Literature DB >> 36132230

4,7-Didehydro-neophysalin B Protects Rat Lung Epithelial Cells against Hydrogen Peroxide-Induced Oxidative Damage through Nrf2-Mediated Signaling Pathway.

Qiu Zhong1, Yaogui Sun1, Ajab Khan2, Jianhua Guo3, Zhirui Wang4, Na Sun1, Hongquan Li1.   

Abstract

The administration of 4,7-didehydro-neophysalin B is expected to be a promising strategy for mitigating oxidative stress in respiratory diseases. This study was aimed at investigating the efficacy of 4,7-didehydro-neophysalin B for apoptosis resistance of rat lung epithelial cells (RLE-6TN) to oxidative stress and evaluating its underlying mechanism of action. The RLE-6TN cells treated with hydrogen peroxide (H2O2) were divided into five groups, and 4,7-didehydro-neophysalin B was administered into it. To evaluate its mechanism of action, the expression of oxidative stress and apoptotic proteins was investigated. 4,7-Didehydro-neophysalin B significantly inhibited H2O2-induced RLE-6TN cell damage. It also activated the Nrf2 signaling pathway which was evident from the increased transcription of antioxidant responsive of KLF9, NQO1, Keap-1, and HO-1. Nrf2 was found to be a potential target of 4,7-didehydro-neophysalin B. The protein levels of Bcl-2 and Bcl-xL were increased while Bax and p53 were decreased significantly. Flow cytometry showed that 4,7-didehydro-neophysalin B protected RLE-6TN cells from apoptosis and has improved the oxidative damage. This study provided a promising evidence that 4,7-didehydro-neophysalin B can be a therapeutic option for oxidative stress in respiratory diseases.
Copyright © 2022 Qiu Zhong et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 36132230      PMCID: PMC9484967          DOI: 10.1155/2022/4189083

Source DB:  PubMed          Journal:  Oxid Med Cell Longev        ISSN: 1942-0994            Impact factor:   7.310


1. Introduction

The respiratory epithelial cell damage is a key indicator of respiratory diseases. Investigation of respiratory epithelial cell injury and its underlying mechanism of action and development of new drugs against it are crucial steps to prevent and treat respiratory diseases. Hydrogen peroxide (H2O2) is the main reactive oxygen species (ROS) involved in the regulation of redox reactions in biological activities through specific protein targets [1]. Recently, oxidative stress is considered as a key risk factor for respiratory diseases [2]; evidences showed that the causative factors of diseases including mycoplasma pneumonia are also linked with the oxidative stress [3-6]. Therefore, the active compounds with antioxidative properties tend to be the potential agents for the prevention of respiratory diseases. In recent years, the use of active natural compounds against pathological conditions has gained considerable recognition. 4,7-Didehydro-neophysalin B and Physalin B are biologically active substances extracted from Physalis alkekengi L. var. franchetii. It has been confirmed that Physalin B has various pharmacological effects such as anti-inflammatory [7], antitumor [8], antibacterial [9], and immune regulation [10] verified by various bioassay both in vitro and in vivo. 4,7-Didehydro-neophysalin B is a new kind of Physalin B lacking two hydrogen atoms. There is evidence that Physalin B has efficient antioxidant activity [8]. However, the protective effect and mechanism of 4,7-didehydro-neophysalin B against H2O2-induced lung injury remained elusive. Nuclear factor-erythroid 2-related factor-2 (Nrf2) has been identified as a key regulator of antioxidative, anti-inflammatory, and conjugation/detoxification proteins including NAD(P)H, quinine oxidoreductase 1 (NQO1), and heme oxygenase-1 (HO-1) [11]. After oxidative stress caused by H2O2 or other factors, the Nrf2 pathway is rapidly activated to eliminate intracellular ROS generation, thereby attenuating DNA damage induced by H2O2 to reduce risk of subsequent lung apoptosis [12]. Activation of antioxidative defense such as phase II enzyme expression is an effective way to protect cells against oxidative damage [13]. Nrf2 combined with antioxidant response element (ARE) system is one of the most important defensive signaling pathways to regulate the transcription activity of antioxidases [14]. The RLE-6TN cell line has been widely used to evaluate lung function due to their hypersensitivity to H2O2 [15, 16]. Although many bioactive compounds have been reported against oxidative stress, still there is no relevant study on the cytoprotective effect of 4,7-didehydro-neophysalin B on RLE-6TN cells. In this study, H2O2 was used to establish the basic oxidative damage model so that we can investigate the effect of 4,7-didehydro-neophysalin B on the oxidative stress, cell apoptosis, and the role of Nrf2 signaling pathway. This study will promote the development of nutraceutical and functional food from Physalis alkekengi L. var. franchetii or its extracts for reducing the risk of oxidative stress-induced lung injury.

