Ting Zhao1,2, Liying Guan3, Xuehua Ma3, Baohui Chen4,5, Mei Ding3,6, Wei Zou1,2. 1. The Fourth Affiliated Hospital, Zhejiang University School of Medicine, Yiwu, China. 2. Institute of Translational Medicine, Zhejiang University, Hangzhou, China. 3. State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, China. 4. Department of Cell Biology, and Bone Marrow Transplantation Center of the First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China. 5. Institute of Hematology, Zhejiang University & Zhejiang Engineering Laboratory for Stem Cell and Immunotherapy, Hangzhou, China. 6. University of Chinese Academy of Sciences, Beijing, China.
Abstract
Cortical actin, a thin layer of actin network underneath the plasma membranes, plays critical roles in numerous processes, such as cell morphogenesis and migration. Neurons often grow highly branched dendrite morphologies, which is crucial for neural circuit assembly. It is still poorly understood how cortical actin assembly is controlled in dendrites and whether it is critical for dendrite development, maintenance and function. In the present study, we find that knock-out of C. elegans chdp-1, which encodes a cell cortex-localized protein, causes dendrite formation defects in the larval stages and spontaneous dendrite degeneration in adults. Actin assembly in the dendritic growth cones is significantly reduced in the chdp-1 mutants. PVD neurons sense muscle contraction and act as proprioceptors. Loss of chdp-1 abolishes proprioception, which can be rescued by expressing CHDP-1 in the PVD neurons. In the high-ordered branches, loss of chdp-1 also severely affects the microtubule cytoskeleton assembly, intracellular organelle transport and neuropeptide secretion. Interestingly, knock-out of sax-1, which encodes an evolutionary conserved serine/threonine protein kinase, suppresses the defects mentioned above in chdp-1 mutants. Thus, our findings suggest that CHDP-1 and SAX-1 function in an opposing manner in the multi-dendritic neurons to modulate cortical actin assembly, which is critical for dendrite development, maintenance and function.
Cortical actin, a thin layer of actin network underneath the plasma membranes, plays critical roles in numerous processes, such as cell morphogenesis and migration. Neurons often grow highly branched dendrite morphologies, which is crucial for neural circuit assembly. It is still poorly understood how cortical actin assembly is controlled in dendrites and whether it is critical for dendrite development, maintenance and function. In the present study, we find that knock-out of C. elegans chdp-1, which encodes a cell cortex-localized protein, causes dendrite formation defects in the larval stages and spontaneous dendrite degeneration in adults. Actin assembly in the dendritic growth cones is significantly reduced in the chdp-1 mutants. PVD neurons sense muscle contraction and act as proprioceptors. Loss of chdp-1 abolishes proprioception, which can be rescued by expressing CHDP-1 in the PVD neurons. In the high-ordered branches, loss of chdp-1 also severely affects the microtubule cytoskeleton assembly, intracellular organelle transport and neuropeptide secretion. Interestingly, knock-out of sax-1, which encodes an evolutionary conserved serine/threonine protein kinase, suppresses the defects mentioned above in chdp-1 mutants. Thus, our findings suggest that CHDP-1 and SAX-1 function in an opposing manner in the multi-dendritic neurons to modulate cortical actin assembly, which is critical for dendrite development, maintenance and function.
