Versatile seamless DNA vector production in E. coli using enhanced phage lambda integrase.

Seamless DNA vectors derived from bacterial plasmids are devoid of bacterial genetic elements and represent attractive alternatives for biomedical applications including DNA vaccines. Larger scale production of seamless vectors employs engineered Escherichia coli strains in order to enable tightly regulated expression of site-specific DNA recombinases which precisely delete unwanted sequences from bacterial plasmids. As a novel component of a developing lambda integrase genome editing platform, we describe here strain MG1655-ISC as a means to easily produce different scales of seamless vectors, ranging in size from a few hundred base pairs to more than ten kilo base pairs. Since we employed an engineered lambda integrase that is able to efficiently recombine pairs of DNA crossover sites that differ in sequence, the resulting seamless vectors will be useful for subsequent genome editing in higher eukaryotes to accommodate variations in target site sequences. Future inclusion of single cognate sites for other genome targeting systems could enable modularity. These features, together with the demonstrated simplicity of in vivo seamless vector production, add to their utility in the biomedical space.

Introduction

Seamless DNA vectors—also referred to as “minicircles or minimized vectors” [1, 2]—are derived from bacterial plasmids and devoid of bacterial genetic elements such as origins of replication and resistance markers. Seamless vectors are circular, covalently closed and usually negatively supercoiled DNA molecules. They are becoming increasingly attractive for biomedical applications such as cell line engineering, biologics production, gene/cell therapy and DNA vaccination. This attractiveness is due to their enhanced transgene expression, improved safety features, reduced gene silencing, and higher gene transfer efficiency when compared to parental plasmids [3, 4].

The most common means to produce seamless DNA vectors are site-specific DNA recombinases which utilize their cognate DNA sequences that flank unwanted bacterial genetic elements. Through a precise DNA strand cutting and pasting reaction at their respective cognate sites, these enzymes can splice out intervening DNA from the rest of the molecule. The recombination reaction using plasmids as substrate thus results in two circular DNA molecules: one that carries the unwanted bacterial elements and the other representing the desired seamless vector. The site-specific recombination reaction can be carried out either in vitro with purified enzymes for cost-effective small scale production or in vivo inside the bacterium Escherichia coli to achieve medium to large scale production; the latter is currently being employed in a few commercial settings. Various protocols are available to isolate and purify seamless vectors for downstream purposes at industrial scales [5].

A number of recombinases have been utilized for in vivo production of seamless vectors in E. coli and include the wild-type phage lambda integrase [6], the yeast recombinases Cre and FLP [7, 8], the wild-type phage ΦC31 integrase [9], and the ParA resolvase [10]. For in vivo seamless vector production, a technical challenge is the stringent control of the expression of the recombinase. Leaky expression during bacterial growth will result in premature loss of the seamless vector inside the bacterium and hence severely compromises yields. In order to achieve stringent recombinase expression control, several expression systems have been employed including temperature-sensitive lambda repressor cI857/pR [6] and the plasmid-based pBAD/araC arabinose system [9]. However, employing these systems reproducibly and at larger scales remains technically challenging due to low recombination efficiency resulting in less yield of seamless vector and contamination with parental plasmids in the final preparation of seamless vectors [11, 12].

In the present study, we present an engineered E. coli strain that can easily be used for multi-scale and multi-purpose seamless vector production by in vivo site-specific recombination catalyzed by an enhanced mutant lambda integrase, dubbed IntC3 [13]. Distinct advantages of this system are the ease of handling and, due to the employment of enhanced IntC3, the application of various pairs of attachment (att) recombination site derivatives as efficient recombination substrates to yield seamless vectors ranging in size between a few hundred base-pairs to > 10 kb. This flexibility in att site sequences considerably expands the scope of future downstream applications for seamless vectors including site-specific genome editing of higher eukaryotic cells [14, 15].

Materials and methods

Engineering of E. coli strain MG1655 carrying an inducible IntC3 expression cassette

The E. coli strain MG1655 was chosen as a base for generating a versatile seamless vector bacterial producer strain because it approximates K12 wild-type cells with minimal prior genetic changes [16]. We hypothesized that this feature provides us with higher chances of success for tightly regulated expression of IntC3 via the endogenous arabinose (ara) operon. MG1655 has been maintained as a laboratory strain with minimal genetic manipulation, having only been cured of the temperate bacteriophage lambda and F plasmid by means of ultraviolet light and acridine orange, respectively [17, 18].

