| Literature DB >> 36160013 |
Amanda W S Martins1, Eduardo N Dellagostin1, Eduardo B Blödorn1, Tony Leandro R Silveira2, Luis A Sampaio3, Eliza R Komninou1, Antonio S Varela Junior4, Carine D Corcini5, Leandro S Nunes1, Mariana H Remião1, Gilberto L Collares6, William B Domingues1, Vinicius F Campos1.
Abstract
Variations in water salinity and other extrinsic factors have been shown to induce changes in feeding rhythms and growth in fish. However, it is unknown whether appetite-related hormones mediate these changes in Nile tilapia (Oreochromis niloticus), an important species for aquaculture in several countries. This study aimed to evaluate the expression of genes responsible for appetite regulation and genes related to metabolic and physiological changes in tilapia exposed to different salinities. Moreover, the study proposed to sequence and to characterize the cart, cck, and pyy genes, and to quantify their expression in the brain and intestine of the fish by quantitative polymerase chain reaction (qPCR). The animals were exposed to three salinities: 0, 6, and 12 parts per thousand (ppt) of salt for 21 days. Furthermore, lipid peroxidation, reactive oxygen species, DNA damage, and membrane fluidity in blood cells were quantified by flow cytometry. The results indicated an increased expression of cart, pyy, and cck and a decreased expression of npy in the brain, and the same with cck and npy in the intestine of fish treated with 12 ppt. This modulation and other adaptive responses may have contributed to the decrease in weight gain, specific growth rate, and final weight. In addition, we showed oxidative damage in blood cells resulting from increasing salinity. These results provide essential data on O. niloticus when exposed to high salinities that have never been described before and generate knowledge necessary for developing biotechnologies that may help improve the production of economically important farmed fish.Entities:
Keywords: CART; CCK; NPY; PYY; food intake; gene expression
Year: 2022 PMID: 36160013 PMCID: PMC9493302 DOI: 10.3389/fgene.2022.948228
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Target genes in appetite regulation, osmoregulation process, and primer sequences used in this study.
| Gene symbol | Function | Primer sequence 5′→ 3′ | Efficiency (%) | Objective | References |
|---|---|---|---|---|---|
|
| Anorexigenic factor | GGACAGTGCTGGTGGCCTTAGTG | — | Cloning |
|
| TCTCTGGTCTCTGTTGTTATCGCC | |||||
| AACACTGGCTGATGCCTACC | 100.6 | qRT-PCR | |||
| TTCCATACCTCTGCCTGGTG | |||||
|
| Anorexigenic factor | TGGTCTAYCTGTCCGTCTGTCTG | — | Cloning | |
| TAGCAGCGCAGGAAGAAGG | |||||
| TGCTGACATCACTCTGTCAAGG | 98.6 | qRT-PCR | |||
| AGCCAGCTCACTGGTTGTG | |||||
|
| Anorexigenic factor | TCTCACTCTCACACACTCC | — | Cloning | |
| AGGAGTACTCATACTCCTCTG | |||||
| AGAAACTCCACGGCAAACAG | 92.5 | qRT-PCR | |||
| ACTCATACTCCTCTGCACTGC | |||||
|
| Orexigenic factor | ACAAGACAGAGGTATGGGAAGA | — | qRT-PCR | |
| GGCAGCATCACCACATTG | |||||
|
| Transport of ions and absorption of water | GCTCCAGAGAGGATTTTGGAC | — | qRT-PCR |
|
| CTCCAAGACCTCCCAACTCA | |||||
|
| Transport of ions and absorption of water | GAGGCAAGATCAACAGGATTG | — | qRT-PCR |
|
| AATGTCCGAAAAGTCTATCCTGAACT | |||||
|
| Reference gene | TGGTGGGTATGGGTCAGAAAG | — | qRT-PCR |
|
| CTGTTGGCTTTGGGGTTCA |
Effects of salinity exposure on Nile tilapia growth performance.
| Control | 6 ppt | 12 ppt | |
|---|---|---|---|
| Final weight (g) | 295.5 士 11.42a | 240.8 士 14.69b | 230.9 士 13.56b |
| Specific growth rate (%/day) | 1.70 士 0.38a | −0.12 士 0.05b | −0.16 士 0.47b |
| Weight gain (g) | 72.56 士 12.1a | −5.84 士 2.68b | −9 士 23.80 |
| Glucose (mg/dl) | 60.50 士 9.13a | 62.17 士 5.41a | 147.3 士 15.87b |
| Osmolality (mOsm/kg) | 325.1 士 4.17a | 325.3 士 3.70a | 347.8 士 5.33b |
| Survival (%) | 100 | 100 | 50 |
Data are expressed as means ± standard error of the mean. Specific growth rates (%/day) were calculated as SGR = 100 (ln FW—ln IW)/Δt, where IW is the initial weight, FW is the final weight, and Δt is the number of days between samplings. The weight gain (in grams, g) was calculated as WG = final weight—initial weight; and survival (%) = (final number of fish—initial number of fish)/initial number of fish × 100. Different letters indicate significant differences between the experimental groups (one-way analysis of variance; n = 30; p < 0.05).
FIGURE 1Gene expression in the brain of Oreochromis niloticus in the control group and those exposed to 6 and 12 parts per thousand (ppt) of salt for 21 days. The relative expression of the cart (A), npy (B), pyy (C), and cck (D) mRNA was evaluated by quantitative polymerase chain reaction and normalized using the actb gene. The values are expressed as mean ± standard error of the mean. Different letters indicate significant differences between the experimental groups (one-way analysis of variance; n = 12; p < 0.05)
FIGURE 2Gene expression in the intestine of Oreochromis niloticus in the control group and those exposed to 6 and 12 parts per thousand (ppt) of salt for 21 days. The relative expression of cck (A) and npy (B) mRNA was evaluated by quantitative polymerase chain reaction and normalized using the actb gene. The values are expressed as mean ± standard error of the mean. Different letters indicate significant differences between the experimental groups (one-way analysis of variance; n = 12; p < 0.05)
FIGURE 3Gene expression in the intestine of Oreochromis niloticus in the control group and those exposed to 6 and 12 parts per thousand (ppt) of salt for 21 days. The relative expression of nka (A) and nkcc (B) mRNA was evaluated by quantitative polymerase chain reaction and normalized using the actb gene. The values are expressed as mean ± standard error of the mean. Different letters indicate significant differences between the experimental groups (one-way analysis of variance; n = 12; p < 0.05).
FIGURE 4The oxidative effects in terms of reactive oxygen species production (A), lipid peroxidation (B), membrane fluidity (C), and DNA fragmentation index (%) (D) in the erythrocytes of Oreochromis niloticus in control and in the groups of fish exposed to 6 and 12 parts per thousand (ppt) of salt, as evaluated by flow cytometry.