| Literature DB >> 36188538 |
Wenju He1, Qiang Xi2, Huantian Cui3, Pingping Zhang1, Rui Huang4, Taihuan Wang4, Dongqiang Wang1.
Abstract
Liang-Ge decoction (LG) has been used in the treatment of early stage of spesis and can ameliorate sepsis-associated lung injury. However, the mechanism of LG on sepsis-associated lung injury remains unknown. In this study, we established a rat model of sepsis-associated lung injury using the cecal ligation and puncture (CLP) method, and investigated the therapeutic effects of LG on lung injury in rats with sepsis. In addition, the anti-inflammatory, anti-oxidative and anti-apoptotic effects of LG on sepsis-associated lung injury model rats were evaluated. Besides, untargeted metabolomics was used to investigate the regulation of metabolites in rats with sepsis-associated lung injury after LG treatment. Our results showed that LG could decrease the wet/dry (W/D) ratio in lung and the total cell count and total protein concentration in bronchoalveolar lavage fluid (BALF) in septic model rats. Hematoxylin and eosin (HE) staining showed that LG reduced the infiltration of pro-inflammatory cells in lung. In addition, LG treatmment down-regulated the gene and protein expression of pro-inflammatory cytokins in lung tissue and BALF. The activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) were increased and the level of methane dicarboxylic aldehyde (MDA) was decreased in lung tissue homogenate in septic model rats after LG treament. Moreover, the numbers of apoptotic cells in lung were reduced and the activity of lactic dehydrogenase (LDH) in BALF was decreased in septic model rats after LG treament. Untargeted metabolomics analysis showed that LG treatment affected the levels of 23 metabolites in lung in septic model rats such as citric acid, methionine, threonine, alpha-ketoglutaric acid, and inositol, these metabolites were associated with the glycine, serine and threonine metabolism, cysteine and methionine metabolism, inositol phosphate metabolism and citrate cycle (TCA cycle) pathways. In conclusion, our study demonstrated the therapeutic effetcts of LG on sepsis-associated lung injury model rats. Moreover, LG could inhibit the inflammatory response, oxidative stress, apoptosis and regulate metabolites related to glycine, serine and threonine metabolism, cysteine and methionine metabolism, inositol phosphate metabolism and TCA cycle in lung in sepsis-associated lung injury model rats.Entities:
Keywords: apoptosis; inflammatory response; liang-Ge decoction; oxidative stress; sepsis-associated lung injury; untargeted metabolomics
Year: 2022 PMID: 36188538 PMCID: PMC9523795 DOI: 10.3389/fphar.2022.926134
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
FIGURE 1Grouping and dosing regimen. LG: Liang-Ge decoction, BALF: bronchoalveolar lavage fluid.
Primer sequences of target genes for rats.
| Genes | Primer sequence (5′-3′) |
|---|---|
| β-actin | Forward: CTTCCAGACACGCCATCATG |
| Reverse: TGGTGATGGCGTAGAACAGT | |
| IL-1β | Forward: GGGATGATGACGACCTGCTA |
| Reverse: TGTCGTTGCTTGTCTCTCCT | |
| IL-6 | Forward: CTCATTCTGTCTCGAGCCCA |
| Reverse: TGAAGTAGGGAAGGCAGTGG | |
| TNF-α | Forward: GAGCACGGAAAGCATGATCC |
| Reverse: TAGACAGAAGAGCGTGGTGG |
IL, interleukin; TNF-α, tumor necrosis factor alpha.
FIGURE 2LG treatment alleviated acute lung injury in septic model rats. (A) LG decreased the W/D ratio in lung. (B) LG treatment decreased the total cell count in BALF. (C) LG treatment decreased the total protein concentration in BALF. (D,E) HE staining indicated that LG treatment alleviated the pathological changes and decreased the inflammation score in lung (100×), black arrows indicated in infiltratiion of inflammatory cells and yellow arrows indicated the damage of bronchial structure. W/D: wet/dry, HE: hematoxylin and eosin. Sham group (n = 15), Model group (n = 8), LG low-dose group (n = 9), LG middle-dose group (n = 9), LG high-dose group (n = 10) ##: p < 0.01 compared with the sham group; *: p < 0.05 compared with the model group; **: p < 0.01 compared with the model group.
FIGURE 3LG treatment reduced the inflammatory response and apoptosis in lung. (A) qPCR showed that LG treatment down-regulated the mRNA expression of IL-6, IL-1β, and TNF-α in lung. (B–D) LG treatment decreased the levels of IL-1β (B), IL-6 (C) and TNF-α (D) in BALF. (E,F) TUNEL staining indicated that LG treatment decreased the proportions of apoptotic cells in lung (100×). TUNEL: terminal deoxynucleotidyl transferase deoxyuridine triphosphate (dUTP) nick end labeling. Sham group (n = 15), Model group (n = 8), LG low-dose group (n = 9), LG middle-dose group (n = 9), LG high-dose group (n = 10) ##: p < 0.01 compared with the sham group; *: p < 0.05 compared with the model group; **: p < 0.01 compared with the model group.