A policistronic sequence of 2725 bp, termed ISC, composed of the IntC3, single chain integration host factor scIHF2 [19] and chloramphenicol resistance gene (CAT) was commercially synthesized (GeneScript) (). scIHF2 (single polypeptide chain IHF) is a modified version of wild-type IHF composed of the alpha subunit of IHF inserted into the beta subunit through a novel protein engineering approach. It exhibits similar properties to wild-type IHF in term of DNA binding and bending [19]. The chosen strategy for MG1655 engineering included the precise insertion of the ISC expression cassette into the ara operon of MG1655 immediately downstream of the promoter by using the start codon of the endogenous araB gene as start codon for INTC3 (). Two primers were designed to insert the construct at this locus using routine protocols of lambda red-mediated homologous recombination reactions [20]. The ATG start codon of the IntC3 gene was re-introduced in the forward primer (). PCR amplification of the ISC construct for electroporation into electroporation-competent MG1655 cells was performed with primers: INTC3_ARAB_FWD_HR:ACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGATGGAGTGAAACGATGGGAAGAAGGCGAAGTCATGAGC and FRT_ARAB_REV_HR: GCCAAAGCTCGCACAGAATCACTGCCAAAATCGAGGCCAATTGCAATCGCTTATACAGTCGAAGTTCCTATA using Q5 High Fidelity DNA Polymerase (New England Biolabs). The thermal cycling parameters used for PCRs were as follows: initial denaturation at 98°C for 30 seconds, 35 cycles of denaturation at 98°C for 10 seconds, annealing at 65°C for 30 seconds and extension at 72°C for 2 minutes, and a final step of 72°C for 2 minutes. The resulting purified PCR product was used for subsequent electroporation into MG1655/pKD46 electroporation competent cells described below.

Genetic modification of strain MG1655-ISC.

(A) Diagram of the ara operon with the inserted gene cassette composed of integrase variant C3 (INTC3), single chain integration host factor 2 (IHF), recombination sites for Flp recombinase (FRT) as direct repeats and chloramphenicol resistance cassette (CAT). The direction of transcription of the modified ara operon is indicated. (B) The red arrow demarcates the precise position of ISC insertion by homologous recombination between start and alanine codons of araB as verified by sequencing.

MG1655/pKD46 cells were made competent for plasmid transformation using standard protocols. Briefly, plasmid pKD46 [21] was transformed, cells plated on ampicillin selection media, and grown at 30°C overnight. A single colony of pKD46-transformed MG1655 was grown overnight in DYT media plus ampicillin (200μg/ml) at 30°C. The stationary culture was diluted 1:200 in fresh 200 ml DYT media and incubated at 30°C. When OD600 had reached 0.4, the culture was induced with 1.2% L-arabinose and incubated at 37°C for 1 hr at 180 rpm. Cells were immediately chilled in an ice water bath. The culture was left on ice for 20 minutes with occasional agitation. Subsequently, cells were kept chilled and distributed into 4 X 50 ml Falcon tubes on ice. Centrifugation was at 1000g for 10 to 20 minutes at 4°C. Once the supernatant became clear, cell pellets were suspended in 25 ml of double-deionized (DD) ice-cold water. Contents of 2 X 50 ml Falcon tubes were combined and centrifuged again under the same conditions. After the supernatant became clear, each pellet was suspended in 50ml ice cold water and centrifugation was repeated. The supernatant was discarded and the pellet suspended in 50 ml ice cold 10% glycerol (diluted in DD water). The centrifugation step was repeated and the pellet re-suspended in 0.5 ml 10% glycerol. The two re-suspended pellets were combined in 2 ml pre-chilled Eppendorf tubes and mixed. OD600 of a 1:100 diluted solution (10 μl suspended cells + 990 μl of 10% glycerol) was set 0.4 to 0.6. Competent cells were stored in aliquots of 70μl-100μl per tube after flash freezing in liquid nitrogen and stored at minus 80°C.

Electroporation of the ISC PCR-amplified construct into electroporation competent MG1655/pKD46 cells was performed with Gene Pulser (BioRad) as follows: 1 to 10 ng of the PCR product were added to 100 μl competent E. coli and electroporated in pre-set conditions (set 1 or 2). Cell recovery was at 37°C for 1 hr in DYT without antibiotics. The transformed cells were spread onto DYT media + 0.1% Glucose + 15 μg/ml chloramphenicol agar plates and grown at 30°C. Growth at 37°C will subsequently lead to the loss of pKD46 plasmid since it carries a temperature sensitive origin of replication. Resulting colonies were tested by colony PCR to confirm the left and right junctions of the inserted transgene cassette, as well as the presence of the entire cassette by genomic PCR ().

