Culicoides' species from a Leishmania transmission hotspot and efficacy of the Captor® suction light trap.

Culicoides have medical and veterinary importance, as they play a role as vectors of viruses, protozoa, and nematodes that cause diseases. Despite the relevance to public health, greater attention has been given to other insect vectors. Therefore, the objective of this study was to evaluate the efficiency of the Captor® light trap in capturing Culicoides that could be examined for the presence of Leishmania DNA. The insects were captured in a rural area of Santa Maria, Rio Grande do Sul, Brazil, where canine and human visceral leishmaniasis have been diagnosed. Adult insects were collected weekly, from 6:00 pm to 6:00 am, for a 12 month period using a Captor® brand suction light trap. All Culicoides were identified at species level. Pools of Culicoides were tested using the Polymerase Chain Reaction (PCR) technique for the detection of Leishmania DNA. A total of 16,016 specimens were collected (71.54% females and 28.39% males), divided among seven species. In the DNA analysis, none of the pools showed a positive result for Leishmania. The data presented demonstrate that the trap is efficient and can be an alternative for use in entomological research. They also demonstrate that, despite the females having hematophagous habits, similar to other vector insects, they did not have contact with Leishmania in the studied locality. Copyright Lignon et al.

Introduction

Culicoides Latreille, 1809 have medical and veterinary importance, as they play a role as vectors of viruses (e.g., Bluetongue Virus and Oropuche Virus), protozoa (e.g., Leucocytozoon and Haemoproteus) and filarial nematodes (e.g., Mansonella and Onchocerca) that cause diseases for animals and humans. In addition to the vectorial importance, they cause discomfort due to the painful bites that causes itching and local irritation (Borkent & Spinelli, 2007; Mellor et al., 2000). Despite the public health relevance of biting midges for public health in the Americas, including Brazil, Culicoides has been neglected if compared to other insect vectors (Rebêlo et al., 2016).

Leishmaniasis is an important parasitic disease transmitted by sand fly vectors resulting from infection by hemoprotozoa of the genus Leishmania (Monteiro, 2017). It is a public health problem worldwide and is part of the group of neglected diseases, which disable or kill millions of people representing an important medical need (Brasil, 2010). In the years 2017 to 2019, the prevalence of canine leishmaniasis diagnosed at the "Hospital Veterinário Universitário - Universidade Federal de Santa Maria" was 24.4% (Mariga et al., 2021). Between 2019 and 2020, 40 dogs were diagnosed with the disease at the same veterinary hospital (Johan, 2021) and in 2021 two human cases were confirmed, with one death (Silveira, 2022).

The disease is considered a complex of diseases with varied symptoms, transmitted by the bite of sandflies and which has shown important changes in the pattern of transmission (Alvar et al., 2012). Some authors admit the hypothesis of transmission between the canine population through ingestion of infected ticks and even copulation (Brasil, 2006). In the 1990s, a clear process of urbanization of the disease began, in addition to its geographic expansion to the southernmost states of the country, increasing its area of dissemination (Alves & Bevilacqua, 2004). In an attempt to identify alternative vectors, during studies on entomological surveys of sandflies in areas with active transmission of leishmaniasis, new species of Culicoides have been described (Rebêlo et al., 2016).

The identification of possible disease vectors is of significant epidemiological importance. Therefore, the objective of the study was to evaluate the efficiency of the Captor® light trap in the capture of Culicoides and to verify the presence of Leishmania DNA in the species collected in a rural area of Santa Maria, Rio Grande do Sul, Brazil, place of occurrence of canine and human visceral leishmaniasis.

Materials and methods

Adults Culicoides were collected weekly (three nights a week) with a Captor® brand suction light trap for twelve months (March 2020 to February 2021). The trap has a range of 120m2 and a 32W ultraviolet lamp (voltage: 220 V / 60 Hz) that attracts insects and propellers that rotate at reduced speed, sucking the insects into an internal drawer inside the trap, protecting them from constant ultraviolet exposure. The trap was installed at ~1.5 m above ground level in a rural property (29o 39′ 37.2" S; 53o 42' 32.2"W) located in Santa Maria, Rio Grande do Sul, South of Brazil (29o 41' 03" S; 53o 48' 25" W).

The property has pets (e.g. dogs) and production animals (e.g. turkeys and chickens) in its peridomicile, as well as routinely humans. And the type of vegetation in the area is native vegetation (Atlantic Forest and country vegetation) with predominance of the Atlantic Forest, with the presence of streams and lakes in the area.

