Literature DB >> 36136983

The ITS analysis and identification of Actinidia eriantha and its related species.

Xiaoqin Zhang1,2, Yixing Zhang3, Jiale Mao1, Yan Lan1, Zunjing Zhang1, Houxing Lei1.   

Abstract

The dried plant material of medically important plant Actinidia eriantha especially when it remains in the form of powder often look morphologically similar to its related species. The lack of efficient methods to distinguish the authentic material from other similar species leads to chances of adulteration. The molecular authentication of herbal plant materials such as the internal transcribed spacer (ITS) sequences is considered as more reliable method compared to morphological traits. In this study, we aim to evaluate the potential of identification for roots of A. eriantha and its related species by ITS sequences. The lengths of ITS regions ranged from 624 to 636 bp with GC content ranging from 50.96% to 59.55%. A total of 194 variation sites and 46 haplotypes were formed in 185 samples. Among them, the roots of A. eriantha possessed specific sites at 85bp (C), 205bp (T), 493bp (C), 542bp (G), 574bp (C), 582bp (T) and 610bp (G), while A. hemsleyana, A. callosa, A. valvata and A. polygama have their own specific sites. The inter-specific genetic distance among 8 Actinidia species in the range 2.28% to 11.00%. The phylogenetic tree constructed with ITS, ITS1 and ITS2 region showed that the ITS sequences have higher potential for identification in 8 Actinidia species. However, as to A. eriantha, A. hemsleyana and A. valvata, these three barcodes have the same identification ability. The ITS regions indicated that different samples from same species can be grouped together, except for A. arguta and A. melanandrah. In conclusion, the ITS sequences can be used as an efficient DNA barcode for the identification of A. eriantha and its related species.

Entities:  

Year:  2022        PMID: 36136983      PMCID: PMC9498973          DOI: 10.1371/journal.pone.0274358

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


1 Introduction

The quality and safety of medical materials are important guarantees for the health and legal rights of patients. The roots of Actinidia Eriantha Benth. is a traditional Chinese medicine. It has been included in the Standard of TCM processing in Zhejiang Province in 2015 [1], and has the function of clearing heat and detoxifying, dampness and swelling in the Traditional Chinese Medicines. The roots A. Eriantha are often used to treat breast carbuncle, rheumatic pain, tumor and other diseases [2, 3]. The genus Actinidia (family: Actinidiaceae) includes approximately 66 species, about 62 of which are distributed in China. Among them, A. Eriantha, A. valvata, A. macrosperma, and A. arguta, are identified as important medicinal species by the Standard of TCM processing in Zhejiang Province in 2015 [1]. However, it is difficult to identify them by leaves due to the diverse variability in morphological characters and short flowering and fruiting period [4]. And the medicinally important A. Eriantha species need exhaustive taxonomic expertise for taxonomic identification especially to discriminate among A. Eriantha, A. valvata, A. macrosperma, and A. arguta. The dried plant material of A. Eriantha in the form of powder looks very similar to A. Eriantha, A. valvata, A. macrosperma, and A. arguta and therefore lead to chances of adulteration [5]. For example, the root of A. Eriantha had good inhibitory effect on liver cancer and colorectal cancer [3, 6], whereas the A. valvata and A. macrosperma had obvious inhibitory effect on gastric cancer and lung cancer, and the anti-tumor effect of A. arguta was seldom reported [7, 8]. So, the adulteration in medicinal plants affect the efficacy of the drug Fig 1.
Fig 1

Leaf image of 8 species of Actinidia.

Note: All pictures from Plant Photo Bank of China.

Leaf image of 8 species of Actinidia.

Note: All pictures from Plant Photo Bank of China. The DNA sequence based molecular authentication of herbal plant materials such as the internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA (nrDNA) is considered as a more reliable method as compared to the methods based on morphological traits and biochemical methods [9, 10]. Although some scholars used SSR and RADP techniques to analyze the genetic diversity of the root of A. Eriantha [11, 12], and some scholars also studied the phylogenetic development of the genus of Actinidia by using matK and rbcL sequences [13], no report hitherto has been found to use ITS sequences to conduct species identification for the root of A. Eriantha and its related species. In this study, we attempted to use the ITS sequences for rapid identification of eight Actinidia species in China. This study will not only lay a foundation for phylogenetic analysis but also provides experimental and practical basis for the rapid authentication of A. Eriantha.