Primers for left junction PCR resulting in a 291 bp product: ARAC_FWD GTCTATAATCACGGCAGAAAAGTCC and INTC3_REV TCGCCTGTCTCTGCCTAATCC. Right Junction primers will yield a PCR product of 397 bp: CAT_FWD CGCAAGGCGACAAGGTGCT and ARAB_REV CCGCTTCCATTGACTCAATGTAGTC. Genomic PCR using ARAC_FWD and ARAB REV primers will generate a 2.85 kb product.

Colony PCR was performed as follows: One colony was diluted in 50 μl DYT media + 0.1% Glucose + 15 μg/ml chloramphenicol media and 2 μl used as colony PCR template. PCR was performed using GoTaq Flexi DNA polymerase (Promega) to amplify both the junctions in 25 μl reactions. The thermal cycling parameters used for PCRs were as follows: initial denaturation at 95°C for 5 minutes, 35 cycles of denaturation at 95°C for 1 minute, annealing at 56°C for 30 seconds and extension at 72°C for 1 minute, and a final step of 72°C for 5 minutes. PCR products were verified by sequencing. We dubbed our engineered strain MG1655-ISC.

Results

Growth of engineered MG1655 strains carrying integrase expression cassettes

Our MG1655-ISC strain retained at this stage the CAT gene as part of the transgene cassette. By including the FRT sequences for the yeast Flp recombinase (, the option remained to remove the CAT expression cassette by transient Flp recombinase expression at a later stage. A critical parameter of any engineered E.coli strain for seamless vector production is the cell doubling time. We analyzed growth rates of MG1655-ISC and compared it with that of another engineered MG1655 strain that carries the same transgene expression cassette at the ara locus, except that scIHF2 [19] had been omitted. The latter strain was dubbed MG1655-IC and had been generated in parallel to MG1655-ISC following the same protocol.

An example of the growth rate analysis () revealed that the presence of bothIntC3 and scIHF2 in the ara operon had no substantial effects on exponential growth rates, with cell doubling times in the typical range of 20 to 30 minutes. Furthermore, the presence of scIHF2 does not change the cell density at stationary phase.

Outline of multi-scale seamless vector production using MG1655-ISC

The general workflow for seamless vector production using strain MG1655-ISC is summarized in . A plasmid with a standard bacterial backbone is flanked by two directly repeated lambda integrase recombination sequences, termed att1 and att2, and carries the desired DNA payload for seamless vector production. After transformation into MG1655-ISC, cells were grown with antibiotics until OD(600) reached 1.0. IntC3 and scIHF2 expression was induced by the addition of arabinose (1.5% final concentration), and cells were incubated for additional 70–90 minutes at 37°C.

Outline of multi-scale seamless vector production using MG1655-ISC.

See text for details. The catenated DNA rings generated by recombination inside E. coli are efficiently resolved into two monomeric DNA circles by topoisomerase IV. The DNA circles were purified from the E. coli strains and digested with an appropriate restriction enzyme to linearize the bacterial backbone and unrecombined substrate plasmid. This was followed by exonuclease treatment to digest the linear and nicked circular DNA products. Hence, only supercoiled seamless vector will be retained.

Induction of IntC3 leads to recombination between att1 and att2 which generates a dimeric DNA catenane consisting of one DNA ring that carried the bacterial backbone and a second DNA ring that carried the DNA payload plus one copy of a hybrid att sequence. The catenated DNA rings can be efficiently unlinked inside E.coli by endogenous type 2 topoisomerases.

Following induction of transgene expression, episomal DNA is purified from lysed MG1655-ISC cells by standard procedures, and the circular bacterial DNA is linearized by restriction digestion. The linearized DNA and contaminating nicked DNA molecules can be effectively degraded with phage T5 exonuclease. The remaining DNA is the intact, covalently closed, supercoiled seamless vector.

Mini-seamless vector production using variants of attL and attB sites in MG1655-ISC

To demonstrate broad utility of MG1655-ISC for seamless vector production, we first transformed the 6.3 kb substrate plasmid pattPhae2 (attL) (). This recombination substrate carried a 21 bp attB variant and a 121 bp attL variant recombination sequence in direct repeat orientation separated by about 530 bp. Recombination by IntC3 will result in two circular DNA molecules: a small supercoiled 530 bp mini-seamless vector and 5.8 kb supercoiled DNA that carries the bacterial backbone and other sequences.

Production of mini-seamless vectors in MG1655-ISC.