2. Materials and Methods

2.1. Preparation of 4,7-Didehydro-neophysalin B

Physalin was isolated from the stems of Physalis alkekengi L. var. franchetii. The plant was identified by Dr. Qiongming Xu from the College of Pharmaceutical Science, Soochow University. Physalin was purified, and the purity of Physalin is 72.39% by chromatography [17]. Physalin from the above reaction was pulverized, extracted with ethanol, loaded on a silica gel column, eluted, and purified with ethyl acetate. The obtained contents of 4,7-didehydro-neophysalin B were detected by chromatography.

2.2. Cytotoxicity of 4,7-Didehydro-neophysalin B

The RLE-6TN cells (ATCC® CRL-2300™, 4000 cells per well) were subcultured in 96-well plates. After different concentrations of 4,7-didehydro-neophysalin B (50, 25, 10, and 5 μg/mL) treatments, cells were incubated with CCK-8 (CK04, Dojindo, Japan) solution (10%) for 1 h at 37°C. The resulting absorbance was measured at 450 nm by using a microplate reader (Tecan, Switzerland). The maximum nontoxic concentration (MNTC) value was calculated by Prism 6 software (San Diego, CA, USA) [18].

2.3. Culture of RLE-6TN Cells

The RLE-6TN cell line was cultured in DMEM containing 15% fetal bovine serum, 2 mmol/L glutamine, 5 mmol/L sodium pyruvate, and 25 mmol/L HEPES, containing 100 UI/mL penicillin and 100 μg/mL streptomycin, placed in an incubator and grown at 37°C, 5% CO2-saturated humidity. 0.25% trypsin-EDTA digested and passaged, and cells in logarithmic growth phase were used for experiments [19]. RLE-6TN cells were seeded in 96-well cell culture plates and incubated in a 5% CO2 humidified incubator for 24 h at 37°C. Various concentrations of H2O2 prepared in 2% medium (200, 100, 50, and 25 μmol) were added and incubated again for 4, 8, 12, and 24 h. The cell proliferation rate of H2O2 was determined using the CCK-8 (CK04, Dojindo, Japan) kit. To develop a cellular oxidative damage model, H2O2 (100 μmol) prepared in 2% medium was added to each well except the blank group and incubated for the next 12 h. Different concentrations of 4,7-didehydro-neophysalin B with low-dose group (2.5 μg/mL), medium-dose group (5 μg/mL), and high-dose group (10 μg/mL) were added as treatment and incubated again for 24 h.

2.4. Transfection

(1) Culture the RLE-6TN cells for 3 to 5 generations, select the cells with good growth condition, digest the cells with 0.25% trypsin, inoculate 2 × 105 cells/well in 6-well plates, add 10% fetal bovine serum, culture in F12 medium (Gibco, USA) without double antibody for 24 h, and after the cell confluence reached 70%, transfection was carried out. (2) Mix 7.5 μL of Lipofectamine 2000 (Life, USA) with 125 μL of OPTI-MEM (Gibco, USA) medium. Take another EP tube and mix 6 μL of siRNA (0.75 μg) with 125 μL of OPTI-MEM medium. This is the amount for one well in a 6-well plate. (3) Gently mix the two tubes of mixture in step 2, and let them act together at room temperature for 15 min. (4) The liquid after the joint action in step 3 was directly added to the original 6-well plate medium, and after 6 hours in a 37°C, 5% CO2 incubator, the medium was replaced and the subsequent experiments were carried out. For siRNA transfection, siRNA duplex targeting Nrf2 (sc-37030, Santa Cruz Biotechnology, Santa Cruz, CA, USA, primer shown in Table 1) were used. siRNA (sc-37007, Santa Cruz Biotechnology, Santa Cruz, CA, USA) was selected as a control to determine whether Nrf2's siRNA was successfully transfected.
Table 1