2 Materials and methods

2.1 Plant materials

All 8 Actinidia species were wild species, A. Eriantha were collected from Lishui city, Zhejiang Province and Nanping City, Fujian Province, in China, respectively, and other Actinidia species were collected from Lishui City, Zhejiang Province, in China. A total of 185 samples were collected, including 53 samples from Genbank gene database (Table 1). All voucher specimens are kept in Lishui Hospital of Traditional Chinese Medicine.
Table 1

Samples information.

Species NameLocatiy informationSamples No.Samples sizeHaplotype(number)
Actinidia eriantha Qingtian, Lishui, ZhejiangDY(1~5)5MH1(4),MH2(1)
Dagangtou,Lishui, ZhejiangHK(1~5)5MH1(5)
DAshanfeng,Lishui, ZhejiangSF(1~12)12MH1(12)
Wuyishan, Nanping, FujianWY(1~2)2MH1(1),MH3(1)
Pucheng, Nanping, FujianPC(1~7)7MH1(4), MH3(2), MH4(1)
Pucheng, Nanping, FujianFG1MH1(1)
Longquan,Lishui, ZhejiangAR(1~2)2MH1(2)
Longquan,Lishui, ZhejiangLQ1MH1(1)
Shakengkou, Lishui, ZhejiangSK(1~4)4MH1(2), MH3(1),MH5(1)
Lishan,Lishui, ZhejiangLL(1~13)13MH1(11), MH3(1), MH4(1)
Genbank (AF323800)Ae-11MH1(1)
Genbank (MG714287)Ae-21MH6(1)
Genbank (MK425151)Ae-31MH1(1)
Genbank (AF323801)Ae-41MH1(1)
Genbank (KP314044)Ae-51MH7(1)
Genbank (KP314039)Ae-61MH8(1)
Genbank (KP314038)Ae-71MH9(1)
A. polygamaLishan,Lishui, ZhejiangGT(1~10)10GZ1(1)
Genbank (KP314060)Ap-11GZ2(1)
Genbank (KP314056)Ap-21GZ1(1)
Genbank (KP314051)Ap-31GZ3(1)
Genbank (KP314035)Ap-41GZ1(1)
Genbank (KC519766)Ap-51GZ4(1)
Genbank (KC519765)Ap-61GZ4(1)
Genbank (AF323796)Ap-71GZ5(1)
Genbank (MW234501)Ap-81GZ2(1)
Genbank (MW234500)Ap-91GZ2(1)
A. melanandraLishan,Lishui, ZhejiangHT(1~10)10HL1(1)
Genbank (AF443211)Am-11HL2(1)
Genbank (MG714285)Am-21HL1(1)
Genbank (MG714282)Am-31HL3(1)
Genbank (AF323808)Am-41HL4(1)
A. argutaLishan,Lishui, ZhejiangRT(1~10)10WD1(1)
Genbank (KP314061)Aa-11WD2(1)
Genbank (KP314034)Aa-21WD3(1)
Genbank (AF323836)Aa-31WD4(1)
Genbank (AF323835)Aa-41WD5(1)
Genbank (MW234506)Aa-51WD4(1)
Genbank (KP314062)Aa-61WD6(1)
Genbank (MW234481)Aa-71WD4(1)
Genbank (MW234478)Aa-81WD4(1)
A. chinensisLishan,Lishui, ZhejiangZT(1~10)10ZH1(10)
Shakengkou, Lishui, ZhejiangZK10ZH1(9), ZH2(1)
Genbank (KC832305)Ach-11ZH3(1)
Genbank (KC832307)Ach-21ZH4(1)
Genbank (MH711099)Ach-31ZH1(1)
Genbank (MH710876)Ach-41ZH1(1)
Genbank (KC832316)Ach-51ZH5(1)
Genbank (KC519784)Ach-61ZH6(1)
Genbank (KC832302)Ach-71ZH6(1)
A. valvataLishan,Lishui, ZhejiangDT(1~10)10DE1(10)
Genbank (MG714283)Av-11DE2(1)
Genbank (MG714281)Av-21DE3(1)
Genbank (KC519764)Av-31DE4(1)
Genbank (KC519763)Av-41DE4(1)
Genbank (KC519762)Av-51DE4(1)
Genbank (AF323842)Av-61DE5(1)
A. hemsleyanaLishan,Lishui, ZhejiangCT(1~10)10CY1(10)
Genbank (MG714284)Ah-11CY1(1)
Genbank (KC519783)Ah-21CY2(1)
Genbank (KC519782)Ah-31CY2(1)
Genbank (KC519781)Ah-41CY2(1)
Genbank (AF323802)Ah-51CY3(1)
A. callosaLishan,Lishui, ZhejiangYT(1~10)10YS1(10)
Genbank (AF323803)Aca-11YS2(1)
Genbank (MH808396)Aca-21YS3(1)
Genbank (MH808395)Aca-31YS4(1)
Genbank (KC519753)Aca-41YS5(1)
Genbank (KC519739)Aca-51YS6(1)
Genbank (AF323804)Aca-61YS7(1)
Genbank (AF323828)Aca-71YS8(1)
Saurauia tristyla Genbank (KP092594)ST1ST1(1)