(A) Map of recombination substrate pattPhae2 (attL). The attB and attL (PT2) sequences are derivatives from the corresponding wild-type attB and attL and were placed about 500 bp apart as direct repeats. Recombination deletes the DNA segment flanked by the two att sites. (B) A suspension culture (10ml) was induced for integrase expression by arabinose and further incubation for 70 minutes. Plasmid DNA was purified and analysed by agarose gel electrophoresis. Lane L: marker ladder; Lane 1: substrate vector attPhae2 (attL) undigested; Lane 2: substrate vector attPhae2(attL) after induction, undigested; Lane 3: substrate vector NdeI digested; Lane 4: substrate vector ScaI digested; Lane 5: purified plasmid DNA after arabinose induction was digested with NdeI and T5 exonuclease; 3μl of 100μl total sample loaded; Lane 6: same as lane 5, 6 μl loaded; Lane 7: Purified plasmid DNA after arabinose induction digested with ScaI. Note that the supercoiled and linearized seamless vectors run at about the same position.

MG1655-ISC cells transformed with pattPhae2 (attL) were induced by arabinose for 70 minutes and harvested. Episomal DNA was isolated and analyzed by agarose gel electrophoresis. The results () revealed that compared to substrate DNA (lane 1), induction of IntC3 expression produced recombination products which were decatenated in vivo by endogenous topoisomerases, i.e., the two recombination product DNA rings were no longer physically (topologically) linked (lane 2; diagrammed in ). The released supercoiled mini-seamless vector (lane 2; arrow) migrates far ahead from the rest of the isolated DNA due to its small size. Restriction digestion of substrate DNA and recombination products by ScaI confirmed that the vast majority of the substrate had been recombined inside MG1655-ISC cells after arabinose induction (lanes 4 and 7, respectively). Restriction digestion of DNA isolated from induced cells by NdeI, which cleaves only the bacterial backbone segment, in the presence of T5 exonuclease resulted in supercoiled mini-seamless vector DNA with only spurious amounts of non-supercoiled (presumably nicked) mini-seamless DNA (lanes 5 and 6; arrow). The substrate DNA digested with NdeI without nuclease treatment is analyzed in lane 3. We determined that about 3 μg of pure supercoiled mini-seamless vector can easily be produced from a 100 ml culture.

Maxi-seamless vector production using variants of attP and attB sites in MG1655-ISC

In another example demonstrating broad utility of strain MG1655-ISC for seamless vector production, we transformed the 13.4 kb substrate plasmid attP4xattH4x (). This recombination substrate carried a 21 bp attB variant (attH4x) and a 241 bp attP variant (attP4x) [13]. Recombination by IntC3 will result in a large supercoiled 10.3 kb seamless vector that carries a human blood clotting factor 8-Ires-hygromycin expression cassette plus a hybrid attL sequence. The second predicted recombination product is a 3.1 kb supercoiled circular DNA that carries bacterial genetic elements plus a hybrid attR sequence.

Production of maxi-seamless vectors in MG1655-ISC.

(A) Map of recombination substrate pattP4xattH4x. The 21 bp attH4x and the 241 bp attP4x sequences are derivatives of the corresponding wild-type attB and attP sites. They flank the 3 kb bacterial backbone as direct repeats. Recombination deletes the bacterial backbone. Relative positions of relevant restriction sites are marked and predicted recombined and un-recombined restriction fragments indicated. (B) A suspension culture (10 ml) was induced for integrase expression by arabinose and further incubation for 70 minutes. Plasmid DNA was purified and analysed by agarose gel electrophoresis. L: 1 kb ladder; Lane 1: substrate vector (before transformation) digested with EcoRV generating two bands of size 7.8 kb and 5.6 kb for linear plasmid; Lane 2: transformed substrate vector (just before induction) digested with EcoRV generating two bands of size 7.8 kb and 5.6 kb for linear unrecombined plasmid; Lane 3: empty; Lane 4: substrate vector (after induction) digested with EcoRV generating four bands of size 7.8 kb and 5.6 kb for linear unrecombined plasmid, 10.3 kb for linear seamless vector and 3.1 kb for linear bacterial backbone; Lane 5: substrate vector (after induction) digested with ClaI generating three bands of size 13.4 kb for linear unrecombined plasmid, 3.1 kb for linear bacterial backbone and 10.3 kb for supercoiled seamless vector; Lane 6: substrate vector (after induction) digested with digested with ClaI and T5 exonuclease generating a supercoiled seamless vector. Note that the additional high molecular weight DNA is most likely the result of intermolecular recombination between seamless vector generating dimers.

