVA followed by Tukey test, n = 4 per group). n.s.: not significant.
Fatty acid composition (µg/g) of antrum during the neonatal period.
| PND0 | PND2 | PND5 | PND10 | Age effect | |
|---|---|---|---|---|---|
| C8:0 | 33 ± 12 | 46 ± 16 | 16 ± 6 | 23 ± 3 | n.s. |
| C10:0 | 39 ± 12 | 61 ± 17 | 26 ± 8 | 33 ± 6 | n.s. |
| C12:0 | 194 ± 52 | 269 ± 79 | 108 ± 33 | 140 ± 16 | n.s. |
| C14:0 | 205 ± 27 | 460 ± 131 | 193 ± 51 | 356 ± 169 | n.s. |
| C14:1 n-5 | 9 ± 2 | 30 ± 9 | 13 ± 5 | 26 ± 10 | n.s. |
| C15:0 | 53 ± 9 a | 56 ± 11 a | 16 ± 6 b | 19 ± 5 b | 0.005 |
| C16:0 | 2492 ± 344 | 4586 ± 1035 | 2291 ± 605 | 4245 ± 1668 | n.s. |
| C16:1 n-9 | 164 ± 23 | 195 ± 28 | 76 ± 20 | 133 ± 52 | n.s. |
| C16:1 n-7 | 327 ± 52 | 850 ± 286 | 398 ± 107 | 860 ± 502 | n.s. |
| C17:0 | 233 ± 53 | 276 ± 110 | 75 ± 13 | 100 ± 17 | n.s. |
| C18:0 | 1287 ± 225 | 1744 ± 307 | 1100 ± 393 | 1924 ± 611 | n.s. |
| C18:1 n-9 | 2371 ± 445 | 2296 ± 932 | 1077 ± 647 | 951 ± 2293 | n.s. |
| C18:1 n-7 | 1033 ± 97 | 638 ± 116 | 356 ± 110 | 716 ± 289 | n.s. |
| C18:2 n-6 | 1033 ± 292 | 2296 ± 595 | 1077 ± 305 | 951 ± 344 | n.s. |
| C18:3 n-6 | 23 ± 6 | 45 ± 17 | 11 ± 2 | 20 ± 9 | n.s. |
| C18:3 n-3 | 59 ± 23 | 161 ± 54 | 60 ± 17 | 136 ± 82 | n.s. |
| C20:0 | 21 ± 5 | 30 ± 6 | 12 ± 4 | 21 ± 8 | n.s. |
| C20:1 n-9 | 22 ± 6 | 35 ± 11 | 25 ± 9 | 52 ± 27 | n.s. |
| C20:2 n-6 | 18 ± 7 | 54 ± 15 | 28 ± 11 | 46 ± 22 | n.s. |
| C20:3 n-6 | 50 ± 12 | 61 ± 22 | 41 ± 17 | 62 ± 9 | n.s. |
| C20:4 n-6 | 993 ± 201 | 1069 ± 274 | 713 ± 286 | 894 ± 52 | n.s. |
| C20:5 n-3 | 14 ± 4 | 25 ± 10 | 15 ± 6 | 21 ± 2 | n.s. |
| C22:4 n-6 | 128 ± 30 | 150 ± 43 | 105 ± 54 | 130 ± 13 | n.s. |
| C22:5 n-6 | 63 ± 16 | 33 ± 11 | 21 ± 13 | 27 ± 4 | n.s. |
| C22:5 n-3 | 44 ± 8 | 92 ± 29 | 71 ± 34 | 102 ± 16 | n.s. |
Data are means +/− sem. Means with different letters are significantly different (p ≤ 0.05, One-way ANOVA followed by Tukey test, n = 4 per group). n.s.: not significant.
FIGURE 3Impact of dietary MCFA formula on the ghrelin system. Medium chain fatty acids (MCFA, C8:0, and C10:0) content in the antrum (A), total (B) and acylated (C) ghrelin plasma level, plasma acylated-to-total ghrelin ratio (D), density of acylated ghrelin immuno-reactive (IR) cells in the antrum (E), pre-pro-ghrelin (ghrl) (F), convertase 3 (pcsk1/3) (G) and ghrelin-O-acetyl transferase (goat) (H) mRNA levels in the antrum and ghrelin receptor (ghsr1a) mRNA levels in the hypothalamus (I) were measured in mini-piglets fed infant formulas formulated with plant lipids (IF) or with a mix of plant and dairy lipids (DL-IF) to modulate MCFA dietary levels. Data are means +/− sem. *: p ≤ 0.05, Student t-test (n = 5 and 11 for IF and DL-IF respectively).