Note: Saurauia tristyla is the outgroup.

Note: Saurauia tristyla is the outgroup.

2.2 DNA extraction, amplification, and sequencing

Fresh young leaves of the collected samples were used for genomic DNA isolation, as previously reported. The pair of universal primers used to amplify nrDNA ITS sequences consist of P1 (5’- AGAAGTCGTAACAAGGTTTCCGTAGG- 3’) and P4 (5’- TCCTCCGCTTATTGATATGC-3’). PCR amplification was conducted using 50 μL volumes containing 5×PCR Buffer 5 μL, dNTPs (5 mmol/L) 5 μL, MgCL (25 mmol/L) 4 μL and each primer (0.5 μM) 2 μL, and 1 U Taq DNA polymerase. PCR amplification was conducted with the following parameter settings: holding at 94°C for 5 min followed by 35 cycles at 94°C for 30 s, at 56°C for 45 s, and at 72°C for 1 min, and a final extension at 72°C for 10 min. The PCR products were analyzed by 1.0% agarose gel electrophoresis, and then were sequenced in Shanghai Shenggong Biotechnology Co., Ltd, Shanghai, China.

2.3 DNA analysis

The ContingExpress and DNAman software were used to align the ITS sequences, analyze the sequence length, variation sites, and this was assisted by manual editing. The Editseq and Mega-X software were used to construct the Phylogenetic tree, calculate the inter-specific and intras-pecific genetic distances. Phylogenetic analysis was conducted according to the maximum likelihood (ML), with the following parameter: 1000 bootstrap replicates. The inter-specific and intras-pecific genetic distances were conducted according to the K2-P models.

2.4 additional information regarding the permits

The research material is plant leaves, it is not involve ethical protection and genetic information protection, so no additional information regarding the permits for the work we need.

3 Results

3.1 PCR efficiency and characteristics of ITS sequences

The success rates of PCR amplification and sequencing of ITS regions from the sampled specimens were 100%. The lengths of ITS regions were ranged from 624 to 636 bp with GC content ranging from 50.96% to 59.55%. The ITS sequence was divided into ITS1, 5.8S and ITS2 sequences, as shown in Table 2. The 5.8s sequences of the eight Actinidia species were highly conserved, with 164bp in length. The lengths of ITS1 regions were ranged from 240 to 246 bp with GC content ranging from 49.79% to 60.25%, and the ITS2 regions were ranged from 218 to 223 bp with GC content ranging from 49.77% to 62.73%.
Table 2

Composition of ITS sequences of 8 Actinidia species.