Transformed MG1655-ISC cells were induced by arabinose as before, and isolated plasmid DNA was analyzed by agarose gel electrophoresis for recombination products. Results obtained with EcoRV-digested DNA () revealed that compared to the untransformed substrate DNA (lane 1), the vast majority of plasmid remained unrecombined after transformation to the time point just before induction of IntC3 expression by arabinose (lane 2), hence again demonstrating tight regulation of IntC3 gene expression from the engineered ara operon under the chosen experimental conditions. Induction of IntC3 expression by arabinose produced a majority of the predicted 10.3 kb and 3.1 kb recombination products (EcoRV digest, lane 4). Restriction digestion with ClaI, which cleaves only in the bacterial DNA backbone, resulted in supercoiled 10.3 kb seamless vector, the linearized unrecombined substrate (13.4 kb) and the linearized bacterial backbone (3.1 kb) (lane 5). Moreover, the 10.3 kb seamless vector remained the only product after addition of T5 exonuclease to the ClaI digest (lane 6). In this example, we also observed a possible small fraction of seamless vector dimers, which could be the result of intermolecular recombination between two hybrid attL sites occurring subsequent to intramolecular recombination (lanes 5 and 6). We determined that 60 to 90μg of supercoiled maxi-seamless vector can be produced from a 100ml culture under standard laboratory conditions after phenol/chloroform extraction and ethanol precipitation.

Discussion

We presented here the engineering and application of a novel E. coli strain carrying a tightly regulated gene cassette for the expression of the lambda integrase variant IntC3 inserted into the ara operon. By using a simple cell culture protocol, we demonstrated that IntC3 very efficiently recombined plasmids inside E. coli to yield seamless vectors ranging in size between 500 bp and >10 kb. The employment of restriction enzymes together with the highly active phage T5 exonuclease ultimately resulted in high yields of pure negatively supercoiled seamless vectors.

Novel lambda integrase variants have recently been generated as part of an evolving integrase platform technology that enables site-specific insertion of large transgene cassettes into predetermined endogenous or artificial human genomic att target sequences [13]. Since these genomic targets vary in sequence, it is important to be able to easily generate sufficient seamless target vectors that can accommodate these sequence variations in the corresponding vector-born att sites as recombination partners. The use of our catalytically enhanced IntC3 as recombinase inside E.coli addresses this issue. We demonstrated this by efficient recombination of distinct pairs of att sites on the substrate vectors, e.g. attBPhae2 x attLPhae2 and attH4x x attP4x. This sequence flexibility will expand the lambda integrase att sequence space of potential endogenous target site selection in higher eukaryotes beyond the human genome specifically for seamless payload vector integration. Furthermore, it will be easy to also include specific recombination or cleavage sequences for other genome editing systems on seamless vectors for modular use.

We have shown previously that functional seamless vectors can also be generated by purified integrase in vitro [15]. However, for applications that require large scale production, e.g., as DNA vaccines, producer E. coli strains need to be deployed [22]. Our novel strain MG1655-ISC presented here may thus become a useful means to achieve this objective based on the demonstrated ease in handling and the efficiency of recombination in the absence of leakiness. Furthermore, lambda integrase can recombine the wild-type attP site on an episomal vector with the genomic attB site in E.coli [23] which would lead to bacterial cell toxicity due to incompatible two origins on the genome. Hence, the ability of using variant att site sequences with strain MG1655-ISC may represent an advantage for large scale approaches.

(PDF)

Click here for additional data file.

Sequence of ISC target construct for generating MG1655-ISC.

See text for details.

(PPTX)

Click here for additional data file.

PCR confirmation of successful targeting events in MG1655-ISC.

(A) Colony PCR was performed with primers ARAC_FWD and INTC3_REV for left junction. PCR amplified products of the expected size 291 bp were detected in all colonies. (B) Colony PCR was performed with primers CAT_FWD and ARAB_REV for right junction. PCR amplified products of the expected size 397 bp were detected in all colonies. (C) Genomic PCR was performed with primers ARAC_FWD and ARAB_REV for full insertion amplification. PCR amplified products of the expected size 2.8 kb were detected in two colonies. L: 100 bp ladder; Lanes 1–4: MG1655/pKD46 colonies electroporated with ISC PCR-amplified construct.

(PPTX)

Click here for additional data file.

Growth curves of MG1655-ISC and MG1655-IC.

Cells of both strains in stationary phase were inoculated in fresh media and OD600 measured at different time points as indicated. Both strains show very similar exponential growth rates and cell densities in late stationary phase.

(PPTX)

Click here for additional data file.