Nrf2 siRNA: a pool of 3 different siRNA duplexes.

siRNAPrimer (5′→3′)
Nrf2 ASense: GCAUGCUACGUGAUGAAGAttAntisense: UCUUCAUCACGUAGCAUGCtt
Nrf2 BSense: CUCCUACUGUGAUGUGAAAtt
Antisense: UUUCACAUCACAGUAGGAGtt
Nrf2 CSense: GUGUCAGUAUGUUGAAUCAtt
Antisense: UGAUUCAACAUACUGACACtt

2.5. Detection of Gene Expression in Tissues by RT-PCR

The total RNA was extracted from cells using TRIzol reagent, and the absorbance was measured at 260 and 280 nm by an ultraviolet spectrophotometer. The RNA content was calculated from the absorbance (A) value at a wavelength of 260 nm while the RNA purity was identified by the ratio of A260/A280. Reverse transcription of total RNA was performed with reverse transcriptase. The PCR primers (shown in Table 2) were designed and synthesized by KeyGEN BioTECH with GAPDH as endogenous control, and the PCR reactions were carried out according to the recommended conditions.
Table 2

Primers used in RT-PCR.

GenePrimer (5′→3′)
Nrf2Forward: GAGAGCCCAGTCTTCATTGCReverse: TTGGCTTCTGGACTTGGAAC
Keap1Forward: TTCAAGGCCATGTTCACCAA
Reverse: TGGATACCCTCAATGGACACC
NQO1Forward: GGAGAGTTTGCTTACACTTACGC
Reverse: AGTGGTGATGGAAAGCACTGCCTTC
HO-1Forward: CGCCTTCCTGCTCAACATT
Reverse: TGTGTTCCTCTGTCAGCATCAC
KLF9Forward: GGGAAACCTCCGAAAA
Reverse: CGTTCACCTGTATGCACTGTA
GAPDHForward: GGAGATTACTGCCCTGGCTCReverse: GACTCATCGTACTCCT

RT-PCR was performed on the ABI PRISM® 7500 real-time PCR analyzer (Applied Biosystems, Foster City, CA, USA) using the SYBR® Premix Ex Taq™ RT-PCR Kit. The relative mRNA expression was calculated by means of 2− and was normalized to the mean mRNA expressions of GAPDH. The results were calculated with the following formulae: ratio = 2−ΔΔCt, ΔΔCt = (Cttarget − CtGAPDH)Sample − (Cttarget − CtGAPDH)Control.

2.6. Flow Cytometry

After treating the cells with/without 100 μmol of H2O2 for 12 h, different concentrations of 4,7-didehydro-neophysalin B (0, 2.5, 5, and 10 μg/mL) were added to the rat lung epithelial cells RLE-6TN for 24 h. The cells were collected, washed twice with cold PBS, and centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the cells were made into a single cell suspension. 5 μL of Annexin V⁃FITC and 5 μL PI were added, mixed, and incubated for 15 min in the dark. Finally, 400 μL of binding buffer was added and cell apoptosis was detected using flow cytometry.

