LOC102553417 silencing facilitates the apoptosis of hepatic stellate cells via the miR‑30e/MTDH axis.

Hepatic fibrosis is an inevitable pathological process in the progression of multiple chronic liver diseases and remains a major challenge in the treatment of liver diseases. The purpose of the present study was to demonstrate whether silencing of the long non‑coding RNA LOC102553417 promoted hepatic stellate cell (HSC) apoptosis via the microRNA (miR)‑30e/metadherin (MTDH) axis. A LOC102553417 silencing lentivirus was constructed and transduced into HSC‑T6 cells. After confirming the silencing efficiency by reverse transcription‑quantitative PCR, cell proliferation was assessed using the Cell Counting Kit‑8 assay and apoptosis was assessed using flow cytometry. The interaction between LOC102553417 and miR‑30e, and that between miR‑30e and MTDH, was demonstrated using the dual‑luciferase reporter assay and RNA binding protein immunoprecipitation. The apoptosis of HSC‑T6 cells was detected after transfection of miR‑30e mimics and inhibitors with or without silencing LOC102553417. Silencing of LOC102553417 curbed HSC‑T6 cell proliferation and expedited their apoptosis. LOC102553417 was demonstrated to target miR‑30e, whereas miR‑30e targeted MTDH. In addition, LOC102553417 silencing significantly upregulated miR‑30e expression levels, and significantly downregulated MTDH mRNA and protein expression levels, which resulted in a significantly reduced p‑Akt/Akt ratio and significantly elevated p53 protein expression levels. Transfection with miR‑30e mimic alone significantly enhanced HSC‑T6 cell apoptosis and inhibits LOC102553417 and MTDH expressions, In addition, miR‑30e mimic expedites the apoptosis of HSCs stimulated by LOC102553417 silencing; consistent results were obtained by reverse validation of miR‑30e inhibitor. In conclusion, the present study demonstrated that LOC102553417 silencing stimulated the apoptosis of HSCs via the miR‑30e/MTDH axis.

Introduction

Hepatic fibrosis (HF) is an important health condition linked to chronic liver injury and HF is a disease associated with high morbidity (1). HF is a pathological process involving structural or functional abnormalities of the liver mainly attributed to the excessive accumulation of extracellular matrix components in hepatic tissues, which can lead to liver cirrhosis and liver cancer (2). The morbidity and mortality of HF-induced liver cirrhosis and liver cancer rank sixth globally and are increasing year-on-year in China (3). Previous studies reported that drugs for liver fibrosis treatment mainly inhibit hepatocyte apoptosis (emricasan) (4) and hepatic stellate cell (HSC) activation (PRI-724) (5), reduce fibrotic scar evolution and contraction (simtuzumab) (6), and regulate the immune response (cenicriviroc) (7). However, there is currently a lack of effective strategies and drugs to directly treat this disease (8,9). Numerous studies have demonstrated that the initiation and development of HF are primarily elicited by factors including viral infections, alcohol toxins and metabolites (Such as cholesterol). Furthermore, the activation and proliferation of HSCs also serve as key drivers of HF (10,11). HSC activation is a complicated process controlled by multiple molecules and signaling pathways (12), yet its underlying mechanisms remain largely undetermined. Exploring the molecular mechanisms related to the function of HSCs in order to identify new diagnostic and therapeutic molecular targets could be instrumental in developing new possibilities for the treatment of HF.