A neuron is the structural and functional unit of the nervous system in animals. During axon formation and dendrite branching, the plasma membrane of a neuron continuously changes its shape until the morphogenesis process is finished, which heavily relies on the membrane-cytoskeleton interactions [1]. The plasma membrane-associated skeleton, also known as the membrane skeleton, consists of actin, spectrin and associated molecules [2]. Analyses from multiple neuronal cells types from different species revealed that many axons and dendrites contain a specialized periodic actin-spectrin-based membrane skeleton (PMS), which can serve as signaling platforms for RTK transactivation and microtubule maintenance [3-11]. Mutations in spectrin are associated with numerous human diseases, such as hereditary elliptocytosis and spinocerebellar ataxia [12,13]. Loss-of-function mutations in unc-70/beta-spectrin in C. elegans result in defects in axonal maintenance, cilium biogenesis, neuron migration and dendrite morphogenesis [10,14]. The actin-binding protein, alpha-adducin, has multiple functions in regulating actin cytoskeleton formation. Knock-out of alpha-adducin causes progressive axon enlargement and degeneration [15]. However, compared to what is known for axonal cortical actin assembly, it is still poorly understood how dendritic cortical actin assembly is controlled and whether it is crucial for dendrite development, maintenance and functions.We previously identified the calponin homology domain-containing protein (CHDP-1) as a critical regulator of cortical actin assembly in C. elegans. Loss of chdp-1 results in defective membrane protrusion formation in the neurite growth cones of BDU and PLM neurons. Using an overexpressed transgene, we showed that CHDP-1 is widely expressed and mainly labels the cell cortex. In BDU and PLM neurons, CHDP-1 promotes cortical actin assembly via recruiting and activating the small GTPase CED-10/Rac1 [16]. It is unclear whether CHDP-1 also regulates cortical actin assembly in multi-dendritic neurons, and if so, whether it is required for dendrite development, maintenance and function.Here we address these questions using the C. elegans PVD neurons as a model. The two PVD neurons, PVDL and PVDR, locate on the left and right sides of the nematode C. elegans, respectively, and covers the majority of the surface of the body except for the head and neck regions [17]. These two neurons are born in the middle second larval stage (L2), and each grows an unbranched axon and two primary dendrites (1o) towards the anterior and posterior, respectively. At the late L2 and early third larval stage (L3), secondary dendrites (2o) are formed from the 1o and grow along the dorsal-ventral axis. When the dendritic tips reach the borders of the outer body wall muscles, the dendrites turn and form T-shaped tertiary branches (3o). At the early L4 stage, quaternary dendrites (4o) are formed from the 3o, and together, they form menorah structures in the wild-type animals [18]. This stereotypical morphogenesis is precisely guided by a multi-protein receptor-ligand complex, including two transmembrane proteins DMA-1/LRR-TM and HPO-30/Claudin on the dendritic membranes, two transmembrane proteins SAX-7/L1CAM and MNR-1/Menorin on the epidermal membranes, and one secreted protein LECT-2/LECT2 derived from the body wall muscle cells [19-26]. Notably, the high-ordered dendrites are sandwiched between the epidermis and body wall muscles, which is consistent with the role of the PVD neurons as the proprioceptors to sense the contraction of the muscle cells [17,27]. During dendrite development, DMA-1 and HPO-30 promote actin assembly via recruiting/activating TIAM-1 and WRC, respectively [24]. In the PVD dendrites, filamentous actin (F-actin) is enriched in the high-ordered, while the microtubule cytoskeleton is enriched in the 1o dendrites [25,28]. The intracellular organelles, such as the endoplasmic reticulum, mitochondria and secretory/endocytic vesicles, are distributed not only in the primary dendrites but also in the high-ordered ones, which are likely regulated by motor proteins moving along the microtubule cytoskeletons [29,30,31]. In the anterior primary dendrite, a growth cone localized non-centrosomal microtubule organizing center generates plus-end-out microtubules in the growth cone and minus-end-out microtubules along outgrowing dendrites [32]. It is not clear how microtubule assembly is controlled in high-ordered dendritic branches.In this work, we performed a forward genetic screen and identified a loss-of-function mutation in the chdp-1 gene as the PVD dendrite morphology was defective in the mutant animals. CHDP-1 modulates actin assembly in the dendritic growth cones. Intriguingly, loss of chdp-1 also perturbs the microtubule cytoskeleton assembly, and transport of intracellular organelles, such as dense-core vesicles, ER and mitochondria in the high-ordered branches. The proprioceptive function of PVD neurons is abolished by the loss of chdp-1. Knock-out of sax-1, which encodes an evolutionary conserved protein kinase [33,34], rescues the defects mentioned above in chdp-1 mutants, suggesting that SAX-1 is likely a negative regulator of cortical actin assembly. Together, our results suggest that CHDP-1 and SAX-1 regulate cortical actin assembly, which is critical for proper dendrite development, maintenance and function.