25 Jul 2022

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Chen Ling, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following financial disclosure:

"supported through a grant from the National Research Foundation-Competitive Research Programme, Singapore to P.D. (NRF-CRP21-2018-0002). Funding for open access charge: National Research Foundation Competitive Research Programme, Singapore (NRF-CRP21-2018-0002)"

Please state what role the funders took in the study.  If the funders had no role, please state: ""The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.""

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

3. We note that you have a patent relating to material pertinent to this article. Please provide an amended statement of Competing Interests to declare this patent (with details including name and number), along with any other relevant declarations relating to employment, consultancy, patents, products in development or modified products etc. Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests by including the following statement: ""This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

This information should be included in your cover letter; we will change the online submission form on your behalf.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Comments:

The authors developed an Escherichia coli strain named MG1655-ISC to produce seamless DNA vectors. In a further step, they gave two examples for its applications. It could be used as a useful method to prepare minimized vectors, though the innovation of this method is not high. Both the preparation of minicircles by using λ integrase and the development of IntC3 has been reported by the authors in other papers (Shree, et al., 2016, Nucleic Acids Research; Namrata Chaudhari, et al., Stem Cell Res Ther.). It is not hard to combine these two ideas together for method optimization. Anyway, the study did present the results of primary scientific research, and the results sound credible. I think it fits to basic criteria of Plos One. If my understanding about the criteria is right, the manuscript could be acceptable after the concerned issues have reasonable explanations.

Some concerns:

1. Line 53-54: ‘However, employing these systems reproducibly and at larger scales remains technically challenging.’ Could the authors give further explanations on the challenges? I could not go there basing on the information provided by the authors.

2. Line 61: Could the author give enough features on the ‘flexibility in att sites’? It is the main ‘novelty’ of this method and would be quite useful for other people to design their DNA sequences basing on this method.

3. Line 70: I do not know the relationship between the tightly regulated expression of ara operon and minimal prior genetic changes. Could the authors give some proofs or references?

4. Line 73: The genome of MG1655 has some gene mutations except λ- and F-. ‘K-12 F– λ– ilvG– rfb-50 rph-1’ This genotype feature is derived from website of openwetware.

5. In the result part, the authors also used the protein scIHF2. I suggested the authors also described its background and purpose in the introduction part.

6. The sequences termed ISC was not long enough in Fig. S1. I also suggested the authors marked the names of each gene or element with underlines.

7. I suggested the authors could give a detailed protocol in the method section besides the development of MG1655-ISC.

8. After the authors got the minicircles in the enzyme reaction buffer, dose it necessary to be purified again or direct to use with these complex enzymes and reagents? If purification is necessary, does the authors calculate the yield before purification or after purification? In addition, I do not know how to calculate minicircles yield in the process. Could the authors give detailed calculation process? (Line 211) In further, if purification is necessary, I also suggested the author gave a gel picture in Fig. 3 and Fig. 4 to show if it is possible the get ‘clean’ DNA in the two examples.

9. Line 203: From lane 4 and lane 5 in Fig. 4, if the ‘majority’ of the DNA recombined, there should be only two bands. However, there are four bands with similar luminance. Majority seems to be improper. If my understandingis right, that would indicate the recombination mediated by IntC3 in cells is not thorough as expected. Could the author give some reasons or discuss it in the discussion section?

Reviewer #2: The researchers in this study described the engineering and application of a novel E. coli strain (MG1655-ISC) carrying a tightly regulated gene cassette for the expression of the enhanced mutant lambda integrase variant IntC3 inserted into the ara operon. The authors have established a simple and efficient cell culture protocol demonstrating IntC3 very efficiently recombined plasmids inside E. coli to easily produce different scales of seamless vectors ranging in size between 0.5 kb and >10 kb. The employment of restriction enzymes together with the highly active phage exonuclease T5 ultimately resulted in high yields of pure negatively supercoiled seamless vectors. This study has potential to expand the scope of future downstream applications for seamless vectors including site-specific genome editing of higher eukaryotic cells.

The manuscript is nicely written and the work is well conducted with appropriate controls. I recommend the paper could be published in the “PloS One” after the authors address the below minor points.

Minor points:

1. Line 116: The authors mentioned “degrees” instead of its symbol as used elsewhere in the manuscript.

2. Line 162, 179, 181, 204: “digestion” instead of “digest”.

3. Line 191: Add a space between “13.4” and “kb”.

4. Line 198: “was analyzed” instead of “analyzed”.

5. Units at some places have a space between number and units and some places do not have it. Please maintain uniformity throughout the manuscript.

6. At some places, the authors have written “lambda integrase” and at some places with the symbol lambda. Please maintain uniformity throughout the manuscript. Check for similar errors and edit it.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Yongzhen Xia

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

3 Sep 2022

Response to Reviewers

We would like to thank the reviewers for his/her thoughtful comments and efforts towards improving the manuscripts.