Long non-coding (lnc)RNAs are a set of non-protein-coding transcripts with a length of over 200 nt (13). A better understanding of HF could support the use of novel concepts and avenues in the targeted therapy of HF (14). A recent study by Zhang et al (15) reported that lnc-Lfar1 was closely associated with HF and modulated the macrophage activation evoked via lipopolysaccharide and IFN-γ to influence the occurrence and development of fibrosis via the NF-κB signaling pathway. Furthermore, Liao et al (16) recently reported that the lncRNA Gpr137b-ps could bind to and impair microRNA (miRNA/miR)-200a-3p causing inhibition of chemokine (C-X-C motif) ligand 14, which may promote the pathological process of HF via alteration of the activation and proliferation of HSCs. A whole-transcriptome sequencing analysis by Gong et al (17) revealed that lncRNA LOC102553417 (Genbank ID: XR_595047) was expressed at a high level in a rat carbon tetrachloride-induced HF model. LOC102553417 is a lncRNA of rats, which can be queried through the UCSC database (genome-asia.ucsc.edu). However, the role of LOC102553417 in the occurrence and development of HF remains undetermined. In the present study, LOC102553417 silencing was used to investigate its role in HSC activation via the miR-30e/metadherin (MTDH) axis. An in-depth understanding of the functions and mechanisms of LOC102553417 in HF could provide a theoretical basis for the clinical use of LOC102553417 as a diagnostic biomarker and treatment for HF.

Materials and methods

Culture of rat HSC-T6 cells

The rat HSC-T6 cell line was purchased from The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences. Cells were cultured at 37°C with 5% CO2 in DMEM (cat. no. PM150210; Procell Life Science & Technology Co., Ltd.), which was supplemented with 10% fetal bovine serum (cat. no. 164210-500; Procell Life Science & Technology Co., Ltd.) and 1% penicillin-streptomycin (cat. no. PB180120; Procell Life Science & Technology Co., Ltd.). The cells were passaged at a 1:3 ratio and the medium was renewed three times per week. For TGF-β1 induction, HSC-T6 cells were stimulated with 10 ng/ml TGF-β1 (cat. no. HY-P7118; MedChemExpress) for 24 h at 37°C or treated with an equal amount of double-distilled H2O as the control.

Cell transduction and transfection

The LOC102553417 silencing lentiviral vector (vector no. GV492) was constructed by Guangzhou Anernor Biotechnology Co., Ltd. Briefly, GV492 plasmid vector (100 nM) and packaging plasmid (psPaX2; third generation lentiviral packaging system (vector: packaging vector: envelope ratio, 10:3:1; Promega Corporation) were mixed with lipo3000 (L3000-015; Invitrogen; Thermo Fisher Scientific, Inc.) were co-transfected into 1×106 293T cells (Cell Bank of the Chinese Academy of Sciences). When 293T cells were cultured for 4 days, the cell supernatant was collected, and then the collected cell supernatant was centrifuged at 251.55 × g for 5 min at 4°C, and the supernatant was filtered with a 0.22 µm membrane. The targeting sequences used for the knockdowns (KDs) and negative control (NC, non-targeting.) were as follows: KD1, 5′-GACCCTGCATCAGAGTCTTCCAGA-3′; KD2, 5′-GGACTCTTCCTGGACTACCATAAAT-3′; KD3, 5′-CATACATGCTAGGGCAGCCATTGCA-3′; and NC, 5′-TTCTCCGAACGTGTCACGT-3′. HSC-T6 cells were transduced at 37°C (multiplicity of infection, 30) for 96 h and green fluorescence was observed via fluorescence microscopy to demonstrate transduction (data not shown). LOC102553417 expression was determined via reverse transcription-quantitative (RT-q)PCR. The vector with the highest silencing efficiency was used for subsequent experimentation at 24 h post-transduction.

The miR-30e mimic (sense, 5′-UGUAAACAUCCUUGACUGGAAG-3′, double chain; antisense 5′-CUUCCAGUCAAGGAUGUUUACA-3′), miR-30e inhibitor (5′-CUUCCAGUCAAGGAUGUUUACA-3′), mimic NC (5′-UUUGUACUACACAAAAGUACUG-3′) and inhibitor NC (5′-CAGUACUUUUGUGUAGUACAAA-3′) vectors were synthesized by Huzhou Hippo Biotechnology Co., Ltd. Lipofectamine® 3000 kit (cat. no. L3000015; Invitrogen; Thermo Fisher Scientific, Inc.) was employed for transfection(final concentration of nucleic acid: 20nM, cell density, 50%, 37°C) for 48 h, subsequent experiments were performed 48 h after transfection.