Results
Loss of chdp-1 causes abnormal development of PVD dendrites in C. elegans
To identify additional regulators that control dendrite development, we used the multi-dendritic PVD neurons in C. elegans as a model and conducted a large-scale forward genetic screen. Among the isolated mutants, here we focused on the characterization of zac135, in which the dendrite arborization was significantly affected. Compared to the wild-type controls, the zac135 mutants showed significantly more 2o and 3o dendritic branches but less 4o branches (Fig 1A and 1B). In addition, the intensity of the membrane-targeted green fluorescent protein (myristoylated-GFP, expressed by an integrated transgene ser2prom3::myr-gfp) in the 2o dendritic branches was significantly dimmer in the zac135 mutants, possibly due to a decreased dendritic width or protein diffusion defect (Fig 1C). Using standard genetic mapping and cloning methods, we identified the causative mutation in zac135 as a single base change (ATG to ATA), which disrupted the start codon of CHDP-1 protein (M1I). We also analyzed the dendrite morphology of tm4947, a putative molecular null mutant of chdp-1[16], and found that both mutants showed similar dendrite branching defects (Fig 1A–1C). Similar abnormal dendrite branching and intensity phenotypes were observed when we used two cytosolic GFP reporters (wdIs51 and otIs138, respectively) to visualize the PVD dendrites [18,35], suggesting that these phenotypes are not specific to the myr-GFP reporter (S1A–S1D Fig). We further analyzed the dendrite width using Stimulated Emission Depletion Microscopy (STED), which offers a higher resolution for imaging [36]. For the 1o dendrites, the width of chdp-1 mutants was less uniform than that of the wild-type controls. The average diameters of 1o dendrites are 0.27 μm and 0.34 μm for wild-type and chdp-1 mutants, respectively. Moreover, the average diameters of 2o branches are 0.17 μm and 0.09 μm for wild-type and chdp-1 mutants, respectively (S1E–S1G Fig).
Fig 1
chdp-1 mutants are defective in PVD dendrite morphogenesis.
(A) Maximum projection of confocal images showing the PVD morphology of wild-type, chdp-1(zac135) and chdp-1(tm4947) mutant animals at the day 1 adult stage. PVD morphology was visualized using a cell-specific fluorescent marker (ser2prom3::myr-gfp). Scale bar: 20 μm. (B-C) Quantification of (B) the number of 2o, 3o and 4o branches, and (C) the ratio of the intensity of the 2o branches to that of the primary dendrite in wild-type, chdp-1(zac135) and chdp-1(tm4947) in the 100 μm area anterior to PVD cell body. Error bars: SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. n = 20–30 for each genotype. (D) Confocal images from time-lapse movies showing dendrite branching, outgrowth and retraction in wild-type (upper) and chdp-1(tm4947) mutant animals (lower) during early L4 stage. Arrows: 4o outgrowth, arrowheads: 4o retraction. Scale bar: 5 μm. (E-F) Quantification of the number of 4o branches initiation (E) and retraction (F) per hour in a 100 μm area anterior to the PVD cell body. Error bars: SEM. ***p < 0.001 by Student’s t-test. n = 10 animals for each genotype. (G-H) Quantification of the speed of 4o dendrite growth (G) and retraction (H). Error bars: SEM. ns: non-significant by Student’s t-test. For G, n = 100 branches for each genotype. For H, n = 36 branches for wild-type, and n = 29 branches for chdp-1(tm4947).
chdp-1 mutants are defective in PVD dendrite morphogenesis.
(A) Maximum projection of confocal images showing the PVD morphology of wild-type, chdp-1(zac135) and chdp-1(tm4947) mutant animals at the day 1 adult stage. PVD morphology was visualized using a cell-specific fluorescent marker (ser2prom3::myr-gfp). Scale bar: 20 μm. (B-C) Quantification of (B) the number of 2o, 3o and 4o branches, and (C) the ratio of the intensity of the 2o branches to that of the primary dendrite in wild-type, chdp-1(zac135) and chdp-1(tm4947) in the 100 μm area anterior to PVD cell body. Error bars: SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. n = 20–30 for each genotype. (D) Confocal images from time-lapse movies showing dendrite branching, outgrowth and retraction in wild-type (upper) and chdp-1(tm4947) mutant animals (lower) during early L4 stage. Arrows: 4o outgrowth, arrowheads: 4o retraction. Scale bar: 5 μm. (E-F) Quantification of the number of 4o branches initiation (E) and retraction (F) per hour in a 100 μm area anterior to the PVD cell body. Error bars: SEM. ***p < 0.001 by Student’s t-test. n = 10 animals for each genotype. (G-H) Quantification of the speed of 4o dendrite growth (G) and retraction (H). Error bars: SEM. ns: non-significant by Student’s t-test. For G, n = 100 branches for each genotype. For H, n = 36 branches for wild-type, and n = 29 branches for chdp-1(tm4947).To understand why chdp-1 mutants grow more 2o dendritic branches and less 4o branches, we performed time-lapse recording. We found that chdp-1 homozygous knock-out mutants showed more branch initiation and retraction during early larval stage 3 (L3) when 2o dendritic branches were formed. The speed of 2o dendrite outgrowth and retraction were not significantly different between the two genotypes (S2A–S2E Fig). During 4o branch development, chdp-1 mutants showed less branch initiation and retraction during early larval stage 4 (L4) when 4o dendritic branches were formed. The speed of 4o dendrite outgrowth and retraction were not significantly different between the two genotypes (Fig 1D–1H). Together, our data demonstrate that CHDP-1 plays a vital role in dendrite branch formation.
