| Literature DB >> 36213227 |
Maryam Delfan1, Alieh Vahed1, David J Bishop2, Raheleh Amadeh Juybari1, Ismail Laher3, Ayoub Saeidi4, Urs Granacher5, Hassane Zouhal6,7.
Abstract
Aims: High intensity interval training (HIIT) improves mitochondrial characteristics. This study compared the impact of two workload-matched high intensity interval training (HIIT) protocols with different work:recovery ratios on regulatory factors related to mitochondrial biogenesis in the soleus muscle of diabetic rats. Materials and methods: Twenty-four Wistar rats were randomly divided into four equal-sized groups: non-diabetic control, diabetic control (DC), diabetic with long recovery exercise [4-5 × 2-min running at 80%-90% of the maximum speed reached with 2-min of recovery at 40% of the maximum speed reached (DHIIT1:1)], and diabetic with short recovery exercise (5-6 × 2-min running at 80%-90% of the maximum speed reached with 1-min of recovery at 30% of the maximum speed reached [DHIIT2:1]). Both HIIT protocols were completed five times/week for 4 weeks while maintaining equal running distances in each session.Entities:
Keywords: diabetes mellitus; exercise training; mitochondrial adaptation; muscle metabolism; time-efficient exercise
Year: 2022 PMID: 36213227 PMCID: PMC9541894 DOI: 10.3389/fphys.2022.927969
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
The high intensity interval training protocols for both training groups.
| Weeks of training | Group | Number of intervals per session | Intensity of each interval (% the maximum speed reached) | Total running distance (m) | Intensity of recovery (% the maximum speed reached) | Intensity of warm-up and cool-down (% the maximum speed reached) |
|---|---|---|---|---|---|---|
| 1 | DHIIT1:1 | 4 | 80 | 1,260 | 40 | 40 |
| DHIIT2:1 | 5 | 80 | 1,250 | 30 | 30 | |
| 2 | DHIIT1:1 | 4 | 85 | 1,440 | 40 | 40 |
| DHIIT2:1 | 5 | 85 | 1,435 | 30 | 30 | |
| 3 | DHIIT1:1 | 5 | 90 | 1,970 | 40 | 40 |
| DHIIT2:1 | 6 | 90 | 1,960 | 30 | 30 | |
| 4 | DHIIT1:1 | 5 | 90 | 2,620 | 40 | 40 |
| DHIIT2:1 | 6 | 90 | 2,620 | 30 | 30 |
The primers sequence used in real-time PCR.
| Gene name | Sequence of primer | Product size (bp) | Accession number | |
|---|---|---|---|---|
| PGC-1α | Forward Reverse | CCGAAGAACCATCCGATTGAAG CCCAAACCTGATGGCATTGTG | 145 | NM_031347.1 |
| CS | Forward Reverse | GAGACTACATCTGGAACAC GACAGGAATATCGTGGATC | 93 | NM_016987.2 |
| p53 | Forward Reverse | CAAGAAGTCACAACACAT ATACTCAGCATACGGATT | 127 | NM_030989.3 |
| GAPDH | Forward Reverse | TTCTAGAGACAGCCGCATC CAATGTCCACTTTGTCACAAGAG | 139 | NM_017008.4 |
The plasma characteristics of the rats at the end of the fourth week.
| Characteristics | Normal control | Diabetic control | DHIIT1:1 | DHIIT2:1 |
|---|---|---|---|---|
| FBS (mmol/L) | 10.30 ± 0.70 | 31.51 ± 3.47≠ | 27.30 ± 1.85∗ | 25.87 ± 2.62∗ |
| Insulin (ng/ml) | 2.29 ± 0.14 | 0.38 ± 0.15≠ | 0.88 ± 0.11 | 1.28 ± 0.56∗ |
The data are presented as mean ± SD. ∗significant differences between diabetic control and DHIIT groups, ≠significant difference between normal control and diabetic control groups (p < 0.05). DHIIT1:1: Diabetic + HIIT1:1 program (2 min of high intensity treadmill running with 2 min of low-intensity recovery); DHIIT2:1: Diabetic + HIIT2:1 (2 min of high intensity treadmill running with 1 min of low-intensity recovery); FBS: Fasting Blood Sugar.
FIGURE 1The effect of the HIIT1:1 and HIIT2:1 protocols on key regulatory factors related to mitochondrial biogenesis. (A) PGC-1α gene expression. (B) p53 gene expression. (C) Citrate synthase gene expression. (D) PGC-1α protein abundance. (E) p53 protein abundance. (F) Citrate synthase protein abundance. The data are presented as mean ± SEM. *: significant differences between control and other groups, #: significant differences between HIIT1:1 and HIIT2:1. HIIT: High Intensity Interval Training, n = 6 and rats trained for 4 weeks.