2.7. Western Blot

RLE-6TN cells were homogenized with RIPA lysate (Solarbio, Beijing, China) containing protease inhibitor PMSF and phosphatase inhibitor (Solarbio). The nuclear and cytosolic proteins were extracted by a nuclear protein extraction kit (KeyGEN BioTECH, Jiangsu, China). The protein concentrations were measured by bicinchoninic acid (BCA) protein assay kit (Beyotime, Shanghai, China). 40 μg equivalent protein samples were separated by SDS-PAGE gel electrophoresis and were transferred into a polyvinylidene fluoride (PVDF) membrane. The membranes were incubated with appropriate primary and HRP-conjugated secondary antibodies. Chemiluminescence was visualized with an enhanced chemiluminescence kit (BOSTER, Wuhan, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein (Sanying, Wuhan, China) and the TATA-binding protein (TBP) (Sanying, Wuhan, China) were used as loading control. The antibodies for Nrf2, heme oxygenase-1 (HO-1), nicotinamide adenine dinucleotide phosphatase:quinone-acceptor 1 (NQO1), Krueppel-like factor 9 (KLF9), Keap-1, p53, Bcl-2-associated X protein (Bax), B cell lymphoma gene 2 (Bcl-2), and B cell lymphoma-extra large (Bcl-xL) were purchased from Abcam (UK). All secondary antibodies were from Sanying (Wuhan, China). Protein expression was analyzed by scanning densitometry using ImageJ software (USA). To further explain the molecular mechanism by which 4,7-didehydro-neophysalin B treated H2O2-induced oxidative damage in RLE-6TN cells, western blot was performed. Nrf2's siRNA was generated to inhibit Nrf2 expression, and the inhibitory efficiency was verified using western blot. Nrf2's siRNA was transfected into RLE-6TN cells with or without H2O2 treatment. Then, 10 μg/mL 4,7-didehydro-neophysalin B was administrated for treatment and the expression of Nrf2 was explored using western blotting.

2.8. Statistical Analysis

Statistical analysis was performed by one-way analysis of variance with Tukey's test post hoc comparisons and Student's t-test when comparing between 2 groups using SPSS 19.0 software (USA). The data were presented as the mean ± SEM. Values with p < 0.05 was considered statistically significant.

3. Results

3.1. Structure and Content of 4,7-Didehydro-neophysalin B

The structure and contents of 4,7-didehydro-neophysalin B are shown in Figures 1(a) and 1(b). The chemical formula of 4,7-didehydro-neophysalin B is C28H28O9, and its purity is 99.01%.
Figure 1

(a) The structure of 4,7-didehydro-neophysalin B. (b) The contents of 4,7-didehydro-neophysalin B.

3.2. The Cytotoxicity of 4,7-Didehydro-neophysalin B

The maximum nontoxic concentration of 4,7-didehydro-neophysalin B in RLE-6TN was investigated. Compared with the blank group, RLE-6TN cells treated with 25 μg/mL 4,7-didehydro-neophysalin B for 24 h showed significant reduction in cell viability (74.87 ± 1.54%, p = 0.008 < 0.01) while 10 μg/mL 4,7-didehydro-neophysalin B had negligible effect on cell viability (93.6 ± 1.03%, p = 0.07 > 0.05) (Figure 2). Therefore, we choose 10 μg/mL 4,7-didehydro-neophysalin B as the maximum nontoxic concentration.
Figure 2

Cell viability (CCK-8) assay results of RLE-6TN cells: 4,7-didehydro-neophysalin B-induced cell proliferation rate. Compared with the blank group, ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001.

3.3. The Effect of 4,7-Didehydro-neophysalin B on RLE-6TN Pretreated with H2O2

Compared with the blank group, the working concentration for H2O2 in RLE-6TN cells treated with different concentrations was determined. Results showed that 100 μmol H2O2 treated for 12 h significantly reduced (59.87 ± 1.32%, p = 0.0004 < 0.001) while 50 μmol H2O2 showed less effect on the cell viability (80.37 ± 1.96%, p = 0.0007 < 0.001). The mortality of cells treated with 200 μmol of H2O2 was too high (41.28 ± 2.84%, p = 0.0003 < 0.001) as shown in Figure 3(a). Therefore, 100 μmol H2O2 was selected as a working concentration.
Figure 3

Cell viability (CCK-8) assay results of RLE-6TN cells. (a) H2O2-induced cell proliferation rate (concentration-dependent); (b) H2O2-induced cell proliferation rate (time-dependent); (c) 4,7-didehydro-neophysalin B treatment of the H2O2-challenged cells. Low: 2.5 μg/mL 4,7-didehydro-neophysalin B-treated RLE-6TN cell group; mid: 5 μg/mL 4,7-didehydro-neophysalin B-treated RLE-6TN cell group; high: 10 μg/mL 4,7-didehydro-neophysalin B-treated RLE-6TN cell group; the same as below. Compared with the blank group, ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001. Compared with the model group, #p < 0.05, ##p < 0.01, and ###p < 0.001.

