| Literature DB >> 36213116 |
Mohamed Emam1, Khalil Eslamloo1, Albert Caballero-Solares1, Evandro Kleber Lorenz1, Xi Xue1, Navaneethaiyer Umasuthan1, Hajarooba Gnanagobal2, Javier Santander2, Richard G Taylor3, Rachel Balder3, Christopher C Parrish1, Matthew L Rise1.
Abstract
We investigated the immunomodulatory effect of varying levels of dietary ω6/ω3 fatty acids (FA) on Atlantic salmon (Salmo salar) antibacterial response. Two groups were fed either high-18:3ω3 or high-18:2ω6 FA diets for 8 weeks, and a third group was fed for 4 weeks on the high-18:2ω6 diet followed by 4 weeks on the high-18:3ω3 diet and termed "switched-diet". Following the second 4 weeks of feeding (i.e., at 8 weeks), head kidney tissues from all groups were sampled for FA analysis. Fish were then intraperitoneally injected with either a formalin-killed Renibacterium salmoninarum bacterin (5 × 107 cells mL-1) or phosphate-buffered saline (PBS control), and head kidney tissues for gene expression analysis were sampled at 24 h post-injection. FA analysis showed that the head kidney profile reflected the dietary FA, especially for C18 FAs. The qPCR analyses of twenty-three genes showed that both the high-ω6 and high-ω3 groups had significant bacterin-dependent induction of some transcripts involved in lipid metabolism (ch25ha and lipe), pathogen recognition (clec12b and tlr5), and immune effectors (znrf1 and cish). In contrast, these transcripts did not significantly respond to the bacterin in the "switched-diet" group. Concurrently, biomarkers encoding proteins with putative roles in biotic inflammatory response (tnfrsf6b) and dendritic cell maturation (ccl13) were upregulated, and a chemokine receptor (cxcr1) was downregulated with the bacterin injection regardless of the experimental diets. On the other hand, an inflammatory regulator biomarker, bcl3, was only significantly upregulated in the high-ω3 fed group, and a C-type lectin family member (clec3a) was only significantly downregulated in the switched-diet group with the bacterin injection (compared with diet-matched PBS-injected controls). Transcript fold-change (FC: bacterin/PBS) showed that tlr5 was significantly over 2-fold higher in the high-18:2ω6 diet group compared with other diet groups. FC and FA associations highlighted the role of DGLA (20:3ω6; anti-inflammatory) and/or EPA (20:5ω3; anti-inflammatory) vs. ARA (20:4ω6; pro-inflammatory) as representative of the anti-inflammatory/pro-inflammatory balance between eicosanoid precursors. Also, the correlations revealed associations of FA proportions (% total FA) and FA ratios with several eicosanoid and immune receptor biomarkers (e.g., DGLA/ARA significant positive correlation with pgds, 5loxa, 5loxb, tlr5, and cxcr1). In summary, dietary FA profiles and/or regimens modulated the expression of some immune-relevant genes in Atlantic salmon injected with R. salmoninarum bacterin. The modulation of Atlantic salmon responses to bacterial pathogens and their associated antigens using high-ω6/high-ω3 diets warrants further investigation.Entities:
Keywords: Salmo salar; bacterial kidney disease; formalin-killed Renibacterium salmoninarum bacterin; molecular biomarker; qPCR; ω3 and ω6 dietary fatty acids
Year: 2022 PMID: 36213116 PMCID: PMC9532746 DOI: 10.3389/fmolb.2022.931548
Source DB: PubMed Journal: Front Mol Biosci ISSN: 2296-889X
Formulation and fatty acid composition of the experimental diets fed to Atlantic salmon.
| Ingredient (%) | High-18:2ω6 | High-18:3ω3 |
|---|---|---|
| Fish meal | 19.86 | 19.86 |
| Plant protein | 49.45 | 49.45 |
| Premix | 2.79 | 2.79 |
| Fish oil | 0.24 | 0.12 |
| Soybean oil | 21.00 | - |
| Linseed oil | - | 13.50 |
| Poultry fat | 6.64 | 14.26 |
| Proximate composition (% as fed basis) | ||
| Dry matter | 96.57 | 96.86 |
| Organic matter | 94.00 | 93.94 |
| Ash | 5.80 | 5.87 |
| Carbon | 52.97 | 51.96 |
| Hydrogen | 8.78 | 8.69 |
| Nitrogen | 7.90 | 7.78 |
| Fatty acid composition (% total FAs) | ||
| 16:0 | 12.00 | 13.00 |
| 18:0 | 4.70 | 3.90 |
| 18:1ω9 | 22.00 | 23.00 |
| 18:2ω6; LNA | 42.00 | 21.00 |
| 18:3ω3; ALA | 5.00 | 27.00 |
| 20:5ω3; EPA | 1.08 | 0.87 |
| 22:6ω3; DHA | 1.40 | 1.20 |
Experimental feeds were produced at the pilot plant at Cargill Innovation Center Dirdal, Norway.