RT-qPCR

TRIzol® reagent (cat. no. 15596-026; Invitrogen; Thermo Fisher Scientific, Inc.) was used to extract total cellular RNA. RT-PCR was performed using an RT-PCR kit (cat. no. RT-02011; Chengdu Foregene Biotechnology Co., Ltd.), which consisted of 10 µl SYBR-Green Mix, 2 µl forward (F) primer, 2 µl reverse (R) primer, 1 µl cDNA and 5 µl RNase-free deionized water. After the purity and concentration tests, RNA was reverse transcribed into cDNA (70°C, 5 min; 42°C, 60 min; 70°C, 10 min). Primer Premier 5.0 software (Premier, Inc.) was employed for primer design; each primer was composed of 20–22 bases and the product size was 70–200 bp. The reaction conditions were set as follows: Pre-denaturation for 15 sec at 95°C; 40 cycles of denaturation for 5 sec at 95°C, annealing and extension at 60°C for 30 sec; and for the melting curve, amplification at 55–95°C for 10 sec (81 cycles in total). Three parallel wells were used for each group with a blank control and a NC group at the same time. After determining the cycle threshold, the relative expression of the target gene normalized to the internal control(GAPDH was used for lncRNA and mRNA, U6 was used for miRNA) was calculated using 2−ΔΔCq analysis (18). The primer sequences were synthesized by Sangon Biotech Co., Ltd. as follows: LOC102553417 (F), AGTCCTGCCCACACTGCTTTT; LOC102553417 (R), AACAGAGGCCTGAAATAGAC; MTDH (F), AGCGGGAGGAGGTGACCCCGCC; MTDH (R), ATTTGGTTTGGGCTTTTCA; miR-30e-RT, GTCGTATCCAGTGCAGGGTCCG AGGTATTCGCACTGGATACGACCTTCCAGT; miR-30e (F), GCCGAGTGTAAACATCCT; miR-30e (R), GTCGTATCCAGTGCGAATAC; GAPDH (F), TGTGAACGGATTTGGCCGTA; GAPDH (R), GATGGTGATGGGTTTCCCGT; U6 (F), CTCGCTTCGGCAGCACA; and U6 (R), AACGCTTCACGAATTTGCGT.

Western blotting

Cells were lysed using RIPA lysis buffer (cat. no. P0013B; Beyotime Institute of Biotechnology). Following homogenization, lysis and centrifugation at 200 × g for 5 min at 4°C, total protein was extracted and the concentration was assessed using the BCA method. Following separation via SDS-PAGE (5% stacking gel, 12% running gel, 20 µg total protein per lane). Electrophoresed proteins were transferred to a PVDF membrane (constant current of 200 mA for 1 h and a constant current of 250 mA for 2 h). The membrane was then blocked with TBS-Tween (Tween 0.1% in TBS) solution containing 5% skimmed milk powder for 1 h and was incubated with primary antibodies against the following proteins: Akt (1:500; cat. no. ab18785; Abcam), phosphorylated (p)-Akt (1:500; cat. no. ab8933; Abcam), p53 (1:333; cat. no. ab26; Abcam), MTDH (1:10,000; cat. no. ab124789; Abcam), β-actin (1:20,000; cat. no. 66009-1-Ig; ProteinTech Group, Inc.), Cleaved Caspase-3 (1:500; cat. no. ab32042; Abcam) and caspase-3 (1:1,000; cat. no. 19677-1-AP; ProteinTech Group, Inc.). After 1 h of agitation at room temperature, overnight incubation was performed with the primary antibodies at 4°C. After washing, the membrane was incubated with a secondary antibody (HRP; anti-rabbit 1:5000, cat. no. 074-1506; anti-mouse 1:5000, cat. no. 074-1807; KPL, Inc.) for 1 h at 37°C. The bands were visualized using ECL kit (P0018S; Beyotime Institute of Biotechnology), followed by pressing, exposure and fixation. Grayscale analysis of the images was performed using ImageJ software 1.8.0 (National Institutes of Health).