Compared with the blank group, the working time for 100 μmol H2O2 in RLE-6TN cells treated with different times was determined. The results showed that RLE-6TN cells treated with 100 μmol H2O2 for 24, 12, 8, and 4 h treatment all had significant effect on cell viability, but the RLE-6TN cells treated with 100 μmol H2O2 for 24 (37.84 ± 1.62%, p = 0.0005 < 0.001), 8 (76.62 ± 1.45%, p = 0.0006 < 0.001), and 4 (87.61 ± 2.33%, p = 0.0009 < 0.001) hours were too high or low on cell viability, as shown in Figure 3(b). Therefore, 12 h (68.88 ± 0.95%, p = 0.0002 < 0.001) was selected as a working time. Conclusively, 100 μmol of H2O2 was used to treat RLE-6TN for 12 h, followed by the addition of 4,7-didehydro-neophysalin B to examine the effect on cell viability. As shown in Figure 3(c), 4,7-didehydro-neophysalin B had significantly reversed the cell viability caused by H2O2 in a dose-dependent manner in which 10 μg/mL 4,7-didehydro-neophysalin B showed the strongest effect (84.93 ± 1.86%, p = 0.0007 < 0.001).

3.4. Expressions of Nrf2 in RLE-6TN under the Intervention of Nrf2's siRNA

The mRNA expression of Nrf2 and its downstream genes was detected by RT-PCR. The A260/A280 ratio of the RNA samples was 1.8-2.0. Nrf2's siRNA treatment significantly reduced the mRNA expression of Nrf2 and its downstream genes compared with the control siRNA which have shown negligible effect on the mRNA expression of Nrf2 and its downstream genes, as shown in Figure 4.
Figure 4

The mRNA expression of Nrf2 and its downstream genes. Compared with the blank group, ∗p < 0.05 and ∗∗p < 0.01.

3.5. 4,7-Didehydro-neophysalin B Mitigates H2O2-Induced Apoptosis in RLE-6TN

We investigated the effect of 4,7-didehydro-neophysalin B on H2O2-induced cell apoptosis by flow cytometry. Compared with the blank group, H2O2 caused a significant increase in RLE-6TN cell apoptosis while only 4,7-didehydro-neophysalin B treatment showed no significant effect on cell viability. Similarly, 4,7-didehydro-neophysalin B treatment dramatically mitigated H2O2-induced apoptosis. These results elucidated that 4,7-didehydro-neophysalin B had only a significant effect on H2O2-induced early apoptosis but had no significant effect on late apoptosis (early apoptosis: 4,7-didehydro-neophysalin B group 7.98 ± 1.15%, p = 0.07 > 0.05; model group 37.48 ± 3.84%, p = 0.0005 < 0.001; low-dose group 29.83 ± 3.68%, p = 0.0007 < 0.001; medium-dose group 21.44 ± 2.99%, p = 0.0008 < 0.001; high-dose group 15.35 ± 1.68%, p = 0.03 < 0.05, compared with the blank group) (late apoptosis: 4,7-didehydro-neophysalin B group 13.32 ± 2.47%, p = 0.008 < 0.01; model group 24.49 ± 2.96%, p = 0.006 < 0.01; low-dose group 17.92 ± 2.86%, p = 0.007 < 0.01; medium-dose group 15.58 ± 3.15%, p = 0.008 < 0.01; high-dose group 19.44 ± 3.57%, p = 0.006 < 0.01, compared with the blank group), as shown in Figure 5(a). The microscopic images of cells after treatment are shown in Figure 5(b).
Figure 5

(a) The effect of 4,7-didehydro-neophysalin B on H2O2-induced apoptosis in RLE-6TN cells. (b) The microscope images of H2O2-induced cells after treatment with 4,7-didehydro-neophysalin B.