Acitivities of SOD and GSH-Px and level of MDA in lung tissue homogenates after LG treatment.
| Group | SOD (U/mgprot) | MDA (nmol/mgprot) | GSH-Px (U/mgprot) |
|---|---|---|---|
| Sham | 55.70 ± 14.92 | 1.73 ± 0.62 | 20.75 ± 3.80 |
| Model | 25.22 ± 15.6## | 3.85 ± 1.35## | 8.04 ± 4.58## |
| LG low-dose | 34.56 ± 6.62 | 3.24 ± 1.35 | 12.22 ± 3.54 |
| LG middle-dose | 42.16 ± 13.07* | 3.01 ± 1.03 | 12.37 ± 3.42* |
| LG high-dose | 46.66 ± 13.62** | 2.60 ± 0.62* | 16.12 ± 3.88** |
SOD, superoxide dismutase; MDA, methane dicarboxylic aldehyde; GSH-Px, glutathione peroxidase. Sham group (n = 15), Model group (n = 8), LG, low-dose group (n = 9), LG, middle-dose group (n = 9), LG, high-dose group (n = 10) ## p < 0.01 compared with the sham group; *p < 0.05 compared with the model group; **p < 0.01 compared with the model group.
Activity of LDH in BALF after LG treatment.
| Group | LDH (U/mL) |
|---|---|
| Sham | 4.37 ± 0.82 |
| Model | 31.27 ± 8.42## |
| LG low-dose | 25.36 ± 4.24 |
| LG middle-dose | 21.25 ± 2.69** |
| LG high-dose | 15.2 ± 1.61** |
LDH, lactic dehydrogenase; Sham group (n = 15), Model group (n = 8), LG, low-dose group (n = 9), LG, middle-dose group (n = 9), LG, high-dose group (n = 10) ##: p < 0.01 compared with the sham group; **p < 0.01 compared with the model group.
FIGURE 4LG treatment modulated the metabolites in lung in sepsis-associated lung injury model rats. (A) Scores plots of PCA among each group. (B,C) Scores plots of PLS-DA between the sham and model groups and the corresponding coefficient of loading plots. (D,E) Scores plots of PLS-DA between the model and LG high-dose groups and the corresponding coefficient of loading plots. (F,G) Summary of pathway analysis between sham and model groups (F) and between model and LG high-dose groups (G), the common pathways have been marked in red. (A) Glycine, serine and threonine metabolism; (B) Cysteine and methionine metabolism; (C) Nicotinate and nicotinamide metabolism; (D) Pyrimidine metabolism; (E) Inositol phosphate metabolism; (F) Citrate cycle (TCA cycle); (G) Tryptophan metabolism; (H) Aminoacyl-tRNA biosynthesis. Sham, model, and LG high-dose groups (n = 8 per group). PCA: principle component analysis, PLS-DA: partial least-squares discriminant analysis.
Differential metabolites in lung in sepsis-associated lung injury model rats after the treatment of LG.
| No. | Formula | RT [min] | m/z | Metabolites | VIP | FC | Trend | Pathway | |||
|---|---|---|---|---|---|---|---|---|---|---|---|
| M vs. S | L vs. M | M vs. S | L vs M | M vs. S | L vs. M | ||||||
| 1 | C6H8O7 | 2.08 | 191.02 | Citric acid | 1.88 | 1.41 | 3.62 | 0.18 | ↑## | ↓** | f |
| 2 | C26H43NO6 | 6.73 | 464.30 | Glycocholic acid | 1.97 | 1.02 | 4.77 | 0.36 | ↑## | ↓** | |
| 3 | C9H9NO3 | 5.34 | 178.05 | Hippuric acid | 2.01 | 1.11 | 0.23 | 1.93 | ↓## | ↑* | |
| 4 | C5H6O5 | 1.37 | 145.01 | alpha-Ketoglutaric acid | 1.63 | 1.62 | 0.55 | 4.84 | ↓## | ↑** | f |