Dendrite maintenance is defective in chdp-1 knock-out animals during the adult stages
To test whether chdp-1 is required for dendrite maintenance during the adult stages, we examined the dendrite morphologies for both the wild-type control and chdp-1 (tm4947) animals at the larval stage 4 (L4), 1 day post L4 stage (day 1), day 3, day 5, day 7 and day 9, respectively. Almost all the animals in the wild-type control groups showed intact anterior primary dendrites from L4 to day 9, while a significant portion of chdp-1 mutant animals displayed dendrite degeneration in the most anterior part from day 1 to day 9. We quantified the number of 2o and 4o branches in the anterior half of the PVD neurons, roughly between the OLL cell bodies and the vulva and found that the number of 2o branches decreased at day 7 and day 9 when chdp-1 was mutated (S3A–S3C Fig). Thus, CHDP-1 is required for both dendrite development and maintenance.
CHDP-1 acts cell-autonomously in the PVD neurons during dendrite branching
Our previous study showed that the exogenously expressed GFP::CHDP-1 driven by the chdp-1 promoter mainly localizes to the cell cortex in many different cell types [16]. To determine the expression pattern and subcellular localization of endogenous CHDP-1, we inserted the coding sequence of gfp into the N-terminus of chdp-1 locus by CRISPR/Cas9-based genome editing [37]. We quantified the number of dendrite branches of PVD neurons and found that the gfp::chdp-1 knock-in strain and the wild-type control strain showed a similar number of 2o, 3o and 4o dendritic branches, suggesting that the gfp insertion does not significantly affect the function of CHDP-1 in dendrite development (S4A and S4B Fig). We confirmed that the endogenously expressed CHDP-1 mainly localizes to the cell cortex and is expressed in many cell types, if not all, including the cell bodies of the PVD neurons. Due to the relatively limited resolution of the spinning-disk confocal imaging, we could not determine whether the endogenous CHDP-1 localizes onto the cell cortex in the PVD dendrites (Figs 2A, 2B, S5A and S5B). Next, to determine which tissue CHDP-1 acts in, we expressed CHDP-1 using cell-type specific promoters, including ser2prom3 for the PVD neurons, Pdpy-7 for the epidermis, and Phlh-1 for the body wall muscle cells. Pchdp-1 was used as a positive control. CHDP-1 expressed from the chdp-1 endogenous promoter or the PVD promoter fully rescued the dendrite branching defects and the faint staining of 2o branches by the myr-GFP reporter in the chdp-1(tm4947) animals, while those driven by the epidermis or the body wall muscle promoter failed to do so (Fig 2C–2E). To understand when CHDP-1 functions, we generated a single copy transgene to express CHDP-1 under a heat-shock promoter (Phsp-16.48) in the chdp-1(tm4947) genetic background [38]. The increased number of 2o and 3o branches could only be rescued when the transgene expression was induced at the L2 stage, but not at earlier or later stages. The decreased number of 4o branches could be rescued by inducing transgene expression at L2, L3 and L4 stages, but not earlier or later (Fig 2F and 2G). In addition, the faint staining of 2o branches by the myr-GFP reporter in the chdp-1(tm4947) animals can be fully or partially rescued by inducing CHDP-1 expression at L2 and L3 stages, respectively (Fig 2H). Together, these data suggest that CHDP-1 functions cell-autonomously and right at the dendrite branching stage.
Fig 2
CHDP-1 functions in the PVD neurons.