3.6. The Effect of 4,7-Didehydro-neophysalin B on Nrf2-Dependent Signaling Pathway in H2O2-Induced Oxidative Damage

Nrf2 signaling pathway proteins were detected by western blotting. In vitro treatment of H2O2 significantly reduced the Nrf2, NQO1, Keap1, HO-1, and KLF9 protein expressions. However, 4,7-didehydro-neophysalin B treatment has significantly reversed these effects induced by H2O2 with 10 μg/mL 4,7-didehydro-neophysalin B showing the strongest effect as shown in Figure 6(a). The addition of 4,7-didehydro-neophysalin B alone showed no effect on the protein expression of Nrf2, NQO1, Keap1, HO-1, and KLF9 in RLE-6TN as shown in Figure 6(b). H2O2 had markedly reduced the expression of nuclear Nrf2 which was significantly reversed by 4,7-didehydro-neophysalin B as shown in Figure 6(c).
Figure 6

Western blot analysis of the Nrf2 signaling pathway. (a) After being added with different concentrations of 4,7-didehydro-neophysalin B, Nrf2 pathway-related protein expression in RLE-6TN cells and its quantitative band intensity analysis. (b) Effect of 4,7-didehydro-neophysalin B on the expression of Nrf2 pathway-related proteins and the quantitative band intensity analysis. (c) Expression of Nrf2 protein in the nucleus and its quantitative band intensity analysis. Compared with the blank group, ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001. Compared with the H2O2+0% 4,7-didehydro-neophysalin B group, #p < 0.05, ##p < 0.01, and ###p < 0.001.

3.7. Knockdown of Nrf2 Declines the Treatment Effect of Physalin B

The Nrf2's siRNA treatment significantly reduced the expression of Nrf2 as shown in Figure 7. Compared with the model group, the treatment effect of 4,7-didehydro-neophysalin B in the Nrf2's siRNA treatment group was significantly reduced.
Figure 7

After using Nrf2 siRNA to knock down the expression of Nrf2 protein, effect of 4,7-didehydro-neophysalin B on the expression of Nrf2 pathway-related proteins and their quantitative band intensity analysis. Compared with the blank group, ∗p < 0.05 and ∗∗p < 0.01. Compared with the H2O2+0% 4,7-didehydro-neophysalin B group, #p < 0.05 and ##p < 0.01.

3.8. Effects of 4,7-Didehydro-neophysalin B on Bcl-2 Family and p53 Proteins

The molecular basis of a protective effect of 4,7-didehydro-neophysalin B against H2O2-induced cell apoptosis was investigated. H2O2 treatment decreased the expression of antiapoptotic Bcl-2 and Bcl-xL proteins in RLE-6TN cells. In H2O2-treated cells, 4,7-didehydro-neophysalin B administration significantly induced the expression of Bcl-2 and Bcl-xL. The expression of proapoptotic protein Bax was significantly increased post H2O2 treatment which was significantly reduced by 4,7-didehydro-neophysalin B treatment. Compared with the control group, p53 expression was also increased post H2O2 treatment. 4,7-Didehydro-neophysalin B attenuated H2O2-induced p53 expression with the strongest effect of 10 μg/mL 4,7-didehydro-neophysalin B as shown in Figure 8(a) (Bcl-xL expression: blank 1.0 ± 0.14, control 0.37 ± 0.05, p = 0.004 < 0.01 compared with the blank group; low 0.28 ± 0.07, mid 0.59 ± 0.09, p = 0.03 < 0.05 compared with the control group; high group 0.98 ± 0.05, p = 0.11 compared with the control group; Bcl-2 expression: blank 1.0 ± 0.16, control 0.48 ± 0.35, p = 0.005 < 0.01 compared with the model group; low 0.53 ± 0.005, mid 0.59 ± 0.77, p = 0.04 < 0.05 compared with the control group; high group 0.98 ± 0.05, p = 0.11 < 0.01 compared with the control group). The addition of 4,7-didehydro-neophysalin B alone showed no effect on the protein expression of Bcl-2, Bcl-xL, Bax, and p53 in RLE-6TN as shown in Figure 8(b).
Figure 8

Western blot analysis of p53 pathway protein. (a) Post addition of different 4,7-didehydro-neophysalin B concentrations, p53 pathway-related protein expression in RLE-6TN cells and their quantitative band intensity analysis. (b) Effect of 4,7-didehydro-neophysalin B on the expression of p53 pathway-related proteins and the quantitative band intensity analysis. Compared with the blank group, ∗p < 0.05 and ∗∗p < 0.01, and with the H2O2+0% 4,7-didehydro-neophysalin B group, #p < 0.05 and ##p < 0.01.