Plant protein: soy protein concentrate, wheat gluten, fava bean meal, pea protein concentrate, and raw wheat. For confidentiality, the nature and proportions of these plant products are not provided.
Premix includes amino acids, vitamins, and pigment. Composition in micronutrients of the premix is proprietary information to Cargill, Inc.
Only FAs >1.0% in at least one of the diets are included in the table.
DHA, docosahexaenoic acid; EPA, eicosapentaenoic acid.
FIGURE 1Experimental design showing sampling time points for fatty acid and qPCR analysis. This figure was constructed using https://biorender.com/.
Primers used for qPCR.
| Gene name | Gene symbol | GenBank accession number | F and R | Primer sequence (5′–3′) | Efficiency (%) | Amplicon size (bp) | Reference |
|---|---|---|---|---|---|---|---|
|
|
| BT072280.1 | F | GGGTCAGGACAGAGTTTAGGA | 91 | 142 |
|
| R | TGGGCAGTAGGAAGAGGTAAG | ||||||
|
|
| XM_014124184.2 | F | CCACAATGGGAGCCAGAATAC | 94 | 96 |
|
| R | GGGTTACAGCCGTTCAAACA | ||||||
|
|
| NM_001139832.1 | F | CTGCTCACCATGCTGCTGTC | 95 | 93 |
|
| R | GTGTGGGAGGAGGCTTCC | ||||||
|
|
| CX354498 | F | ACTGCTGTGGGTTTCCCAAG | 103 | 98 |
|
| R | GACAGCAGCGTGATGTGCAG | ||||||
|
|
| EG843167.1 | F | CACACCAACATCCCTTACCC | 92 | 112 |
|
| R | CTTTGCTCGTGATGGAGACA | ||||||
|
|
| BT048088 | F | ACTCCTCCTGGGACTGCTCT | 95 | 109 |
|
| R | CCTCTTTGGGTGGAACTTCA | ||||||
|
|
| BT046542 | F | TAGAGCTGTGATGCTAGTTTAC | 100 | 106 |
|
| R | ACCCAGTAGCACTGAGAAGTC | ||||||
|
|
| BT057484 | F | TGGAGCCACGTCAGACATAA | 108 | 153 |
|
| R | GCACCATGTGTTTTCCAGTG | ||||||
|
|
| EG842232 | F | GGGTATTGGATCGGTTTGAC | 106 | 109 |
|
| R | TCCCTCCATTTCGACTGTTC | ||||||
|
|
| EL698766.1 | F | CCAACCGTTACTGGAGCACT | 97 | 174 |
|
| R | GGCTCCCCTTAACCCAGATA | ||||||
|
|
| BT045745 | F | CTCATGAGGGTGGTCCTCAC | 98 | 135 |
|
| R | AGGCACAGGGGGTAGGATAC | ||||||
|
|
| CX355704 | F | ATGCTGATTCCCCCTACTCC | 97 | 103 |
|
| R | ACACTGCTCAAGCCCAAGAT | ||||||
|
|
| BT048538 | F | GCAATGAAGTAGGCACAGCA | 94 | 100 |
|
| R | CGCAGCTCTATTTCCGTTTC | ||||||
|
|
| NM_001140535 | F | ACCCAACTTTCCACGTCAAG | 95 | 137 |
|
| R | CAGTAGATCCCCGATGTCGT | ||||||
|
|
| XM_014152853 | F | TGACAACGGAGGTGGAACT | 97 | 80 |
|
| R | ATGGCAATGTCCGCTTTAGG | ||||||
|
|
| BT058522.1 | F | TGGACCTTCATCGAACGAGAA | 94 | 97 |
|
| R | CGCTCTTCATTGAAAGATTTAAC | ||||||
|
|
| BT048787 | F | GGTGCTCAACAAGCTCTACA | 92 | 114 |
|
| R | GCAGGAAAGCGATGTTGTCA | ||||||
|
|
| XM_045721418 | F | CACCCGTCTGGACAAACTAATC | 109 | 102 |
|
| R | ATGTTGAGGTGAGTCAGGGT | ||||||
|
|
| AY628755 | F | ATCGCCCTGCAGATTTTATG | 102 | 101 |
|
| R | GAGCCCTCAGCGAGTTAAAG | ||||||
|
|
| NM_001123653 | F | AGACTCCAGTGTGGTGAACT | 91 | 109 |
|
| R | TACCTGCTGAATCCCGGTATAG | ||||||
|
|
| BT049358 | F | CTGTCCTCAGGGGTACGTGT | 99 | 154 |
|
| R | CTGACCAGCTTCCTCAGCTT | ||||||
|
|
| EG881931 | F | CCCAGGTCGCACCACTATAC | 96 | 112 |
|
| R | CATCAACTCCCCATCACAGA | ||||||
|
|
| EG922586 | F | CAGCACGTCATCGTTGTAGG | 92 | 103 |
|
| R | CAAGTGTCCTGTCTGCTCCA | ||||||
|
|