Species NameHaplotypeSequences lengthens of ITS1 (bp)GC content of ITS1 (%)Sequences lengthens of 5.8S (bp)G+C%Sequences lengthens of ITS2 (bp)G+C content of ITS2 (%)Sequences lengthens of ITS (bp)
A. erianthaMH124555.5116453.6622056.82629
A. erianthaMH224455.3316453.6622056.82628
A. erianthaMH324555.9216453.6622056.82629
A. erianthaMH424555.9216453.6622057.27629
A. erianthaMH524555.5116453.6622056.82629
A. erianthaMH624555.1016453.6622056.82629
A. erianthaMH724556.7316453.6622057.27629
A. erianthaMH824556.3316453.6622056.82629
A. erianthaMH924556.3316453.6622056.36629
A. polygamaGZ124451.6416452.4421955.71627
A. polygamaGZ224351.8516453.0521954.79626
A. polygamaGZ324351.4416453.0521954.79626
A. polygamaGZ424451.2316452.4421955.71627
A. polygamaGZ524251.6516453.0521954.79625
A. melanandraHL124459.8416454.2722062.73628
A. melanandraHL224658.1316852.9822261.26636
A. melanandraHL324559.1816454.2722062.73629
A. melanandraHL424558.7816454.2722060.45629
A. argutaWD124558.7816454.2722061.82629
A. argutaWD224459.8416454.2722062.73628
A. argutaWD324458.6116454.8822062.73628
A. argutaWD424460.2516454.2722062.73628
A. argutaWD524059.1716454.2722062.73624
A. argutaWD624358.0216454.8822062.73627
A. chinensisZH124349.7916454.2721949.77626
A. chinensisZH224350.6216454.2721951.60626
A. chinensisZH324350.6216454.2721951.60626
A. chinensisZH424350.2116454.2721952.05626
A. chinensisZH524350.6216454.2721952.05626
A. chinensisZH624350.6216454.2721952.05626
A. valvataDE124455.7416453.6622161.09629
A. valvataDE224455.7416453.6622160.63629
A. valvataDE324355.5616453.6622161.09628
A. valvataDE424454.9216453.6622360.99631
A. valvataDE524455.7416453.6622160.63629
A. hemsleyanaCY124350.2116453.0521950.23626
A. hemsleyanaCY224450.0016453.0521950.68627
A. hemsleyanaCY324350.2116453.6621850.46625
A. callosaYS124456.1516454.2721956.16627
A. callosaYS224355.9716454.2721956.62626
A. callosaYS324455.3316454.2721956.62627
A. callosaYS424458.2016454.2722057.27628
A. callosaYS524458.2016454.2722157.01629
A. callosaYS624456.1516454.2721956.62627
A. callosaYS724256.6116454.2721856.42624
A. callosaYS824353.0916454.2722056.82627

3.2 Analysis of haplotype and variable sites

A total of 46 haplotypes were formed in 185 samples (Table 1), among which 9 haplotypes were formed in A. eriantha, 5 in A. polygama, 4 in A. melanandra, 6 in A. arguta, 6 in A. chinensis, 5 in A. valvata, 3 in A. hemsleyana, and 5 in A. callosa. Analysis of Variation sites in all samples is shown in Table 3. There are 194 variation sites in 8 Actinidia species, except for A. melanandra, A. arguta and A. chinensis, the other 5 species have unique Variable sites. For example, bases at 85 bp, 205 bp, 493 bp, 542 bp, 574 bp, 582 bp, and 610 bp of A. eriantha are C, T, C, G, C, C, G, respectively. Bases at 28 bp, 79 bp, 83 bp, 109 bp, 128 bp, 448 bp, and 501 bp of A. hemsleyana are T, A, A, T, A, T, T, respectively. These mutated loci can be considered as the unique identification loci for the root of A. eriantha, A. polygama, A. valvata, A. hemsleyana and A. callosa.
Table 3

Analysis of base variation in 8 species of Actinidia.

