| Literature DB >> 36176777 |
De Xin Dang1,2, Haizhu Zhou3, Yujie Lou3, Xiao Liu4, Desheng Li1.
Abstract
This study aimed to better understand the development patterns of breast muscle and glycogen reserves in goslings during pre- and post-hatching periods. The timepoints for sampling were embryonic days 23 and 27 of hatching and days 1, 4, and 7 post hatching. We found that the body weight of goslings increased with age. The small intestine developed with age and remained reasonably constant on day 4 post hatching. The breast muscle development decreased with age and stayed relatively stable on day 1 post hatching. The diameter of myofiber increased prior to hatching and then decreased while hatching. The development patterns of breast muscle glycogen reserves were similar to the diameter of myofiber. In contrast, the contents of liver glycogen began to decrease before hatching and then increased rapidly after hatching. Moreover, the expression of Myf-5 increased with age. The expression of MSTN was maintained at high levels prior to hatching, dropped immediately after hatching, and then gradually increased with age. Additionally, we also observed that the glycogen content in the breast muscle was positively correlated with the diameter of the myofiber. The liver glycogen content was positively correlated to the relative weight of the breast muscle, the diameter of the myofiber, and the breast muscle glycogen content. The development pattern of the myofiber was synchronized with the change in the MSTN/Myf-5 ratio. This study provided a profile to understand the development patterns of breast muscle, glycogen reserves, and myogenic gene expression in goslings, which was beneficial to understanding the characteristics of energy reserves during the early life of goslings.Entities:
Keywords: breast; early-life development; glycogen; gosling; myogenic gene
Year: 2022 PMID: 36176777 PMCID: PMC9513458 DOI: 10.3389/fphys.2022.990715
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Composition and nutrient levels of the experimental basal diet (%, as-fed basis).
| Ingredients, % | |
|---|---|
| Corn | 60.00 |
| Soybean meal | 29.11 |
| Wheat bran | 6.00 |
| Fish meal | 2.00 |
| Lysine-HCl | 0.20 |
| Methionine | 0.23 |
| Dicalcium phosphate | 0.84 |
| Limestone | 0.82 |
| Sodium chloride | 0.30 |
| Vitamin and trace mineral premix | 0.50 |
| Total | 100.00 |
| Calculated value, % | |
| Metabolizable energy, MJ/kg | 11.67 |
| Available phosphorus | 0.40 |
| Analyzed composition, % | |
| Calcium | 0.78 |
| Crude protein | 19.78 |
| Methionine | 0.50 |
| Total sulfate amino acid | 0.77 |
| Lysine | 1.08 |
| Crude fiber | 0.31 |
| Neutral detergent fiber | 1.09 |
| Acid detergent fiber | 0.35 |
Provided per kg of complete diet: vitamin D3, 200 IU; vitamin A (retinyl acetate), 1500 mg; vitamin E (DL-α-tocopheryl acetate), 12.5 mg; vitamin K3, 1.5 mg; thiamine, 2.2 mg; riboflavin, 5 mg; nicotinic acid, 65 mg; folic acid, 1 mg; pantothenic acid, 15 mg; pyridoxine, 2 mg; biotin, 0.2 mg; choline, 1000 mg; Fe, 90 mg; Cu, 6 mg; Mn, 85 mg; Zn, 85 mg; I, 0.42 mg; Se, 0.3 mg; Co, 2.5 mg.
Primers used for quantitative real-time PCR.
| Gene | Accession number | Size (bp) | Primer sequence (5′→3′) | |
|---|---|---|---|---|
| β-Actin | M26111 | 158 | Forward | GCCCAGCACGATGAAGAT |
| Reverse | ATTTACGGTGGACGATGGAC | |||
| MSTN | AY448009 | 133 | Forward | GTGGCTCTTGATGACGGTAGT |
| Reverse | GCAGTGTGCTGAGGATTTGA | |||
| Myf-5 | KU744843 | 147 | Forward | GCGTTTGAGACCCTGAAGAG |
| Reverse | TCCCGGCAGGTGATAGTAGT | |||
Abbreviation: Myf-5, myogenic factor-5; MSTN, myostatin.
Accession number refer to Genbank (NCBI).
PCR, product size (base pairs).