| BT043656 | F | AGGCGGTTTAAGGGTCAGAT | 93 | 119 |
|
| R | TCGAGCTCCTTGATGTTGTG | ||||||
|
|
| GE777139 | F | CTCCTCCTCCTCGTCCTCTT | 92 | 105 |
|
| R | GACCCCAACAAGCAAGTGAT |
Forward (F) and Reverse (R) Primers.
Primers designed in the current study.
FIGURE 2qPCR for transcripts playing roles related to lipid metabolism and inflammation ((A–I); individual RQs used in the analysis n = 9). Two-way ANOVA results are shown in the table above each panel, and t-test results (i.e., significant differences between PBS and bacterin-stimulated fish within a diet group) are shown with asterisks (“*” for p ≤ 0.05). Data are presented as mean ± SE. Overall fold-change values (FC; mean RQ in bacterin-injected group/mean RQ in PBS-injected group) are shown below the transcripts with significant differences between groups. The significance threshold was adjusted to p ≤0.05. (A) cholesterol 25-hydroxylase-like protein a; (B) lipase e, hormone-sensitive; (C) arachidonate 5-lipoxygenase b; (D) arachidonate 5-lipoxygenase a; (E) cyclooxygenase 1; (F) leukotriene a-4 hydrolase-like; (G) lipocalin-type prostaglandin d synthase; (H) 15-lipoxygenase b-like; (I) arachidonate 12-lipoxygenase.
FIGURE 4qPCR for transcripts representing the immune effectors and transcription factors ((A–F); individual RQs used in the analysis n = 9). Two-way ANOVA results are shown in the table above each panel, and t-test results (i.e., significant differences between PBS and bacterin-stimulated fish within a diet group) are shown with asterisks (“*” for p ≤ 0.05, “**” for p ≤ 0.01, and “***” for p ≤ 0.001). Data are presented as mean ± SE. Overall fold-change values (FC; mean RQ in bacterin-injected group/mean RQ in PBS-injected group) are shown below the transcripts with significant differences between groups. The significance threshold was adjusted to p ≤ 0.05. (A) cc motif chemokine 13; (B) cytokine-inducible sh2-containing protein; (C) e3 ubiquitin-protein ligase znrf1; (D) b-cell lymphoma 3 protein-like; (E) interferon regulatory factor 1; (F) nf-kappa-b inhibitor alpha.
FIGURE 3qPCR for transcripts representing the immune receptors ((A–H); individual RQs used in the analysis n = 9). Two-way ANOVA results are shown in the table above each panel, and t-test results (i.e., significant differences between PBS and bacterin-stimulated fish within a diet group) are shown with asterisks (“*” for p ≤ 0.05, “**” for p ≤ 0.01, and “***” for p ≤ 0.001). Data are presented as mean ± SE. Overall fold-change values (FC; mean RQ in bacterin-injected group/mean RQ in PBS-injected group) are shown below the transcripts with significant differences between groups. The significance threshold was adjusted to p ≤ 0.05. (A) tumor necrosis factor receptor superfamily member 6b; (B) c-type lectin domain family 12-member b; (C) toll-like receptor 5; (D) c-x-c chemokine receptor type 1-like; (E) c-type lectin domain family 3-member a; (F) tumor necrosis factor receptor superfamily member 11b; (G) toll-like receptor 2; (H) toll-like receptor 9.