The collections were carried out between 6:00 pm to 6:00 am, the captured insects were placed inside a plastic container containing 70% ethanol and transported to the Veterinary Parasitology Laboratory of the Federal University of Santa Maria for identification. Culicoides were separated from other insects under a stereoscopic microscope based on morphology and grouped into morphospecies according to the wing spotting pattern.

Specimens of each morphological group were mounted on microscope slides according to Wirth & Marston (1968) with adaptations, where they were taxonomically identified at the species level with the aid of the identification keys of Wirth & Blanton (1959), Wirth et al. (1988), Spinelli et al. (2005) and Felippe-Bauer et al. (2008). The other samples were stored and preserved in a -20oC freezer in 2 mL Eppendorf® microtubes.

The capture, collection and transport of samples of the dipterans were authorized by the System of Authorization and Information on Biodiversity (SISBIO) of the Ministry of the Environment under registration no. 76188 based on Normative Instruction no. 03/2014.

Genomic DNA was extracted from pools with 15 specimens (using whole individuals) from each morphological group using the phenol/chloroform method similar to that described by Rebêlo et al. (2016). DNA purity and concentrations were determined using a spectrophotometer. The Polymerase Chain Reaction (PCR) for the detection of Leishmania DNA was performed using specific primers for the amplification of Leishmania spp. known and verified in GenBank using BLAST: LITSR (5' CTGGATCATTTTCCGATG 3') and L5.8S (5' TGATACCACTTATCGCACTT 3') (Rebêlo et al., 2016) of 453pb. The reaction had a total volume of 25µl, using 2.5µl of 10X reaction buffer (100 mM Tris-HCl, pH 8.5 and 500 mM KCl), 1.25µl of MgCl2 (50mM), 1µl of dNTPs (2,5mM) and 0.25µl of recombinant Taq DNA Polymerase (5U/μL), 1µl of each primer (10mM), 2µl of DNA (50 μL) and 16µl of nuclease-free water. Amplification was performed in a Bio-Rad® CFX96 thermocycler by: one cycle of 94°C for two minutes, 35 cycles of three steps including denaturation (94°C for 20 seconds), annealing (50°C for 30 seconds) and extension (72°C for 1 minute) and final extension of a 72°C cycle for seven minutes. The amplified product (8µl) was analyzed by electrophoresis in a 1.5% agarose gel stained with ethidium bromide (0.5µg/mL) and visualized under ultraviolet light. A molecular weight standard of 100bp was used. As a positive control, DNA from a strain of Leishmania braziliensis provided by the Protozoology Laboratory of the Federal University of Santa Catarina was used, whose DNA extraction was performed by the phenol/chloroform method. For the negative control, ultrapure water was used.

The chi-square statistical method (significance level p < 0.05) was used to compare the absolute frequencies of all Culicoides species captured in this study. This comparison was performed according to the total number of captures and the analyzes were performed using the SAS statistical program, version 9.2 (SAS Institute, 2001).

Results

During the sampling period, 16,016 specimens of Culicoides were collected, being 71.54% females and 28.39% males (Table 1). Seven species were identified: Culicoides impusilloides Spinelli & Wirth, 1984, C. insignis Lutz, 1913, C. leopoldoi Ortíz, 1951, C. limai Barretto, 1944, C. pseudodiabolicus Fox, 1946, C. pusillus Lutz, 1913 and C. venezuelensis Ortíz & Mirsa, 1950. The most statistically frequent species were C. insignis and C. venezuelensis.

Table 1

Species of Culicoides captured in Santa Maria, Rio Grande do Sul, Brazil, from March 2020 to February 2021.

Species	Female number	Male number	Absolute frequency	Relative frequency (%)
Culicoides impusilloides	27	4	31b	0.19
Culicoides insignis	5,764	2,344	8,108a	50.62
Culicoides leopoldoi	289	132	421 b	2.62
Culicoides limai	34	12	46 b	0.28
Culicoides pseudodiabolicus	3	0	3 b	0.01
Culicoides pusillus	13	9	22b	0.13
Culicoides venezuelensis	5,329	2,056	7,385a	46.11
Total	11,459	4,548	16,016	100

Using the chi-square statistical method, values followed by a different letter in the same column differ (p < 0.05).

After sorting and identifying the biting midges, 2,400 female specimens of the five most abundant species of Culicoides were selected, which were divided into 160 pools of 15 individuals, similar to the methodology carried out by Rebêlo et al. (2016) as described in Table 2. In DNA analysis, none of the pools tested positive for Leishmania spp.

Table 2

Relation between the number of pools and the total number of specimens examined according to the species of Culicoides collected in greater abundance for carrying out the Polymerase Chain Reaction.