Cell Counting Kit-8 (CCK-8)

HSC-T6 cell suspension was prepared and seeded onto a 96-well plate (100 µl/well) at 1×103 cells/well with three parallel wells for each group. On each of 5 consecutive days, 10 µl CCK-8 reagent (cat. no. FC101-03; TransGen Biotech Co., Ltd.) was added to each well. Following incubation in 37°C and 5% CO2 incubator for 2 h, absorbance was quantified at 450 nm using an ELx800 Absorbance Microplate Reader (BioTek Instruments Inc.).

Flow cytometry

HSC-T6 cells were transferred directly into a 10-ml centrifuge tube at 106/ml cells per sample, total 1ml. Following centrifugation at 200 × g for 5 min, the supernatant was discarded. Subsequently, cells (100 µl) were suspended in a 5 ml flow tube and incubated with 5 µl Annexin V-PE and 5 µl PI (cat. no. 640914; Biolegend, Inc.) at ambient temperature for 15 min. The samples were then loaded onto a CytoFLEX Flow Cytometer (Beckman Coulter, Inc.) for apoptosis analysis with FlowJo Software V10 (FlowJo, LLC).

Bioinformatics analysis of binding sites

It has been reported that miR-30e is a miRNA associated with HF using the RegRNA2 database (regrna2.mbc.nctu.edu.tw/) (19), predicted that wild-type (WT) LOC102553417 contained a binding site with miR-30e. The binding site was mutated into the original complementary sequence and designed as LOC102553417 mutant (MUT). The TargetScan database, version 8.0 (http://www.targetscan.org/vert_80/) was used to identify potential target genes selecting the total context++ score <-0.8, aggregate PCT ≥90 and selecting for genes that have been reported to be related to liver disease. miR-30e was predicted to have a binding site with MTDH and based on the binding site, the binding site was mutated into the original complementary sequence and designed as MTDH MUT.

Dual-luciferase reporter assay

Log-phase HSC-T6 cells were seeded into a 24-well plate and cultured for 24 h. Cell transfection by lipo3000 (L3000-015; Invitrogen; Thermo Fisher Scientific, Inc.) was performed using MTDH 3′UTR or LOC102553417 (wild or mutant type) psicheck2 luciferase reporter gene plasmid (Shanghai Genechem Technology Co., Ltd), Renilla control plasmid, aforementioned miR-30e mimic or mimic-NC. Three parallel wells were used in each group. After culture at 37°C and 5% CO2 for 24 h, the medium was discarded and the residual medium was removed via two washes in ice-cold PBS. Immediately following transduction, activity measurement was performed. According to the manufacturers' protocol, 100 µl 1X Passive Lysis Buffer from the Dual-Luciferase Reporter Assay System kit (cat. no. E1910; Promega Corporation) was added to each well. Following gentle shaking, the cells were maintained at ambient temperature for 15 min. The lysate (20 µl) was placed into a 96-well plate and the luminescence was quantified using a Lux-T020 Ultra-sensitive Tube Luminometer (Guangzhou Biolight Biotechnology Co., Ltd.) for statistical analysis of relative luciferase activity normalized to Renilla luciferase activity.