Haplotypebase variationGenbanK No.
ITS15.8SITS2
24778899911111122444444445555566666666
88393523501224803123344890347800000124
95287452625668731024223456000
MH1CCCCTCCCTCGG/GTTCGTACACTCCAGCCTTACTGG/OK036712
MH2************/************************/OK036713
MH3************/************************/OK036795
MH4************/************************/OK036796
MH5************/************************/OK036797
MH6************/************************/MG714287
MH7************/************************/KP314044
MH8************/************************/KP314039
MH9************/************************/KP314038
CY1T*TAAT***T**A**A******T*TT*ATG*****T*/OK036804
CY2T*TAAT***T**A**A******T*TT*ATG*****T*/KC519783
CY3T*TAAT***T**A**A******T*TT*ATG*****T*/AF323802
DE1*GA**TT*C**C/*CAA**C***CT*GATGC*G**CTTOK036803
DE2*GA**TT*C**C/*CAA**C***CT*GATGC*G**CTTMG714283
DE3*GA**TT*C**C/*CAA**C***CT*GATGC*G**CTTMG714281
DE4*GA**TT*C**C/*CAA**C***CT*GATGC*G**CTTKC519764
DE5*GA**TT*C**C/*CAA**C***CT*GATGC*G**CTTAF323842
GZ1*TT**T*T**A*/T*A*A**T***T**ATG*GCTCT*/OK036798
GZ2*TT**T*T**A*/T*A*A**T*G*T**ATG*GCTCT*/KP314060
GZ3*TT**T*T**A*/T*A*A**T*G*T**ATG*GCTCT*/KP314051
GZ4*TT**T*T**A*/T*A*A**T***T**ATG*GCTCT*/KC519766
GZ5*TT**T*T**A*/T*A*A**T*G*T**ATG*GCTCT*/AF323796
HL1**/G*T******/**A***G****T**ATG**G**C*/OK036799
HL2**T**T******/**A********T**ATG**T**C*/AF443211
HL3*****T******/**A***G****T**ATG**G**C*/MG714282
HL4**/G*T******/**A********T**ATG**T**C*/AF323808
WD1**T**T******/**A********T**ATG**G**C*/OK036800
WD2**/G*T******/**A********T**ATG**G**C*/KP314061
WD3**T**T******/**A********T**ATG**G**C*/KP314034
WD4**/G*T******/**A********T**ATG**G**C*/AF323836
WD5**/G*T******/**A********T**ATG**G**C*/AF323835
WD6**T**T******/**A********T**ATG**G**C*/KP314062
YS1*****T******/**A**C**G**T**ATG*****T*/OK036805
YS2*****T******/**A**C**G**T**ATG*****T*/AF323803
YS3*****T******/**A**C**G**T**ATG*****T*/MH808396
YS4*****T******/**A**C**G**T**ATT*****C*/MH808395
YS5*****T******/**A**C**G**T**ATT*****C*/KC519753
YS6*****T******/**A**C**G**T**ATG*****T*/KC519739
YS7*****T******/**A**C**G**T**ATG*****T*/AF323804
YS8*TTTCT******/**A**C**G**T**ATT*****C*/AF323828
ZH1*TTTCT******/A*A********T**ATG*****T*/OK036801
ZH2*TTTCT******/**A********T**ATG*****T*/OK036802
ZH3**TT*T******/A*A********T**ATG*****T*/KC832305
ZH4**TTCT******/**A********T**ATG*****T*/KC832307
ZH5**TT*T******/**A********T**ATG*****T*/KC832316
ZH6**TT*T******/A*A********T**ATG*****T*/KC519784

Note: M = A+C, R = A+G, /, base deletion.

Note: M = A+C, R = A+G, /, base deletion.

3.3 K2P genetic distance analysis

The genetic distance of 8 Actinidia species based on ITS sequence is shown in Tables 4 and 5. The intra-specific genetic distance of A. callosa, A. arguta and A. melanandra is 2.18%, 2.13% and 2.26%, respectively. And then, the intra-specific genetic distance of A. eriantha and A. valvata is less than A. callosa, A. arguta and A. melanandra, which is 0.48% and 0.35%, respectively.
Table 4

Intra-specific genetic distance of 8 species of Actinidia.

Species nameYSWDZHHLGZDECYMH
Genetic distance2.18%2.13%1.65%2.26%0.94%0.35%0.59%0.48%

Note: DE = A. valvata, GZ = A. polygama, HL = A. melanandrah, CY = A. hemsleyana, MH = A. eriantha, ZH = A. chinensis, YS = A. callosa, WD = A. arguta.

Table 5

Genetic distances among 8 species of Actinidia.

Species nameYSWDZHHLGZDECYMH
YS
WD9.86%
ZH5.69%10.15%
HL10.11%2.28%10.28%
GZ6.95%9.73%6.42%9.94%
DE9.01%9.72%9.60%10.04%7.51%
CY5.99%10.89%2.88%11.00%6.53%10.46%
MH4.77%9.56%6.19%9.87%5.97%7.77%6.36%

Note: DE = A. valvata, GZ = A. polygama, HL = A. melanandrah, CY = A. hemsleyana, MH = A. eriantha, ZH = A. chinensis, YS = A. callosa, WD = A. arguta.

Note: DE = A. valvata, GZ = A. polygama, HL = A. melanandrah, CY = A. hemsleyana, MH = A. eriantha, ZH = A. chinensis, YS = A. callosa, WD = A. arguta. Note: DE = A. valvata, GZ = A. polygama, HL = A. melanandrah, CY = A. hemsleyana, MH = A. eriantha, ZH = A. chinensis, YS = A. callosa, WD = A. arguta. The inter-specific genetic distance among 8 Actinidia species ranged from 2.28% to 11.00%. The genetic distance between A. melanandra and A. hemsleyana was the highest (11.00%), while the genetic distance between A. melanandra and A. arguta was the lowest (2.28%). For A. eriantha, there was a largest genetic distance between A. eriantha and A. arguta (9.56%), and the smallest genetic distance between A. eriantha and A. callosa (4.77%).