Confocal images showing the localization of endogenously expressed GFP::CHDP-1 in embryonic stages (upper, middle) and the second larval stage (lower). Arrows: PVD cell body. Scale bar: 20 μm. (B) Confocal images showing the expression patterns of endogenous GFP::CHDP-1 and myr-mCherry expressed in the PVD neurons (driven by the PVD cell-specific promoter ser2prom3). Arrows: PVD cell body. Scale bar: 20 μm. (C) Confocal images of the PVD morphologies in wild-type, chdp-1(tm4947), chdp-1(tm4947) mutant carrying transgenes driven by Pchdp-1, PVD-, skin- and muscle-specific promoters. Scale bar: 20 μm. (D-E) Quantification of (D) the number of 2o, 3o and 4o branches, and (E) the ratio of the intensity of the 2° branches to that of the primary dendrite in wild-type, chdp-1(tm4947) and chdp-1(tm4947) mutant expressing CHDP-1 under different tissue promoters in a 100 μm area anterior to the PVD cell body. Error bars: SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–30 for each genotype. (F) Confocal images showing the PVD morphologies of chdp-1(tm4947) mutant carrying a Phsp-16.48::chdp-1 single copy transgene without heat-shock, heat-shocked at either L2 stage or L3 stage. Scale bar: 20 μm. (G-H) Quantification of (G) the number of 2o, 3o and 4o branches in a 100 μm region anterior to the PVD cell body, and (H) the ratio of the intensity of the 2o branches to that of the primary dendrites in chdp-1(tm4947) mutant without heat-shock, heat-shocked at different developmental stages. Error bars: SEM. **p < 0.01, ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–30 for each genotype.
CHDP-1 functions in the PVD neurons.
Confocal images showing the localization of endogenously expressed GFP::CHDP-1 in embryonic stages (upper, middle) and the second larval stage (lower). Arrows: PVD cell body. Scale bar: 20 μm. (B) Confocal images showing the expression patterns of endogenous GFP::CHDP-1 and myr-mCherry expressed in the PVD neurons (driven by the PVD cell-specific promoter ser2prom3). Arrows: PVD cell body. Scale bar: 20 μm. (C) Confocal images of the PVD morphologies in wild-type, chdp-1(tm4947), chdp-1(tm4947) mutant carrying transgenes driven by Pchdp-1, PVD-, skin- and muscle-specific promoters. Scale bar: 20 μm. (D-E) Quantification of (D) the number of 2o, 3o and 4o branches, and (E) the ratio of the intensity of the 2° branches to that of the primary dendrite in wild-type, chdp-1(tm4947) and chdp-1(tm4947) mutant expressing CHDP-1 under different tissue promoters in a 100 μm area anterior to the PVD cell body. Error bars: SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–30 for each genotype. (F) Confocal images showing the PVD morphologies of chdp-1(tm4947) mutant carrying a Phsp-16.48::chdp-1 single copy transgene without heat-shock, heat-shocked at either L2 stage or L3 stage. Scale bar: 20 μm. (G-H) Quantification of (G) the number of 2o, 3o and 4o branches in a 100 μm region anterior to the PVD cell body, and (H) the ratio of the intensity of the 2o branches to that of the primary dendrites in chdp-1(tm4947) mutant without heat-shock, heat-shocked at different developmental stages. Error bars: SEM. **p < 0.01, ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–30 for each genotype.
Structure-function analysis of CHDP-1 in regulating dendrite morphogenesis
To understand how CHDP-1 regulates dendrite development, we sought to determine which domain(s) is essential by performing the structure-function analysis. The full-length CHDP-1 driven by the PVD promoter fully rescued the dendrite branching defects of chdp-1(tm4947) mutants and was used as a positive control. Truncating the P1 motif, P2 motif or the C-terminal part did not affect the rescue ability, suggesting these motifs are not critical for regulating dendrite branching. In contrast, truncating the calponin homology domain (CH) or the helix motif abolished the rescue activity (Fig 3A–3C). We also examined the expression and subcellular localization of the full-length and truncated CHDP-1 proteins tagged by an N-terminal GFP. GFP signals could be detected for all the transgenes. For the full-length, delta P1, delta P2, or delta C transgenes, GFP clearly labeled the cell margin in the cell bodies of the PVD neurons. However, possibly due to improper folding/trafficking, GFP::CHDP-1 delta CH and GFP::CHDP-1 delta helix failed to localize to the cell cortex. They displayed punctate signals and diffused cytosolic distribution, respectively (Fig 3D), consistent with the notion that the cell cortex localization of CHDP-1 is critical for its function in dendrite development.
Fig 3
Structure-function analysis of CHDP-1 in dendrite development.