RNA-binding protein immunoprecipitation (RIP)

According to the manufacturer's instructions of RIP kit (cat. no. Bes5101; Guangzhou Boxin Biotechnology Co., Ltd.), RIP buffer and Argonaute RNA-induced silencing complex catalytic component 2 (Ago2) antibodies 3ug (cat. no. ab233727; Abcam) were equilibrated at ambient temperature for 10 min. The harvested HSC-T6 cells were lysed with RIP lysis buffer at 4°C for 10 min, washed with 2 ml PBS and centrifuged at 200 × g for 5 min at room temperature to collect cell lysate. The cell lysate (100 µl) was incubated with RIP buffer (900 µl) containing antibody-labeled A + G magnetic beads (20 µl) at 4°C for 16 h (overnight). IgG (cat. no. ab172730; Abcam) served as a NC and the supernatant was harvested as ‘Input’ as a control. The immunoprecipitated complex was isolated and detached with 150 µl proteinase K buffer to isolate the RNA at 55°C for 1 h. RT-qPCR was employed to analyze the relative expression of miR-30e and LOC102553417 as aforementioned.

Statistical analysis

All experimental data were analyzed using Prism 8.0 software (GraphPad Software Inc.). Statistics was obtained from three repeat experiments. Data are presented as the mean ± standard deviation. Comparisons between two groups were performed using unpaired Student's t-test, whereas one-way ANOVA followed by Tukey's post-hoc test was used for comparisons among three or more groups. P<0.05 was considered to indicate a statistically significant difference.

Results

LOC102553417 silencing decreases HSC-T6 cell proliferation and increases their apoptosis

To ascertain the importance of LOC102553417 in the activation of HSCs, the mRNA expression levels of LOC102553417 after TGF-β1-triggered activation of HSC-T6 cells were determined using RT-qPCR. LOC102553417 mRNA expression levels in the TGF-β1-induced group were significantly higher compared with those in the control group (P<0.001; Fig. 1A). Post-transduction of HSC-T6 cells with LOC102553417 silencing vectors and NC vector, LOC102553417 mRNA expression levels were assessed via RT-qPCR. The mRNA expression levels of LOC102553417 in the KD1 group (0.20±0.02), KD2 group (0.12±0.01) and KD3 group (0.16±0.01) were all significantly downregulated compared with those in the NC vector group (1.00±0.03; P<0.001). The silencing efficiency of LOC102553417 KD2 was the greatest (Fig. 1B); therefore, KD2 was selected for use in the subsequent experiments. CCK-8 assay demonstrated significantly reduced proliferation of HSCs in LOC102553417-silenced cells compared with in the NC group (P<0.001; Fig. 1C). Furthermore, flow cytometry data demonstrated increased cell apoptosis in LOC102553417-silenced cells compared with in the NC group (P<0.001; Fig. 1D and E).

Figure 1.

LOC102553417 silencing limits HSC-T6 cell proliferation and their resistance to apoptosis. (A) LOC102553417 expression in TGF-β1-activated HSC-T6 cells was assessed via RT-qPCR. (B) Transfection efficiency of LOC102553417 KD vectors in HSC-T6 cells presented as mRNA expression levels was assessed via RT-qPCR. (C) Proliferation of HSC-T6 cells was assessed via Cell Counting Kit-8 assay following LOC102553417 silencing. (D) Flow cytometry dot plots and (E) statistical analysis of the apoptotic rate of HSC-T6 cells following LOC102553417 silencing. Results are expressed as the mean ± SD (n=3). ***P<0.001. RT-qPCR, reverse transcription-quantitative PCR; NC, negative control; KD, knockdown; OD, optical density.

LOC102553417 competitively binds to miR-30e, which upregulates MTDH expression

Using the RegRNA2 database predicted that wild-type (WT) LOC102553417 contained a binding site with miR-30e. MUT LOC102553417 was designed (Fig. 2A. Using the TargetScan predicted that WT MTDH 3′UTR contained a binding site with miR-30e. MUT MTDH 3′UTR was designed (Fig. 2B).

Figure 2.