3.4 Phylogenetic analysis

ITS1, ITS2 and ITS sequences were tested 1000 times by bootstrap method to build ML phylogenetic tree (Fig 2), with Saurauia tristyla as the outgroup. Phylogenetic tree of ITS sequences showed that all of the tested samples can be grouped into two main clusters. One cluster includes A. eriantha, A. callosa, A. chinensis and A. hemsleyana, and each species also clustered separate group respectively. The other cluster includes A. polygama, A. valvata, A. arguta and A. melanandrah, among which A. polygama and A. valvata clustered into each separate group respectively, and A. arguta and A. melanandrah clustered into one group. Phylogenetic tree of ITS1 sequences showed that A. arguta and A. melanandrah clustered into one group, and the other 6 species were group into another category. Moreover, in this category, A. eriantha, A. hemsleyana, A. polygama and A. valvata were separately distinguished, and A. callosa and A. chinensis scattered in the category. Phylogenetic tree of ITS2 sequences shows similar results with ITS sequence, except A. hemsleyana and A. chinensis which are clustered into one group. For ITS sequences, except A. arguta and A. melanandrah the other 6 species can be distinguished separately from others. For ITS1 sequences, A. eriantha, A. hemsleyana, A. polygama and A. valvata can be distinguished separately from the other 4 varieties. For ITS2 sequences, A. eriantha, A. callosa, A. polygama and A. valvata can be distinguished separately from the other 4 varieties.
Fig 2

Phylogenetic tree of 8 species of Actinidia.

(a) Analysis of ITS sequences fragments; (b) Analysis of ITS1 sequences fragments; (c) Analysis of ITS2 sequences fragments.

Phylogenetic tree of 8 species of Actinidia.

(a) Analysis of ITS sequences fragments; (b) Analysis of ITS1 sequences fragments; (c) Analysis of ITS2 sequences fragments.

4 Discussion

As early as in the “compendium of materia medica”, there is a record of the medicinal plants of the Actinidia. Many Actinidia species with high commercial value have received considerable attention because of their edible fruits, medical value and ornamental values [14-16]. Therefore, their accurate identification is highly in demand. However, currently the identification of Actinidia mainly depends on the characteristics of the original plant, which requires a high degree of experience, especially when the plant is dry [17]. For example, A. eriantha and A. chinensis have a high degree of similarity, in terms of the body of the plant, the size of the fruit and the coat characteristics of the fruit, which are very closely. The only distinguishing feature is that the coat of A. eriantha is milky white, thick and dense [18]. The ITS region has been used as a DNA barcode to authenticate various plants with similar morphological traits [19]. In this study, the ITS sequences were used for barcoding Actinidia species for the first time. The ITS sequence analysis of 8 Actinidia species showed that there were 194 mutants, including A. eriantha (85 bp C、205 bp T、493 bp C、542 bp G、574 bp C、582 bp T、610 bp G), A. hemsleyana (28 bp T、79 bp A、83 bp A、87 bp C、109 bp T、128 bp A、448 bp T、501 bp T), A. valvata (48bpG、73bpA、92bpT、95bpC、122bpC、184bpC、232bpA、435bpC、487bpC、530bpG、602bpC、620bpT、640bpT), A. polygama (93 bp T、115 bp A、147 bp T、416 bp A、436 bp T、603 bp G、605 bp T、606 bp C)and A. callosa (422 bp C、446 bp G). All of them have their own specific loci. These specific loci can be used as the basis for the identification of several Actinidia species. Many researchers have reported that ITS region has the advantages of high intra-specific conservation, large inter-specific variation, small fragment, easy amplification, easy analysis and high success rate for species identification [20, 21]. Similar results were found in our study. We found that the genetic distance between the most samples from the same species in this study is less than 1% (A. eriantha, A. hemsleyana, A. valvata, A. polygama), and there were no specific loci differentiating among them. This feature is thus useful for identifying different Actinidia species and related species. The phylogenetic tree which was constructed with ITS, ITS1 and ITS2 region showed that the ITS sequences have higher identification ability in 8 Actinidia species. However, these three barcodes have the same identification ability for A. eriantha, A. hemsleyana and A. valvata. The ITS regions indicated that different samples from same species can be grouped together, except for A. arguta and A. melanandrah. Previoues study reported two groups, one group includes A. eriantha, A. callosa, A. chinensis and A. hemsleyana, the other group includes A. polygama, A. valvata, A. arguta and A. melanandrah, which are based on matK gene. Whereas, A. eriantha, A. callosa, A. chinensis, A. hemsleyana and A. polygama clustered into one group based on rbcL gene. Our study is consistent with the results indicated by matK gene. Therefore, the ITS sequences are useful for species identification, as well as contribute to the phylogenetic analysis of Actinidia and its related species.