Fatty acid profiles (% total FAs ) of the head kidney tissues of Atlantic salmon after 8 weeks of the experimental diet regimens.
| FA composition (% total FAs) | High-18:3ω3 | Switched-diet | High-18:2ω6 |
|
|---|---|---|---|---|
| 14:0 | 1.44 ± 0.08 | 1.43 ± 0.13 | 1.41 ± 0.09 | 0.975 |
| 16:0 | 14.27 ± 0.43 | 15.5 ± 1.37 | 13.8 ± 0.31 | 0.360 |
| 18:0 | 4.58 ± 0.14 | 5.1 ± 0.44 | 4.81 ± 0.14 | 0.437 |
| 18:2ω6 | 13.2 ± 0.42 | 13.75 ± 0.81 | 20.42 ± 0.69 |
|
| 20:2ω6 | 0.86 ± 0.04 | 0.84 ± 0.06 | 1.28 ± 0.07 |
|
| 20:3ω6 (DGLA) | 0.96 ± 0.05 | 1.16 ± 0.1 | 2.14 ± 0.21 |
|
| 20:4ω6 (ARA) | 1.45 ± 0.14 | 2.01 ± 0.29 | 2.41 ± 0.35 | 0.065 |
| 18:3ω3 | 9.6 ± 0.58 | 6.39 ± 0.56 | 2.19 ± 0.1 |
|
| 18:4ω3 | 1.66 ± 0.09 | 1.35 ± 0.16 | 0.82 ± 0.05 |
|
| 20:4ω3 | 1.3 ± 0.07 | 1.11 ± 0.1 | 0.66 ± 0.1 |
|
| 20:5ω3 (EPA) | 3.01 ± 0.28 | 3.38 ± 0.39 | 2.62 ± 0.26 | 0.252 |
| 22:6ω3 (DHA) | 8.36 ± 0.85 | 10.06 ± 1.45 | 10.28 ± 1.14 | 0.460 |
| ΣSFA | 21.27 ± 0.65 | 23.12 ± 1.8 | 21.11 ± 0.36 | 0.385 |
| ΣMUFA | 35.08 ± 1.2 | 33.57 ± 1.93 | 32.74 ± 1.63 | 0.593 |
| ΣPUFA | 43.49 ± 1.34 | 43.2 ± 3.3 | 46.03 ± 1.38 | 0.614 |
| P/S | 2.06 ± 0.09 | 1.98 ± 0.19 | 2.18 ± 0.05 | 0.551 |
| Σω3 | 25.67 ± 1.23 | 23.93 ± 2.48 | 17.7 ± 1.32 |
|
| DHA/EPA | 2.81 ± 0.15 | 2.93 ± 0.16 | 3.9 ± 0.21 |
|
| Σω6 | 17.17 ± 0.36 | 18.56 ± 1.01 | 27.58 ± 0.46 |
|
| ω6/ω3 | 0.68 ± 0.03 | 0.88 ± 0.13 | 1.62 ± 0.11 |
|
| EPA/ARA | 2.09 ± 0.08 | 1.79 ± 0.2 | 1.16 ± 0.08 |
|
| DHA/ARA | 5.79 ± 0.22 | 5.05 ± 0.39 | 4.42 ± 0.17 |
|
| DGLA/ARA | 0.68 ± 0.03 | 0.65 ± 0.07 | 0.95 ± 0.08 |
|
| EPA + DGLA/ARA | 3.69 ± 0.25 | 4.03 ± 0.34 | 3.57 ± 0.22 | 0.489 |
Mean ± s.e. (n = 9).
Sum saturated fatty acids.
Sum monounsaturated fatty acids.
Sum polyunsaturated fatty acids.
FIGURE 5Pearson’s correlation coefficient (r) matrix for the fold-change of the targeted transcripts. FCs were calculated using individual RQ (n = 9) of the bacterin-stimulated individual/average RQs of the PBS-injected fish for each group. Created using the “corrplot” R-software package. Significant correlations with p ≤0.05 are indicated by an asterisk (*) on the r values in the cells (blue for positive correlations and red for negative correlations).
FIGURE 6(A) Principal coordinates analysis (PCoA) for head kidney FAs and fold-change (FC) of each targeted transcript using tank mean (tank numbers = 3 for nine individual fish). (B) Significant correlation between tank means of gene expression FCs and FAs. (C) p (perm) is the statistical significance value of the pairwise comparison using permutational multivariate ANOVA (PERMANOVA), and a list of contributing variables (top 50%) that were obtained through similarity of percentage analysis (SIMPER).