In the following sections, we address each point raised by the reviewers. All page numbers mentioned refer to the amended manuscript.

Reviewer #1: Comments:

1. Line 53-54: ‘However, employing these systems reproducibly and at larger scales remains technically challenging.’ Could the authors give further explanations on the challenges? I could not go there basing on the information provided by the authors.

We have included the explanation in the amended manuscript in line 54-56.

2. Line 61: Could the author give enough features on the ‘flexibility in att sites’? It is the main ‘novelty’ of this method and would be quite useful for other people to design their DNA sequences basing on this method.

“att” sites are flexible because not only attP but also attL can also recombine with attH for site specific recombination in human genome (Chandra et al., 2016; Makhija et al., 2018). Thus, the parental plasmids can be designed with different combinations of att sites for seamless vector production

3. Line 70: I do not know the relationship between the tightly regulated expression of ara operon and minimal prior genetic changes. Could the authors give some proofs or references?

Since MG1655 is cured of temperate lambda bacteriophage, hence there will be no leaky expression of integrase from the integrated lambda prophage (mentioned in line 73-75). In addition, as stated, we reasoned those minimal genetic changes will contribute to the functionality of the ara operon. We amended this in line 71 to “hypothesized”.

4. Line 73: The genome of MG1655 has some gene mutations except λ- and F-. ‘K-12 F– λ– ilvG– rfb-50 rph-1’ This genotype feature is derived from website of openwetware.

The mutations listed in the genotype are present in most K-12 strains and were probably acquired early in the history of the laboratory strain. A frameshift at the end of rph results in decreased pyrE expression and a mild pyrimidine starvation, such that the strain grows 10 to 15% more slowly in pyrimidine-free medium than in medium containing uracil (Jensen, 1993). The ilvG- mutation is a frameshift that knocks out acetohydroxy acid synthase II (Lawther et al., 1982). The rfb-50 mutation is an IS5 insertion that results in the absence of O-antigen synthesis (Liu and Reeves, 1994).

5. In the result part, the authors also used the protein scIHF2. I suggested the authors also described its background and purpose in the introduction part.

We have followed this suggestion and incorporated the background of protein scIHF2 in the amended manuscript in line 78-80.

6. The sequences termed ISC was not long enough in Fig. S1. I also suggested the authors marked the names of each gene or element with underlines.

We have followed this suggestion and incorporated this change in Figure S1.

7. I suggested the authors could give a detailed protocol in the method section besides the development of MG1655-ISC.

The detailed protocol for seamless vector preparation has been already mentioned in line 154-169.

8. After the authors got the minicircles in the enzyme reaction buffer, dose it necessary to be purified again or direct to use with these complex enzymes and reagents? If purification is necessary, does the authors calculate the yield before purification or after purification? In addition, I do not know how to calculate minicircles yield in the process. Could the authors give detailed calculation process? (Line 211) In further, if purification is necessary, I also suggested the author gave a gel picture in Fig. 3 and Fig. 4 to show if it is possible the get ‘clean’ DNA in the two examples.

After restriction digestion and exonuclease treatment, minicircles are purified by phenol/chloroform extraction and ethanol precipitation. Aliquots of purified DNA are quantified by standard OD readings and total yields calculated accordingly. We have added a note in line 218. The purified seamless vector was shown in lane no. 5 & 6 of Figure 3 (B) and lane no. 6 of Figure 4 (B).

9. Line 203: From lane 4 and lane 5 in Fig. 4, if the ‘majority’ of the DNA recombined, there should be only two bands. However, there are four bands with similar luminance. Majority seems to be improper. If my understanding is right, that would indicate the recombination mediated by IntC3 in cells is not thorough as expected. Could the author give some reasons or discuss it in the discussion section?

The combined intensity of the two expected recombination products (band 10.3kb for linear seamless vector and 3.1kb for linear bacterial backbone) is much higher than the combined intensities of unrecombined plasmid (bands 7.8kb and 5.6kb from unrecombined plasmid). Hence, we stated that the majority of the substrate plasmid had undergone recombination.

The figure legend for Figure 4 has been amended in line 310-319.

Reviewer #2: Comments:

1. Line 116: The authors mentioned “degrees” instead of its symbol as used elsewhere in the manuscript.

We have followed this suggestion and incorporated the change in the amended manuscript in line 115.

2. Line 162, 179, 181, 204: “digestion” instead of “digest”.

We have followed this suggestion and incorporated the change in the amended manuscript in Line 162, 179, 181, 204.