5 Conclusion

Our study demonstrates that the ITS sequences possess high species discriminability and it could be a useful DNA barcode for Actinidia species. However, more Actinidia species should be collected in the future to verify whether ITS sequences that could be used to identify all species of Actinidia. In addition, ML tree analyses provided a solid evidence that the ITS sequences have the potential in the phylogenetic analysis of Actinidia and its related species.

Mutation loci analysis of 8 Actinidia.

(XLS) Click here for additional data file. 6 Jun 2022
PONE-D-22-07942
The ITS Analysis and Identification of Actinidia eriantha and its Related Species
PLOS ONE Dear Dr. Mao, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Jul 21 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Evangelia V. Avramidou, PhD Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf  and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the field site access and, if no permits were required, a brief statement explaining why. 3. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files. 4. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://aje.com/go/plos) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free. Upon resubmission, please provide the following: The name of the colleague or the details of the professional service that edited your manuscript A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file) A clean copy of the edited manuscript (uploaded as the new *manuscript* file)”" 5. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter. 6. Thank you for stating the following financial disclosure: “Ms. XZ was funded by [Zhejiang Provincial Natural Science Foundation of China] grant number [LGF20H280005], Mr. HL was funded by[development project in Lishui city] grant number [2020ZDYF 15] and Ms. YL was funded by [Lishui Science and Technology project] grant number [2021SJZC039]. YES - Specify the role(s) played.” Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." If this statement is not correct you must amend it as needed. Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf. Additional Editor Comments: Dear authors, based on reviewer's comments and also from my expertise your article has many deficiencies and needs further improvement. So please answer reviewers's somments and additionaly please answer to the following comments: 1. why did you prefer ITS although discriminations power of SSR are more accurate? is it less expensive to do a sequencing analysis rather genotyping? 2. please provide some photos also for the difficult part of morphological description 3. finally the manuscript needs to be critically proof read before resubmitted. With kind regards [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: I Don't Know ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: 1. The authors suggested ITS as a reliable marker for species identification of Actinidia eriantha and its Related Species (n=185 samples which includes 53 samples from Genbank). It is not clear from the methodology whether these are their own samples or from others, thus questioning the reliability of species vouchering. This is crucial to be clarified due to: “However, it is difficult to identify them due to the diverse variability in morphological characters[4].”, as stated by the authors. And it's also not clear if the new barcodes generated from the other haplotypes listed in Table 1 have been submitted and verified by Genbank. 2. Furthermore, the methods lack details and are only vaguely described, without proper citation. Eg: "Fresh young leaves of the collected samples were used for genomic DNA isolation, as previously reported". A supplementary data of the characteristics of all 8 species would be extremely helpful to convince the readers on the morphological species identification. 3. The authors generated a good dataset but the way it was reported and discussed is really confusing and only partly supports the overall conclusion. 4. Overall, the manuscript is poorly written and difficult to follow. The manuscript needs to be critically proof read before resubmitted for further review. Obvious language mistakes are observed throughout the manuscript. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 4 Aug 2022 1. Dr. Bin Wu of Zhejiang University thoroughly copyedit manuscript for language usage, spelling, and grammar. 2. The minimal data set underlying the results described in your manuscript can be found in Genbank(accession numbers see S1 Table). 3. Ms. Xiaoqin Zhang was funded by [Zhejiang Provincial Natural Science Foundation of China] grant number [LGF20H280005], Mr. Houxing Lei was funded by[development project in Lishui city] grant number [2020ZDYF 15] and Ms. Yan Lan was funded by [Lishui Science and Technology project] grant number [2021SJZC039]. Ms. Xiaoqin Zhang – Methodology and Writing–original draft Mr. Houxing Lei –Conceptualization Ms. Yan Lan –Software 4. We add Leaf image of 8 species of Actinidia in manuscript for the difficult part of morphological description. 5. The research material is plant leaves , it is not involve ethical protection and genetic information protection, so no additional information regarding the permits for the work we need. 6. SSR has some shortcomings: 1) the detection of SSR polymorphism largely depends on the effect of PCR amplification; 2) The existing SSR markers are limited in number, and can not mark all functional genes; 3) The development and synthesis of primers are expensive, difficult and time-consuming. Submitted filename: Response to Reviewers.docx Click here for additional data file. 26 Aug 2022 The ITS Analysis and Identification of Actinidia eriantha and its Related Species PONE-D-22-07942R1 Dear Dr. Mao, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Evangelia V. Avramidou, PhD Academic Editor PLOS ONE Additional Editor Comments (optional): Dear authors, based on the answers you provided the manuscript is now suitable for publication. Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response) ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Aside from the addition of leaf images (which also lacks proper citation), the manuscript was barely improved from the first version. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No ********** 7 Sep 2022 PONE-D-22-07942R1 The ITS Analysis and Identification of Actinidia eriantha and its Related Species Dear Dr. Mao: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Evangelia V. Avramidou Academic Editor PLOS ONE
  16 in total