4. Discussion

A variety of chemicals and environmental factors causes oxidative stress in the human body which damages and induces a variety of diseases. H2O2-induced RLE-6TN cell damage is a classical model of oxidative stress injury. Studies have shown that the damage caused by oxidative stress is mediated by reactive oxygen species which plays an important role in neurodegenerative diseases [20, 21]. H2O2 produced in the body during metabolism is equivalent to reactive oxygen species and can aggravate the body oxidative stress injury [22, 23]. The results of this study showed that H2O2 induced oxidative damage and apoptosis in RLE-6TN cells which was reduced by 4,7-didehydro-neophysalin B treatment as shown in Figure 2(c). This study demonstrated that 4,7-didehydro-neophysalin B possessed therapeutic effects in the form of antioxidant activities against H2O2-induced oxidative stress injury. When the cellular level of ROS exceeds the body's antioxidant capacity, it induces oxidative stress leaving the cells in a redox state by producing peroxides and free radicals [24-26]. Mitochondrial dysfunction and DNA damage are caused by the accumulation of reactive oxygen species which mediate and accelerate apoptosis [27-30]. DNA damage causes activation of p53which serves as a major mediator of cellular stress [31]. Our results (Figure 7) indicated p53-mediated apoptosis in H2O2-induced lung injury. p53 along with the members of Bcl-2 family proteins regulates protein–protein interactions and causes activation of Bax which promotes mitochondrial membrane permeability and hence induces apoptosis [32]. In this study, 4,7-didehydro-neophysalin B suppressed p53, decreased the level of proapoptotic member Bax, and increased the level of prosurvival members Bcl-2 and Bcl-xL. Moreover, the results of apoptotic index (Figure 2) and cell viability (Figure 4) of RLE-6TN were consistent with the observed effects on Bcl-2 family proteins. These findings suggest that 4,7-didehydro-neophysalin B has a pivotal role in regulating apoptosis and inhibiting oxidative stress-induced cell death. It is also noteworthy that some studies showed that NQO1 stabilizes the tumor suppressor p53 [33]. HO-1 upregulates Bcl-2 and Bcl-xL expressions [34] which are downstream proteins of Nrf2. A possible explanation is that 4,7-didehydro-neophysalin B protects lung injury induced by H2O2 via activating the Nrf2 pathway. The transcription factor Nrf2 plays an important role in protection against oxidative damage [35, 36]. Nrf2 senses the presence of oxidative stress and regulates transcription of genes encoding cytoprotective enzymes and other proteins crucial for maintaining cellular homeostasis. Under physiological conditions, the Nrf2 inhibitor, Keap-1, which is a negative regulator of Nrf2 binds to Nrf2 and retains Nrf2 in the cytoplasm [37]. During oxidative stress, Nrf2 dissociates from Keap1, translocates into the nucleus, and activates ARE-dependent gene expression including transcription of target genes NQO-1 and HO-1 [38], thereby improving the antioxidant capacity in the body [39, 40]. Accumulation of Nrf2 in the nucleus is a necessary condition which is closely related to the induction of cellular defense genes [41]. The increase in cell death caused by H2O2 might be attributed to the insufficient ROS removal caused by the failure of Nrf2 activation. However, Figure 5 shows that 4,7-didehydro-neophysalin B activates the antioxidant pathway affecting both Nrf2 gene levels and expression of its target proteins. Therefore, this study suggested that Nrf2 activation was required for protection of the lungs by 4,7-didehydro-neophysalin B from H2O2-mediated cell death.