(A) Confocal images showing the PVD morphologies of chdp-1(tm4947) mutant expressing full length CHDP-1, CHDP-1 ΔP1, CHDP-1 ΔP2, CHDP-1 ΔCH, CHDP-1 ΔHelix, CHDP-1 ΔC under the PVD specific promoter. Scale bar: 20 μm. (B-C) Quantification of the number of (B) 2o, 3o and 4o branches in a 100 μm area anterior to the PVD cell body, and (C) the ratio of the intensity of the 2o branches to that of the primary dendrites in wild-type, chdp-1(tm4947) and chdp-1(tm4947) mutant expressing either full length or truncated forms of CHDP-1. Error bars: SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. n = 20–30 for each genotype. (D) Confocal images showing the localization of GFP::CHDP-1 (full length), GFP::CHDP-1 ΔP1, GFP::CHDP-1 ΔP2, GFP::CHDP-1 ΔCH, GFP::CHDP-1 ΔHelix and GFP::CHDP-1 ΔC under the PVD specific promoter (ser2rpom3). Arrows: the localization of CHDP-1 and truncated CHDP-1 in PVD cell body. Scale bar: 20 μm.
Structure-function analysis of CHDP-1 in dendrite development.
(A) Confocal images showing the PVD morphologies of chdp-1(tm4947) mutant expressing full length CHDP-1, CHDP-1 ΔP1, CHDP-1 ΔP2, CHDP-1 ΔCH, CHDP-1 ΔHelix, CHDP-1 ΔC under the PVD specific promoter. Scale bar: 20 μm. (B-C) Quantification of the number of (B) 2o, 3o and 4o branches in a 100 μm area anterior to the PVD cell body, and (C) the ratio of the intensity of the 2o branches to that of the primary dendrites in wild-type, chdp-1(tm4947) and chdp-1(tm4947) mutant expressing either full length or truncated forms of CHDP-1. Error bars: SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. n = 20–30 for each genotype. (D) Confocal images showing the localization of GFP::CHDP-1 (full length), GFP::CHDP-1 ΔP1, GFP::CHDP-1 ΔP2, GFP::CHDP-1 ΔCH, GFP::CHDP-1 ΔHelix and GFP::CHDP-1 ΔC under the PVD specific promoter (ser2rpom3). Arrows: the localization of CHDP-1 and truncated CHDP-1 in PVD cell body. Scale bar: 20 μm.
Actin assembly in the growth cones of high-ordered branches was reduced by the loss of chdp-1
We previously found that CHDP-1 regulates cortical actin assembly during neurite growth cone formation in the BDU and PLM neurons. Thus, we sought to determine whether CHDP-1 plays a similar role during PVD dendrite development. We first examined the localization of the endogenously expressed CHDP-1 in the dendrite growth cones. To avoid the signals derived from other cells, we specifically labeled the endogenously expressed CHDP-1 protein in the PVD neurons using the native and tissue-specific fluorescence (NATF) approach (Fig 4A) [39]. Briefly, we inserted the seven copies of sequences encoding the GFP11 into the N-terminus of the endogenous CHDP-1 using CRIPSR/Cas9-mediated genome editing and over-expressed GFP1-10 specifically in the PVD neurons using the ser2prom3 promoter from an extrachromosomal array. The animals expressing GFP(7x)::CHDP-1 showed normal dendrite morphology and intensity of the 2o branches, suggesting that the function of the endogenous CHDP-1 is not perturbed (S4C–S4E Fig). Unlike the cytosolic GFP, which showed even distribution in the 2o branches, GFP(7x)::CHDP-1 was enriched in the dendritic growth cones. This pattern was reminiscent of the F-actin probe mCherry::moesin actin-binding domain (moesinABD) (Fig 4B and 4D) [40]. Our previous study reported that the formation of the high-ordered branches relies on F-actin assembly [24]. In the wild-type animals, more than 80% of the moesinABD-labeled growth cones of the 2o branches showed a palm-like shape. In contrast, nearly all the growth cones of the 2o branches in the chdp-1(tm4947) animals showed a finger-like shape (Fig 4E–4G). We also compared the actin assembly in the dendritic growth cones of wild-type control and chdp-1(tm4947) animals using time-lapse recording and found that knock-out of chdp-1 dramatically decreased both the growth cone size and F-actin assembly in the growth cones of both 2o and 4o branches (Figs 4G, 4H, S6A, and S6B). The actin assembly defect of the chdp-1(tm4947) animals was confirmed using another F-actin reporter—Lifeact::GFP (S7A–S7D Fig) [41].