1.  Anticancer and anti-angiogenic activities of extract from Actinidia eriantha Benth root.

Authors:  Jian-Guo Wu; Li Ma; Shui-Hua Lin; Yan-Bin Wu; Jun Yi; Bin-Jun Yang; Jin-Zhong Wu; Ka-Hing Wong
Journal:  J Ethnopharmacol       Date:  2017-03-18       Impact factor: 4.360

2.  Application of Ribosomal Internal Transcribed Spacer 1, Internal Transcribed Spacer 2, and Large-Subunit D1-D2 Regions as the Genetic Markers to Identify Fungi Isolated from Different Environmental Samples: A Molecular Surveillance Study of Public Health Importance.

Authors:  Irshad M Sulaiman; Emily Jacobs; Steven Simpson
Journal:  J AOAC Int       Date:  2020-06-01       Impact factor: 1.913

3.  Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).

Authors:  Bryn T M Dentinger; Maryna Y Didukh; Jean-Marc Moncalvo
Journal:  PLoS One       Date:  2011-09-22       Impact factor: 3.240

4.  Molecular Authentication of the Medicinal Species of Ligusticum (Ligustici Rhizoma et Radix, "Gao-ben") by Integrating Non-coding Internal Transcribed Spacer 2 (ITS2) and Its Secondary Structure.

Authors:  Zhen-Wen Liu; Yu-Zhen Gao; Jing Zhou
Journal:  Front Plant Sci       Date:  2019-04-09       Impact factor: 5.753

5.  Authentication of Cordyceps sinensis by DNA Analyses: Comparison of ITS Sequence Analysis and RAPD-Derived Molecular Markers.

Authors:  Kelly Y C Lam; Gallant K L Chan; Gui-Zhong Xin; Hong Xu; Chuen-Fai Ku; Jian-Ping Chen; Ping Yao; Huang-Quan Lin; Tina T X Dong; Karl W K Tsim
Journal:  Molecules       Date:  2015-12-15       Impact factor: 4.411

6.  Morphology and Molecular Identification of Twelve Commercial Varieties of Kiwifruit.

Authors:  Qiaoli Xie; Hongbo Zhang; Fei Yan; Chunxia Yan; Shuguang Wei; Jianghua Lai; Yunpeng Wang; Bao Zhang
Journal:  Molecules       Date:  2019-03-03       Impact factor: 4.411

7.  The ITS region provides a reliable DNA barcode for identifying reishi/lingzhi (Ganoderma) from herbal supplements.

Authors:  Tess Gunnels; Matthew Creswell; Janis McFerrin; Justen B Whittall
Journal:  PLoS One       Date:  2020-11-12       Impact factor: 3.240

8.  Actinidia eriantha Polysaccharide and PD1-Antibody Combination Therapy Enhances Antitumor Efficacy in Colorectal Cancer-Xenograft Mice.

Authors:  Jinxia Li; Yiping Wang; Weiyang Jin; Li Shen
Journal:  Onco Targets Ther       Date:  2021-02-24       Impact factor: 4.147

9.  Flavonoid-Rich Extract of Actinidia macrosperma (A Wild Kiwifruit) Inhibits Angiotensin-Converting Enzyme In Vitro.

Authors:  Sujeewa K Hettihewa; Yacine Hemar; H P Vasantha Rupasinghe
Journal:  Foods       Date:  2018-09-05
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.