LOC102553417 silencing suppresses MTDH expression via competitively binding to miR-30e. Alignment of the binding site between (A) LOC102553417, miR-30e and the designed MUT sequence, and (B) miR-30e, MTDH and the designed MUT sequence. Binding of (C) miR-30e to LOC102553417 and (D) miR-30e to MTDH were assessed via dual-luciferase reporter assay. (E) Binding of miR-30e to LOC102553417 was assessed via RNA binding protein immunoprecipitation. mRNA expression levels of (F) miR-30e and (G) MTDH were assessed via RT-qPCR. (H) Representative western blotting images of MTDH, Akt, p-Akt, p53, caspase-3 and cleaved caspase-3 protein bands. (I) Statistical analysis of MTDH, Akt, p-Akt, p53, caspase-3 and cleaved caspase-3 protein expression levels assessed via western blotting. Results are expressed as the mean ± SD (n=3). **P<0.01; ***P<0.001; ns, no significant difference; WT, wild-type; MUT, mutant; NC, negative control; Ago2, Argonaute RNA-induced silencing complex catalytic component 2; p, phosphorylated; miR, microRNA; MTDH, metadherin; RT-qPCR, reverse transcription-quantitative PCR; NC, negative control; KD, knockdown.

The binding of LOC102553417 to miR-30e was demonstrated by the dual-luciferase reporter assay. Luciferase activity was significantly reduced in the LOC102553417-WT + miR-30e mimic compared with that in the LOC102553417-WT + miR-NC group (P<0.01; Fig. 2C). However, the LOC102553417-MUT + miR-30e mimic demonstrated no significant difference in luciferase activity compared with the LOC102553417-MUT + miR-NC group (P>0.05), which demonstrated the binding of LOC102553417 to miR-30e at the aforementioned binding site. The binding of MTDH to miR-30e was also demonstrated using the luciferase assay. Compared with the MTDH-WT + miR-NC group, the MTDH-WT + miR-30e mimic group demonstrated significantly reduced luciferase activity (P<0.01); however the MTDH-MUT + miR-30e mimic group demonstrated no significant difference in luciferase activity compared with the MTDH-MUT + miR-NC group (P>0.05; Fig. 2D), which demonstrated the binding of miR-30e to MTDH at the binding site predicted using TargetScan database.

Antibodies to Ago2, a miRNA precursor cleavage protein, were used to conduct RIP experiments to verify the binding of miR-30e to LOC102553417. Compared with in the IgG antibody group (NC antibody), significantly higher expression levels of miR-30e and LOC102553417 were detected in the Ago2 antibody group (P<0.001; Fig. 2E). Subsequently, LOC102553417 was silenced in HSC-T6 cells, the miR-30e and MTDH expression levels were determined via RT-qPCR, and the MTDH protein expression levels were assessed via western blotting. miR-30e relative expression levels in the KD group were significantly elevated compared with those in the NC group (P<0.001; Fig. 2F). MTDH mRNA expression levels (P<0.001; Fig. 2G) and protein expression levels (P<0.001; Fig. 2H and I) were significantly reduced in the LOC102553417 KD group compared with those in the NC group. Western blot analysis of the protein expression levels of p-Akt, Akt, caspase-3, cleaved caspase-3 and p53 was used to assess the downstream mechanism of the LOC102553417/miR-30e/MTDH axis. Western blotting demonstrated significant reductions in the p-Akt/Akt ratio (P<0.001), and significant elevations in p53, caspase-3 and cleaved caspase-3 protein expression levels (P<0.001) in the LOC102553417 KD group compared with those in the NC group.

miR-30e inhibits LOC102553417 and MTDH expression levels and expedites the apoptosis of HSCs in which LOC102553417 is knocked down

The present study subsequently focused on whether LOC102553417 could function via the miR-30e/MTDH axis. miR-30e mimic, miR-30e inhibitor, NC-mimic and NC-inhibitor were constructed and transfected into HSC-T6 cells, and the mRNA expression levels of miR-30e, LOC102553417 and MTDH were quantified via RT-qPCR. miR-30e expression levels in the miR-30e inhibitor group were significantly reduced compared with those in the NC-inhibitor group (P<0.001; Fig. 3A); however, LOC102553417 (Fig. 3B) and MTDH (Fig. 3C) expression levels were significantly increased in the miR-30e inhibitor group compared with in the NC-inhibitor group (P<0.001). miR-30e mRNA expression levels were significantly raised in the miR-30e mimic group compared with in the NC-mimic group (P<0.001). Furthermore, the miR-30e mimic resulted in significant reductions in LOC102553417 and MTDH mRNA expression levels compared with in the NC-mimic group (P<0.001).