Fig 4
Loss of chdp-1 causes reduced actin assembly in the dendritic growth cones.
(A) A schematic diagram illustrating how the endogenously expressed CHDP-1 protein is specifically lighten up by GFP using the native and tissue-specific fluorescence approach. (B) Confocal images from time-lapse movies of growth cones labeled by GFP (upper) and GFP(7x)::CHDP-1 (lower) at L3 stage. Arrowheads: growth cones labeled with GFP, arrows: growth cones labeled with GFP(7x)::CHDP-1. Scale bar: 5 μm. (C) Confocal images showing the localization of GFP(7x)::CHDP-1 (left), mCherry::moesinABD (middle), and overlay (right) at early L3 stage. Arrows: growth cones. Scale bar: 5 μm. (D) Quantification of the ratio of the GFP, CHDP-1 and moesinABD intensity of the 2o dendrite growth cones to that of the primary branches. Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. n = 100 growth cones for each genotype. (E) Confocal images of GFP::moesinABD in wild-type (upper), chdp-1(tm4947) mutant (lower) at early L3 stage. Scale bar: 10 μm. Dotted line depicts the shape of the developing growth cone. (F) Quantification of the percentage of different morphology of growth cones in wild-type and chdp-1(tm4947) mutant in a 100 μm area anterior to the PVD cell body. n = 128 2o growth cones (from 10 animals) for WT, and n = 227 2o growth cones (from 10 animals) for chdp-1 mutants. (G) Confocal images from time-lapse movies of GFP::moesinABD in wild-type (upper) and chdp-1(tm4947) mutant (lower) during early L3 stage. Arrows: growth cones in wild-type, arrowheads: growth cones in chdp-1(tm4947). Scale bar: 5 μm. (H) Quantification of the average area of growth cones labeled by GFP::moesinABD, and the ratio of the intensity of the growth cones in the 2o branches to that of the primary dendrite in wild-type and chdp-1(tm4947) during early L3 stage. n = 100 growth cones for each group.
Loss of chdp-1 causes reduced actin assembly in the dendritic growth cones.
(A) A schematic diagram illustrating how the endogenously expressed CHDP-1 protein is specifically lighten up by GFP using the native and tissue-specific fluorescence approach. (B) Confocal images from time-lapse movies of growth cones labeled by GFP (upper) and GFP(7x)::CHDP-1 (lower) at L3 stage. Arrowheads: growth cones labeled with GFP, arrows: growth cones labeled with GFP(7x)::CHDP-1. Scale bar: 5 μm. (C) Confocal images showing the localization of GFP(7x)::CHDP-1 (left), mCherry::moesinABD (middle), and overlay (right) at early L3 stage. Arrows: growth cones. Scale bar: 5 μm. (D) Quantification of the ratio of the GFP, CHDP-1 and moesinABD intensity of the 2o dendrite growth cones to that of the primary branches. Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. n = 100 growth cones for each genotype. (E) Confocal images of GFP::moesinABD in wild-type (upper), chdp-1(tm4947) mutant (lower) at early L3 stage. Scale bar: 10 μm. Dotted line depicts the shape of the developing growth cone. (F) Quantification of the percentage of different morphology of growth cones in wild-type and chdp-1(tm4947) mutant in a 100 μm area anterior to the PVD cell body. n = 128 2o growth cones (from 10 animals) for WT, and n = 227 2o growth cones (from 10 animals) for chdp-1 mutants. (G) Confocal images from time-lapse movies of GFP::moesinABD in wild-type (upper) and chdp-1(tm4947) mutant (lower) during early L3 stage. Arrows: growth cones in wild-type, arrowheads: growth cones in chdp-1(tm4947). Scale bar: 5 μm. (H) Quantification of the average area of growth cones labeled by GFP::moesinABD, and the ratio of the intensity of the growth cones in the 2o branches to that of the primary dendrite in wild-type and chdp-1(tm4947) during early L3 stage. n = 100 growth cones for each group.
