| Literature DB >> 36185461 |
Zheng Zheng1,2, Yanjin He1,2, Li Long1,2, Shuaiqi Gan1,2, Shujiang Chen1,2, Min Zhang1,2, Jia Xu1,2, Ruijie Fu1,2, Yihan Liao1,2, Zhimin Zhu1,2, Hang Wang1,2, Wenchuan Chen1,2.
Abstract
Non-thermal atmospheric plasma (NTAP) modification to induce a hydrophilic titanium (Ti) surface with less carbon contamination, has been demonstrated to boost the osteogenic responses. In this study, we investigated the underlying bone formation mechanism of NTAP-Ti, and the involvement of PI3K/Akt signaling pathway in regulating osteogenic activities on NTAP-Ti surfaces. NTAP was employed for Ti activation, and PI3K inhibitor, LY294002, was applied to the suppression of PI3K/Akt pathway. We systematically and quantitatively detected the cell morphology, attachment, proliferation, osteogenic differentiation and mineralization of MC3T3-E1 mouse preosteoblasts, and molecular expressions involved in osteogenesis and PI3K/Akt signaling pathway in vivo and in vitro. A descent in osteoblast proliferation on Ti surfaces in relation to LY294002. Alkaline phosphatase (ALP) activity, as well as matrix mineralization, was mitigated by PI3K inhibitor in NTAP-Ti. Likewise, the expression levels of osteogenesis-related genes [ALP, osteocalcin (Ocn), osteopontin (Opn) and runt-related transcription factor 2 (Runx2)] on NTAP-Ti were notably attenuated by LY294002, as confirmed by the results of osteogenesis-related proteins (ALP, and Runx2) expression analysis. In addition, the expression of PI3K/Akt signal pathway proteins further verified the inhibition of LY294002 on Ti surfaces modified by NTAP. Collectively, the PI3K/Akt signal pathway was involved in the amelioration of osteogenesis induced by NTAP modification. NTAP treatment for Ti activation is promising in augmented osteogenic potential through the activation of PI3K/Akt signal pathway.Entities:
Keywords: PI3K/Akt signaling pathway; implant; non-thermal plasma; osteogenesis; surface modification; titanium
Year: 2022 PMID: 36185461 PMCID: PMC9523010 DOI: 10.3389/fbioe.2022.975840
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
The primers sequences used for qRT-PCR.
| Gene | Forward primer sequence (5′-3′) | Reverse primer sequence (5′-3′) |
|---|---|---|
| ALP | CTGCCTGAAACAGAAAGTCTGC | TATGTCTTTACCAGGAGGCGTG |
| Ocn | GGACCATCTTTCTGCTCACTCTG | ACCTTATTGCCCTCCTGCTTG |
| Opn | TTCTCCTGGCTGAATTCTGAGG | GCTGCCAGAATCAGTCACTTTC |
| Runx2 | ACGAAAAATTAACGCCAGTCGG | CACTTCACCCTCAGGACCG |
| β-actin | AGATTACTGCTCTGGCTCCTAGC | ACTCATCGTACTCCTGCTTGCT |
FIGURE 1Cell morphology, adhesion and proliferation of MC3T3-E1 cells. (A) Cell morphology of MC3T3-E1 cells cultured on Ti, Ti + L, N-Ti, N-Ti + L surface after 12 h of incubation. (B) TRITC Phalloidin, and DAPI labeled MC3T3-E1 cells on Ti surfaces at 24 h. Area (C) and density (D) of MC3T3-E1 cells were analyzed quantitatively. (E) Cell proliferation of MC3T3-E1 cells on Ti samples surface after 1 d, 3 d and 5 d of culture. Results are shown as mean ± SD; n = 6/group. Values with diverse letters are significantly different (p < 0.05).
FIGURE 2Osteogenic differentiation and mineralization of MC3T3-E1 cells on Ti, Ti + L, N-Ti, N-Ti + L surfaces. (A) ALP activity of MC3T3-E1 cells seeded on Ti surfaces for 4, 7, and 14 d. (B) Colorimetric quantitative results of mineralization. (C) ARS staining of MC3T3-E1 cells incubated on Ti surfaces for 21 d. Results are shown as mean ± SD; n = 6/group. Values with dissimilar letters are markedly different (p < 0.05).
FIGURE 3The expression of osteogenic-related genes of MC3T3-E1 cells on Ti, Ti + L, N-Ti, N-Ti + L surfaces for 4, 7, and 14 d: (A) ALP, (B) Ocn, (C) Opn, (D) Runx2. Results are shown as mean ± SD; n = 6/group. Values with diverse letters are notably different (p < 0.05).
FIGURE 4The protein expressions involved in osteogenesis and PI3K/Akt signaling pathway on Ti, Ti + L, N-Ti, N-Ti + L surfaces. (A) Western blot of ALP, Runx2, PI3K, p-PI3K, Akt, p-Akt, and β-actin protein expression of MC3T3-E1 cells after cultured on Ti surfaces for 7d. (B) Quantitative results of Western blot. Results are shown as mean ± SD; n = 4/group. Values with diverse letters are notably different (p < 0.05).
FIGURE 5Immunochemical staining and analysis of M1 implant regions in rats. (A) The p-Akt staining of Ti and N-Ti samples at 6 weeks post-operation. The p-Akt-positive cells (black arrows) were located in peri-implant bone tissue. (B) Quantitative analysis of p-Akt expression. Results are shown as mean ± SD; n = 6/group. Values with diverse letters are notably different (p < 0.05).