3. Line 191: Add a space between “13.4” and “kb”.

We have followed this suggestion and incorporated the change in the amended manuscript in line 191.

4. Line 198: “was analyzed” instead of “analyzed”.

We have followed this suggestion and incorporated the change in the amended manuscript in line 198.

5. Units at some places have a space between number and units and some places do not have it. Please maintain uniformity throughout the manuscript.

We have followed this suggestion and incorporated the change in the amended manuscript.

6. At some places, the authors have written “lambda integrase” and at some places with the symbol lambda. Please maintain uniformity throughout the manuscript. Check for similar errors and edit it.

We have followed this suggestion and incorporated the change in the amended manuscript.

References:

K F Jensen. The Escherichia coli K-12 "Wild Types" W3110 and MG1655 Have an rph Frameshift Mutation That Leads to Pyrimidine Starvation Due to low pyrE Expression Levels. J Bacteriol. 1993; 175(11): 3401–3407. doi: 10.1128/jb.175.11.3401-3407. PubMed PMID: 8501045.

Liu D and Reeves PR. Escherichia coli K12 regains its O antigen. Microbiol. 1994; 140: 49-57. doi.org/10.1099/13500872-140-1-49. PubMed PMID: 7512872.

Makhija H, Roy S, Hoon S, Ghadessy FJ, Wong D, Jaiswal R, et al. A novel lambda integrase-mediated seamless vector transgenesis platform for therapeutic protein expression. Nucleic Acids Res. 2018;46(16):e99. Epub 2018/06/13. doi: 10.1093/nar/gky500. PubMed PMID: 29893931; PubMed Central PMCID: PMCPMC6144826

R P Lawther, D H Calhoun, J Gray, C W Adams, C A Hauser, G W Hatfield. DNA Sequence Fine-Structure Analysis of ilvG (IlvG+) Mutations of Escherichia coli K-12. J Bacteriol. 1982 Jan; 149(1): 294–298. doi: 10.1128/jb.149.1.294-298.1982. PubMed PMID: 7033211.

Vijaya Chandra SH, Makhija H, Peter S, Myint Wai CM, Li J, Zhu J, et al. Conservative site-specific and single-copy transgenesis in human LINE-1 elements. Nucleic Acids Res. 2016;44(6):e55. Epub 2015/12/18. doi: 10.1093/nar/gkv1345. PubMed PMID: 26673710; PubMed Central PMCID: PMCPMC4824084.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

8 Sep 2022

Versatile seamless DNA vector production in E. coli using enhanced phage lambda integrase

PONE-D-22-16259R1

Dear Dr. Dröge,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Chen Ling, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: N/A

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Reviewer comments

Most of the questions have been solved, but there are still some that need to be further revised.

1. Line 61: Could the author give enough features on the ‘flexibility in att sites’? It is the main ‘novelty’ of this method and would be quite useful for other people to design their DNA sequences basing on this method.

“att” sites are flexible because not only attP but also attL can also recombine with attH for site specific recombination in human genome (Chandra et al., 2016; Makhija et al., 2018). Thus, the parental plasmids can be designed with different combinations of att sites for seamless vector production

More suggestions: I suggested that the author put this information in the introduction section.

2. I suggested the authors could give a detailed protocol in the method section besides the development of MG1655-ISC.

The detailed protocol for seamless vector preparation has been already mentioned in line 154-169.

More suggestions: I suggested the authors to describe how to prepare the seamless vector in more detailed manner. First, the volume to culture the cells could be given, since I would like to know the scale. Because the author has declared ‘large scales’ is a problem (line 54). I would like to know if the author could solve this problem here. Second, the steps about phenol/chloroform extraction and ethanol precipitation (line 218) or declared ‘standard procedures’ here (line 166) should be given too. At least a reference could be given to let audience follow. Third, how could the concentration of DNA be determined by using a standard OD method?

A more confusing thing is that how to treat the DNA with restriction digestion and T5 exonuclease in follow? Should we purify them before T5 digestion, or should we just direct add T5 enzyme inside? Do we need to purify the DNA several times with the same procedure?

In addition, I do not think it is proper to describe ‘method’ in the result section. Principle of the method could be given in the result section, but not detailed parameters.

Reviewer #2: The authors have satisfactorily addressed all the comments raised by the reviewers and can be recommended for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

16 Sep 2022

PONE-D-22-16259R1

Versatile seamless DNA vector production in E. coli using enhanced phage lambda integrase

Dear Dr. Dröge:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Chen Ling

Academic Editor

PLOS ONE