Figure 3.

miR-30e suppresses LOC102553417 and MTDH and accelerates the apoptosis of HSC-T6 cells evoked by LOC102553417 deficiency. Quantification of expression levels of (A) miR-30e, (B) LOC102553417 and (C) MTDH via RT-qPCR. (D) Representative western blotting images of MTDH protein bands. (E) Statistical analysis of MTDH protein expression levels. (F) Representative flow cytometry dot plots and (G) statistical analysis of HSC-T6 cell apoptotic rate after treatment with miR-30e mimic or inhibitor. (H) Representative flow cytometry dot plots and (I) statistical analysis of HSC-T6 cell apoptotic rates after co-manipulation with miR-30e mimic or inhibitor and KD-LOC102553417. Results are expressed as the mean ± SD (n=3). **P<0.01 and ***P<0.001. RT-qPCR, reverse transcription-quantitative PCR; NC, negative control; KD, knockdown; MTDH, metadherin; miR, microRNA.

Western blotting demonstrated that MTDH protein expression levels were significantly elevated in the miR-30e inhibitor group compared with in the NC-inhibitor group (P<0. 001; Fig.3D and E); however, they were significantly reduced in the miR-30e mimic group compared with in the NC-mimic group (P<0.001) (Fig. 3D and E). Apoptosis analysis demonstrated that the apoptotic rate was significantly suppressed following miR-30e inhibitor transfection compared with that in the NC-inhibitor group (P<0.001; Fig. 3F and G). Furthermore, a significant increase in apoptotic rate was demonstrated after miR-30e mimic transfection compared with the NC-mimic (P<0.001). Compared with LOC102553417 silencing (NC-inhibitor + KD-LOC102553417), simultaneous miR-30e inhibitor and LOC102553417 silencing (miR-30e inhibitor + KD-LOC102553417) demonstrated a significantly reduced apoptotic rate (P<0.001), whereas simultaneous miR-30e mimic and LOC102553417 silencing (miR-30e mimic + KD-LOC102553417) demonstrated a significant enhancement in the apoptotic rate compared with NC-mimic + KD-LOC102553417 (P<0.001) (Fig. 3H and I). These findings indicate miR-30e inhibits LOC102553417 and MTDH expression levels and expedites the apoptosis of HSCs in which LOC102553417 is knocked down.

Discussion

HF is a dynamic process that manifests through extracellular matrix accumulation triggered by chronic liver injury of any etiology, including viral infection, alcoholic liver disease and nonalcoholic steatohepatitis (12). Activation of HSCs is a crucial event in HF, and their proliferation and apoptosis are highly relevant to the initiation and development of HF (20). Previous studies have reported that the proliferation of HSCs can drive the initiation of HF and stimulating HSC apoptosis could ameliorate HF (21,22). The present study demonstrated that silencing LOC102553417 contributed to the significant suppression of HSC-T6 cell proliferation and the significant enhancement of their apoptotic rate. Therefore, it could be hypothesized that LOC102553417 may be a driver of HF, which agrees with a previous finding that LOC102553417 was highly expressed in a rat model of HF (17), and that targeting LOC102553417 could be a potential strategy to treat HF.