Body weight, small intestine, and breast muscle parameters of goslings between embryonic day 23 to day 7 post hatching , .
| Age | Body weight, g | Relative weight of small intestine, % | Relative weight of breast muscle, % | Diameter of myofiber, mm |
|---|---|---|---|---|
| E23 | 46.85 ± 2.51e | 7.50 ± 0.41e | 19.18 ± 1.27a | 6.04 ± 0.43b |
| E27 | 69.33 ± 2.78d | 11.64 ± 0.47d | 10.57 ± 0.23b | 6.67 ± 0.16a |
| DOH | 80.53 ± 10.75c | 36.84 ± 4.69c | 9.98 ± 0.49b | 5.55 ± 0.22c |
| D1 | 80.29 ± 2.84c | 46.53 ± 2.51b | 6.99 ± 1.18c | 4.66 ± 0.33d |
| D4 | 120.45 ± 7.21b | 64.00 ± 4.29a | 6.72 ± 0.58c | 5.02 ± 0.32d |
| D7 | 158.96 ± 4.92a | 62.51 ± 2.50a | 6.15 ± 0.73c | 5.96 ± 0.34b |
a-eDifferent superscripts within a column indicate a significant difference (p < 0.05).
The data are presented as the means ± standard deviation.
Value presents the means of six samples (values from the three birds were pooled to form one sample) per sampling timepoint (n = 6).
Age refers to embryonic day 23 (E23), day 27 (E27), day of hatch (DOH; after hatch but before feeding), and day 1 (D1), 4 (D4), and 7 (D7) post hatching.
Liver and breast muscle glycogen contents of goslings between embryonic day 23 to day 7 post hatching , .
| Age | Breast muscle glycogen content, mg/g | Liver glycogen content, mg/g |
|---|---|---|
| E23 | 3.79 ± 0.41b | 6.06 ± 0.71d |
| E27 | 5.00 ± 0.77a | 6.86 ± 0.83cd |
| DOH | 1.73 ± 0.17c | 4.98 ± 0.44e |
| D1 | 2.07 ± 0.17c | 7.31 ± 0.93c |
| D4 | 1.83 ± 0.13c | 21.57 ± 0.74b |
| D7 | 1.63 ± 0.09c | 26.61 ± 0.72a |
a-eDifferent superscripts within a column indicate a significant difference (p < 0.05).
The data are presented as the means ± standard deviation.
Value presents the means of six samples (values from the three birds were pooled to form one sample) per sampling timepoint (n = 6).
Age refers to embryonic day 23 (E23), day 27 (E27), day of hatch (DOH; after hatch but before feeding), and day 1 (D1), 4 (D4), and 7 (D7) post hatching.
Partial correlations among body weight, small intestine, and breast muscle parameters, liver and breast muscle contents, and breast muscle-related gene expression.
| Variable | Breast muscle parameter | Diameter of myofiber | Breast muscle glycogen content | Liver glycogen content |
|---|---|---|---|---|
| Breast muscle parameter | 1.000 | 0.116 | −0.234 | 0.664*** |
| Diameter of the myofiber | 1.000 | 0.609*** | 0.571*** | |
| Breast muscle glycogen contents | 1.000 | 0.451** | ||
| Liver glycogen contents | 1.000 |
p < 0.05, p < 0.01, p < 0.001.
Representative myofiber H&E stain slice of goslings between embryonic day 23 to day 7 post hatching , .
| Diameter of myofiber, 4 × 10 | ||
|---|---|---|
|
|
|
|
| E23 | E27 | DOH |
|
|
|
|
| D1 | D4 | D7 |
Age refers to embryonic day 23 (E23), day 27 (E27), day of hatch (DOH; after hatch but before feeding), and day 1 (D1), 4 (D4), and 7 (D7) post hatching.
One of five images from each sample (in total 18 embryos were used to measure myofiber parameters in each sampling timepoint).
FIGURE 1Breast growth-related gene expression of geese on embryonic day 23 (E23), day 27 (E27), day of hatch (DOH; after hatch but before feeding), and day 1 (D1), 4 (D4), and 7 (D7) post hatching. a-eDifferent superscripts between columns indicate significant difference (P < 0.05). The data are presented as the mean ± standard deviations. The value presents the means of six samples (values from the three birds were pooled to form one sample) per sampling timepoint (n = 6). Sampling timepoint of E23 was used as the untreated control timepoint (value = 1). a-eDifferent superscripts within a column indicate a significant difference (p < 0.05).