| 5 | C6H12O6 | 1.45 | 179.06 | Inositol | 1.43 | 1.55 | 0.68 | 5.61 | ↓# | ↑** | e |
| 6 | C24H40O5 | 6.60 | 407.28 | Cholic acid | 1.38 | 1.16 | 0.28 | 2.97 | ↓# | ↑** | |
| 7 | C24H40O4 | 6.91 | 437.29 | Chenodeoxycholic Acid | 1.18 | 0.52 | 0.39 | 1.89 | ↓# | ↑* | |
| 8 | C5H9NO3 | 1.30 | 132.07 | Hydroxyproline | 1.86 | 0.62 | 3.91 | 0.15 | ↑## | ↓** | |
| 9 | C5H11NO2S | 5.30 | 150.06 | Methionine | 1.02 | 2.00 | 0.57 | 2.27 | ↓## | ↑** | b, h |
| 10 | C6H6N2O | 1.89 | 123.06 | Nicotinamide | 1.52 | 0.46 | 0.27 | 1.53 | ↓## | ↑ | c |
| 11 | C30H48O3 | 9.46 | 439.35 | Oleanolic acid | 1.51 | 1.02 | 0.57 | 3.19 | ↓## | ↑** | |
| 12 | C9H13N3O5 | 1.38 | 244.09 | Cytidine | 1.21 | 0.78 | 2.17 | 0.28 | ↑## | ↓** | d |
| 13 | C10H17N3O6S | 1.38 | 308.09 | Glutathione | 1.32 | 0.48 | 0.58 | 1.52 | ↓# | ↑ | |
| 14 | C9H12N2O5 | 6.21 | 229.08 | 2-Deoxyuridine | 1.42 | 0.29 | 3.09 | 0.23 | ↑# | ↓* | d |
| 15 | C4H4N2O2 | 1.79 | 113.03 | Uracil | 1.30 | 0.86 | 1.99 | 0.55 | ↑# | ↓ | d |
| 16 | C4H5N3O | 1.38 | 112.05 | Cytosine | 1.13 | 0.35 | 1.98 | 0.47 | ↑## | ↓** | |
| 17 | C6H5NO2 | 1.74 | 124.04 | Nicotinic Acid | 1.21 | 1.75 | 0.46 | 2.49 | ↓# | ↑* | c |
| 18 | C9H13N3O4 | 1.82 | 228.10 | 2-Deoxycytidine | 1.07 | 0.38 | 0.53 | 1.82 | ↓# | ↑ | d |
| 19 | C27H46O | 8.18 | 387.36 | Cholesterol | 1.22 | 0.39 | 0.56 | 1.68 | ↓## | ↑ | |
| 20 | C6H8O6 | 5.50 | 177.04 | l-Ascorbate | 0.18 | 1.64 | 0.96 | 1.65 | ↓ | ↑** | |
| 21 | C10H12N4O5 | 5.04 | 269.09 | Inosine | 0.22 | 1.80 | 1.16 | 0.44 | ↑ | ↓** | |
| 22 | C6H13NO2 | 3.01 | 132.10 | l-Isoleucine | 1.04 | 1.43 | 1.31 | 0.64 | ↑# | ↓** | h |
| 23 | C4H9NO3 | 1.31 | 120.07 | Threonine | 0.62 | 1.38 | 0.79 | 4.20 | ↓ | ↑** | a, h |
| 24 | C5H9NO2 | 1.37 | 116.07 | D-Proline | 0.71 | 1.14 | 0.70 | 1.79 | ↓ | ↑** | |
| 25 | C26H45NO6S | 7.13 | 500.30 | Taurodeoxycholic Acid | 0.24 | 1.44 | 1.35 | 0.35 | ↑ | ↓** | |
| 26 | C4H6O5 | 1.67 | 133.01 | DL-Malic acid | 0.61 | 1.30 | 1.21 | 0.35 | ↑ | ↓** | f |
| 27 | C11H12N2O2 | 5.13 | 157.08 | D-(+)-Tryptophan | 0.62 | 1.43 | 0.85 | 2.99 | ↓ | ↑** | g, h |
| 28 | C3H7NO3 | 1.29 | 106.05 | DL-Serine | 1.05 | 1.59 | 2.11 | 0.23 | ↑## | ↓** | a, b, h |
RT, retention time; VIP, variable importance of projection; FC: fold change; # p < 0.05 as compared to the control group; ## p < 0.01 as compared to the control group; *p < 0.05 as compared to the model group; ** p < 0.01 as compared to the model group; ↑content increased; ↓content decreased; vs. S, sham group; M, model group; L: LG, high-dose group. a, Glycine, serine and threonine metabolism; b, Cysteine and methionine metabolism; c, Nicotinate and nicotinamide metabolism; d, Pyrimidine metabolism; e, Inositol phosphate metabolism; f, Citrate cycle (TCA, cycle); g, Tryptophan metabolism; h, Aminoacyl-tRNA, biosynthesis. Sham, model, and LG, high-dose groups (n = 8 per group). # p < 0.05 compared with the sham group; ## p < 0.01 compared with the sham group; *p < 0.05 compared with the model group; **p < 0.01 compared with the model group.