5. Conclusions

In conclusion, our study demonstrated that Physalin B attenuated H2O2-induced lung injury by regulating the Nrf2/P53 signaling pathway. Physalin B with great therapeutical potential can be used as an antioxidant agent. This study provided beneficial evidences for the application of Physalin B supplementation as an alternative treatment strategy for lung injury.
  40 in total

1.  Novel protective mechanisms for S-adenosyl-L-methionine against acetaminophen hepatotoxicity: improvement of key antioxidant enzymatic function.

Authors:  James Michael Brown; John G Ball; Michael Scott Wright; Stephanie Van Meter; Monica A Valentovic
Journal:  Toxicol Lett       Date:  2012-06-05       Impact factor: 4.372

Review 2.  Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling.

Authors:  Paul D Ray; Bo-Wen Huang; Yoshiaki Tsuji
Journal:  Cell Signal       Date:  2012-01-20       Impact factor: 4.315

Review 3.  Physalis alkekengi L. var. franchetii (Mast.) Makino: An ethnomedical, phytochemical and pharmacological review.

Authors:  Ai-Ling Li; Bang-Jiao Chen; Guo-Hui Li; Ming-Xing Zhou; Yan-Ru Li; Dong-Mei Ren; Hong-Xiang Lou; Xiao-Ning Wang; Tao Shen
Journal:  J Ethnopharmacol       Date:  2017-08-31       Impact factor: 4.360

4.  Exploring the liver fibrosis induced by deltamethrin exposure in quails and elucidating the protective mechanism of resveratrol.

Authors:  Siyu Li; Xiaoyan Zheng; Xiaoya Zhang; Hongxiang Yu; Bing Han; Yueying Lv; Yan Liu; Xiaoqiao Wang; Zhigang Zhang
Journal:  Ecotoxicol Environ Saf       Date:  2020-11-03       Impact factor: 6.291

5.  Pomegranate protects against arsenic-induced p53-dependent ROS-mediated inflammation and apoptosis in liver cells.

Authors:  Sreetama Choudhury; Sayan Ghosh; Sudeshna Mukherjee; Payal Gupta; Saurav Bhattacharya; Arghya Adhikary; Sreya Chattopadhyay
Journal:  J Nutr Biochem       Date:  2016-09-06       Impact factor: 6.048

6.  β-Caryophyllene Pretreatment Alleviates Focal Cerebral Ischemia-Reperfusion Injury by Activating PI3K/Akt Signaling Pathway.

Authors:  Qian Zhang; Ruidi An; Xiaocui Tian; Mei Yang; Minghang Li; Jie Lou; Lu Xu; Zhi Dong
Journal:  Neurochem Res       Date:  2017-02-24       Impact factor: 3.996

Review 7.  The role of DNA damage responses in p53 biology.

Authors:  Daniel Speidel
Journal:  Arch Toxicol       Date:  2015-01-25       Impact factor: 5.153

8.  Investigation of the immunosuppressive activity of Physalin H on T lymphocytes.

Authors:  Youjun Yu; Lijuan Sun; Lei Ma; Jiyu Li; Lihong Hu; Jianwen Liu
Journal:  Int Immunopharmacol       Date:  2009-12-03       Impact factor: 4.932

9.  Increased cerebral mitochondrial dysfunction and reactive oxygen species with cardiopulmonary bypass.

Authors:  Lindsay E Volk; Constantine D Mavroudis; Tiffany Ko; Thomas Hallowell; Nile Delso; Anna L Roberts; Jonathan Starr; William Landis; Yuxi Lin; Marco Hefti; Ryan W Morgan; Richard W Melchior; Tami M Rosenthal; Alexander Chappell; Douglas Fisher; Molly Dreher; Daniel J Licht; Jonathan Chen; J William Gaynor; Christopher E Mascio; Todd J Kilbaugh
Journal:  Eur J Cardiothorac Surg       Date:  2021-06-14       Impact factor: 4.191

10.  Metformin Activates the Protective Effects of the AMPK Pathway in Acute Lung Injury Caused by Paraquat Poisoning.

Authors:  Liaozhang Wu; Yifang Cen; Menglong Feng; Yanna Zhou; Hui Tang; Xueli Liao; Yanze Wang; Min Wang; Manhong Zhou
Journal:  Oxid Med Cell Longev       Date:  2019-10-30       Impact factor: 6.543

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.