Species	Pools number/ Specimens number	Total specimens examined
Culicoides impusilloides	1 / 15	15
Culicoides insignis	71 / 15	1,065
Culicoides leopoldoi	15 / 15	225
Culicoides limai	2 / 15	30
Culicoides venezuelensis	71 / 15	1,065

Discussion

Despite the knowledge about the vectorial importance of Culicoides, studies with these Diptera worldwide are still considered limited. In Brazil, studies are even more incipient. Species surveys have been carried out in different Brazilian states, however, in Rio Grande do Sul the works are scarce. Some authors contributed by identifying allergic dermatitis caused by C. insignis in a flock of sheep (Corrêa et al., 2007). Carrasco et al. (2014) related the interactions between the population fluctuation of Culicoides species such as C. insignis, C. venezuelensis and C. caridei and the environmental variables in the marshes of the Lagoa dos Patos estuary. Furthermore, efforts have been made by Santarém & Felippe-Bauer (2021) annually to update species lists to facilitate the study of the Ceratopogonidae family.

Although this survey of Culicoides species in Santa Maria, RS, was carried out in a single environment (rural area), a high diversity of species was observed, including new records (Culicoides impusilloides, C. leopoldoi, C. limai, C. pseudodiabolicus and C. pusillus), which highlights the scarcity of available information, suggesting that the real diversity of Culicoides in the state may be even greater. In fact, a high number of C. insignis and C. pusillus were collected, which are vectors of the Bluetongue disease virus, an infectious, non-contagious, notifiable disease that affects domestic and wild ruminants, according to the World Organization for Animal Health (2022), which creates restrictions on the international movement of animals and their products. The disease infected sheep in Santa Maria in 2018 (Martins, 2018), so this information can be useful in epidemiological surveillance strategies to determine the risk of bluetongue outbreak and spread in Rio Grande do Sul.

Although only one trap was used, an expressive number of Culicoides was collected (16,016 specimens) in one year of research if compared to other studies found in the literature. As an example, Barros et al. (2007) obtained 2,874 specimens in one year of collections using a trap proposed by the Center for Disease Control (CDC). The Captor® light trap can be considered an efficient alternative, easy to handle, install and transport, and at a lower cost when compared to the CDC light trap (Sudia & Chamberlain, 1962), normally used for sampling blood-sucking insects (Barros et al., 2007; Laender et al., 2004; Santarém et al., 2010). Both traps attract the insect to a light source, however, the CDC trap differs in that it attracts them by a small source of incandescent light or LED light, while the Captor® attracts them by an ultraviolet light source. Both suck the insects inside through a small fan. A recent study compared the capture efficiency of two suction light traps: the ultraviolet light Onderstepoort and the incandescent light CDC type trap for collecting Culicoides species associated with livestock in South Africa, and the This result confirmed the superiority of the Onderstepoort trap (Venter et al., 2022). This data corroborates the methodology used, since the type of lamp is the same.

It is described that, in areas of humid and sub-humid climate, Lutzomyia spp. and Culicoides spp. can be captured in the same traps, thus Leishmania infection of ceratopogonids is feasible due to the obvious overlap of habitat and likely blood sources. Both are commonly collected in peridomiciliary environments, and studies show that they use similar hosts, which consist mainly of domestic and synanthropic animals (Costa et al., 2013; Gusmão et al., 2014; Rebêlo et al., 2010). Seblova et al. (2012) observed the development of Leishmania parasites in Culicoides nubeculosus. In Brazil, the presence of Leishmania DNA in Culicoides spp. was first reported by Rebêlo et al. (2016). The results showed the detection of Leishmania braziliensis DNA in C. foxi, C ignacioi and C. insignis, while the DNA of L. amazonensis was detected in C. filariferus and C. flavivenula. However, despite the presence of natural infection suggesting a possible role as potential vectors of leishmaniasis, their ability to transmit Leishmania has not been confirmed and must be tested experimentally. Unlike Rebêlo et al. (2016), in our research, it was demonstrated that, despite the females having hematophagous habits, similar to sand flies, they did not have contact with trypanosomatids in the studied locality.

Considering that there are autochthonous cases of Leishmaniasis in the studied locality since 2011 (Silva et al., 2011), it is necessary to know all the possible vectors of this disease in the region, which determines the need for further studies on the subject.

Conclusion

The data presented demonstrate that the trap used is efficient and can be an alternative for use in entomological research. C. insignis and C. venezuelensis were the most frequent species in the study. They also demonstrate that, despite the females having hematophagous habits, similar to other vector insects, they did not have contact with protozoa of the genus Leishmania in the studied locality.