| Literature DB >> 36188540 |
Qiuling Lin1, Dingguo Zhang2, Jian Zhang3, Weixiang Luo4, Zhenglei Xu2, Jun Yao2, Lisheng Wang2.
Abstract
The incidence of ulcerative colitis (UC) in China has significantly increased over the past 10 years. Here we aim to explore potential diagnostic biomarkers and anti-inflammatory targets associated with UC. Patients with UC were enrolled in this study. The expression of lncRNAs and mRNAs in the nidus of the gut mucosa and adjacent normal mucosa samples was evaluated by RNA sequencing. The role of DLEU2 in inflammation and NF-κB signaling pathway was examined by RT-qPCR, Western blotting, and ELISA with human macrophage-like cells derived from THP-1. 564 lncRNAs and 859 mRNAs are significantly altered in the nidus of the gut mucosa of UC patients. Among the differentially expressed lncRNAs, DLEU2 changes the most. The expression of DLEU2 is negatively associated with inflammatory factors such as TNF-α, IL-1α, IL-1β, IL-6, and NLRP3. Mechanistically, DLEU2 exerts anti-inflammatory activity by inhibiting the NF-κB signaling pathway. In conclusion, the lncRNA DLEU2 in the intestinal mucosa is dysregulated upon gut inflammation and may act as a diagnostic biomarker and a therapeutic target for UC.Entities:
Keywords: DLEU2; NF-κB; inflammatory factors; lncRNA; ulcerative colitis
Year: 2022 PMID: 36188540 PMCID: PMC9515961 DOI: 10.3389/fphar.2022.991448
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
Primers used in RT-qPCR.
| Forward (5′–3′ sequence) | Reverse (5′–3′ sequence) | |
|---|---|---|
|
| GGTCGGAGTCAACGGATTTGG | CCATGGGTGGAATCATATTGGAAC |
|
| CGGGGTTGGCTCTAACGAAT | GTGGCGCTATACTCTCGGAC |
|
| CCTCTCTCTAATCAGCCCTCTG | GAGGACCTGGGAGTAGATGAG |
|
| TGGTAGTAGCAACCAACGGGA | ACTTTGATTGAGGGCGTCATTC |
|
| ATGATGGCTTATTACAGTGGCAA | GTCGGAGATTCGTAGCTGGA |
|
| ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
|
| GATCTTCGCTGCGATCAACAG | CGTGCATTATCTGAACCCCAC |
FIGURE 1DLEU2 is up-regulated in UC patients. (A) The clustering heat map of the differentially expressed lncRNAs and mRNAs. (B) The barplot map of the differentially expressed lncRNAs and mRNAs. (C) The volcano map of the differential expressed lncRNAs and mRNAs. (D) TOP three differentially expressed known lncRNAs. Control, ctrl.
FIGURE 2GO and KEGG pathway enrichment analysis of the differentially expressed (DE) mRNAs and DE LncRNAs-targeting genes. (A) KEGG pathway enrichment analysis of the DE mRNAs. (B) KEGG pathway enrichment analysis of the DE lncRNAs-targeting genes.
FIGURE 3DLEU2 inhibits NF-κB-related inflammation cytokines. (A) The expression level of DLEU2 in DLEU2 and pcDNA (control) treated THP-1 cells. (B) Effects of DLEU2 overexpression on level of inflammation cytokines in THP-1 cells. (C) The expression level of DLEU2 in siDLEU2 and negative control transfected THP-1 cells. (D) Effects of DLEU2 knockdown on level of inflammation cytokines in THP-1 cells. n = 5 per group. p < 0.05 (t-test).
FIGURE 4DLEU2 inhibits NF-κB signaling pathway. (A) The level of IL-6 and TNF-α protein in THP-1 cells transfected with DLEU2 or pcDNA. (B) The protein expression level of IL-1β and p-p65 in THP-1 cells transfected with DLEU2 or pcDNA. (C) Quantification data of (B). n = 3 per group. p < 0.05 (t-test).