The gene encoding MTDH is located on the long arm of human chromosome 8 (8q22) in region 22, with a molecular weight of ~64 kDa and has previously been reported as an miR-30e-5p target gene (23). MTDH can facilitate hepatocarcinogenesis and cancer progression (24); in addition, abnormal expression of miR-30a-5p can impede the proliferative function of liver cancer cells and enhance their apoptosis via targeting of the MTDH/PTEN/AKT pathway (25). MTDH knockout has been shown to impair the proliferation and accelerate the apoptosis of hepatocellular carcinoma cells via the PTEN/AKT pathway (26); however, the significance of MTDH in HF is rarely reported. Previous studies have reported that miR-30e is abnormally expressed in liver injury and hepatocellular carcinoma (27,28). Furthermore, hepatitis B virus X protein may promote the development of liver fibrosis and hepatoma through the downregulation of miR-30e, which targets prolyl 4-hydroxylase subunit α2 (29). Moreover, human antigen R has been reported to be involved in sphingosine 1-phosphate (S1P)-induced bone marrow mesenchymal stem cell migration and can increase the stabilization of S1P receptor 3 mRNA by competing with miR-30e to regulate liver fibrosis (30). The present study demonstrated that LOC102553417 loss-of-function expedited HSC apoptosis by inhibiting MTDH expression through competitively binding to miR-30e, which could be a key mechanism responsible for the action of LOC102553417 on HSCs, which drive HF. The combination of the miR-30e inhibitor and KD-LOC102553417 significantly inhibited apoptosis. The results of the present study demonstrated that the miR-30e inhibitor significantly decreased the apoptotic rate and that silencing of LOC102553417 significantly promoted apoptosis. Furthermore, miR-30e could competitively bind to LOC102553417 and when the miR-30e inhibitor inhibited the expression of miR-30e, thus reducing the binding of miR-30e to LOC102553417, the expression of LOC102553417 was significantly increased and the cell apoptotic rate was significantly reduced. Moreover, miR-30e inhibits LOC102553417 and MTDH expression levels, and expedites the apoptosis of HSCs in which LOC102553417 is knocked down. These results further indicate that the three factors have a mutual regulatory relationship in the apoptosis of hepatic stellate cells.

Akt is a serine/threonine protein kinase. Activation of the Akt signaling pathway mainly depends on the activity of PI3K, which can be stimulated by JAK1 and CD19. Akt phosphorylation is essential for Akt activation and subsequent PI3K/Akt signaling pathway activation (31–33). Akt phosphorylates downstream targets to block cell apoptosis (34). A recent study reported that activation of the PI3K/AKT/MDM2 signaling pathway could degrade p53, inhibiting apoptosis (35). p53 is a key tumor suppressor that suppresses cell proliferation and induces apoptosis. It predominantly maintains body homeostasis via diverse regulatory mechanisms, including mediating DNA repair, impeding cell proliferation, stimulating apoptosis and boosting metabolism (36,37). The results of the present study demonstrated that LOC102553417 silencing significantly increased apoptotic rate, significantly reduced Akt protein phosphorylation and significantly upregulated p53 protein expression levels. Furthermore, the present study demonstrated that LOC102553417 silencing could enhance Akt protein phosphorylation via the miR-30e/MTDH signaling pathway. This may be the downstream pathway of the LOC102553417-mediated miR-30e/MTDH axis affecting the apoptosis of HSCs.

Notably, the present study has certain limitations. Firstly, the significantly upregulated LOC102553417 expression in clinical HF samples and its clinical significance were not verified. Furthermore, the present study was only performed on rat HSCs and needs to be further explored and verified in human cells and clinical samples. Secondly, an HF cell model was not established to validate the in vivo function and mechanism of LOC102553417. Thirdly, pathway inhibitors were not utilized to verify the downstream pathways of the LOC102553417/miR-30e/MTDH axis; therefore, an in-depth exploration of their interaction is warranted in the future.

In conclusion, the present study demonstrated that silencing LOC102553417 reinforced HSC apoptosis via the miR-30e/MTDH axis, which could be a crucial regulatory mechanism in HF and may provide a theoretical basis for HF-targeted therapy.