CHDP-1 is required for the proprioceptive function of the PVD neurons
PVD neurons sense the contraction of body wall muscle cells and thus are proprioceptors [17,27]. As loss of chdp-1 caused defects in dendrite branching and actin cytoskeleton organization, we sought to determine whether CHDP-1 is required for the proprioceptive function of the PVD neurons. We measured the moving tracks and body length of the following four strains: wild-type, dma-1(wy686), chdp-1(tm4947) and chdp-1(tm4947) carrying a PVD::chdp-1 transgene. dma-1 encodes a dendritic branching receptor, loss of which severely affects dendrite branching and the proprioceptive function of the PVD neurons (Fig 5A) [26,27]. Thus, dma-1(wy686) was used as a positive control in these experiments. All the strains showed similar body lengths, making it possible to directly compare the amplitude and wavelength of the moving tracks (Fig 5B). Interestingly, although chdp-1(tm4947) animals grew more dendrite branches than dma-1(wy686) animals, they displayed similar defects in proprioception as determined by the quantification of the amplitude and wavelength of the moving tracks. Expressing CHDP-1 specifically in the PVD neurons fully restored not only the dendrite branching but also the proprioceptive function of the PVD neurons (Fig 5A and 5C–5E). These results reveal that although the high-ordered branches could be generated when chdp-1 is mutated, they are non-functional for proprioception.
Fig 5
CHDP-1 is required for PVD’s proprioceptive function.
(A) Confocal images of the PVD morphologies of wild-type, dma-1(wy686), chdp-1(tm4947) and chdp-1(tm4947) mutant expressing CHDP-1 under the PVD specific promoter. Scale bar: 20 μm. (B) Quantification of the body length in late L4 stage for the genotypes mentioned above. Error bars: SEM. ns: non-significant. n = 10–20 worms for each genotype. (C) Images showing the representative moving tracks of wild-type, dma-1(wy686), chdp-1(tm4947) and chdp-1(tm4947) mutant expressing CHDP-1 under the PVD neuron-specific promoter. Scale bar: 200 μm. (D-E) Quantification of the (D) amplitude and (E) wavelength of the moving tracks in late L4 stage for the genotypes mentioned above. Error bars: SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 10–20 worms for each genotype.
CHDP-1 is required for PVD’s proprioceptive function.
(A) Confocal images of the PVD morphologies of wild-type, dma-1(wy686), chdp-1(tm4947) and chdp-1(tm4947) mutant expressing CHDP-1 under the PVD specific promoter. Scale bar: 20 μm. (B) Quantification of the body length in late L4 stage for the genotypes mentioned above. Error bars: SEM. ns: non-significant. n = 10–20 worms for each genotype. (C) Images showing the representative moving tracks of wild-type, dma-1(wy686), chdp-1(tm4947) and chdp-1(tm4947) mutant expressing CHDP-1 under the PVD neuron-specific promoter. Scale bar: 200 μm. (D-E) Quantification of the (D) amplitude and (E) wavelength of the moving tracks in late L4 stage for the genotypes mentioned above. Error bars: SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 10–20 worms for each genotype.
Neuropeptide release and microtubule assembly are defective in the high-ordered branches of chdp-1 mutants
Recently Tao et al. reported that the proprioceptive PVD neurons secret neuropeptide NLP-12 from their 3o branches to modulate neuromuscular junction activity and set muscle tone and movement vigor [27]. To understand how the loss of chdp-1 results in defects in proprioception, we asked whether the dendritic secretion of the neuropeptide NLP-12 is defective in chdp-1(tm4947) animals. We compared the distribution of NLP-12::Venus in wild-type and chdp-1(tm4947) animals. In wild-type animals, NLP-12 positive dense-core vesicles are distributed in the primary dendrites and the high-ordered branches. However, in chdp-1(tm4947) animals, these dense-core vesicles can only be found in the primary dendrites (Figs 6A, 6B, S8A, and S8B). Next, to directly compare the local secretion of NLP-12::Venus, we used the neuropeptide trapping assay developed by Tao et al. Briefly, the GFP nanobody, which is also known as the GFP binding protein (GBP), was fused at the N-terminus of the single transmembrane domain protein SAX-7 and the fused protein was specifically expressed in the epidermal cells using the Pdpy-7 promoter. SAX-7 formed stripes to guide the formation of 3o and 4o branches of the PVD neurons. Thus, once NLP-12::Venus was secreted from these branches, the neuropeptide was captured by the locally expressed GBP::SAX-7 due to the high binding affinity between GBP and the Venus protein. We found that loss of chdp-1 completely abolished NLP-12 secretion from the 3o dendrites (Fig 6C–6E) [27]. Together, these data suggest CHDP-1 is critical for the dendritic secretion of the neuropeptide NLP-12, and this is likely due to a defect in dense-core vesicle transport from the primary dendrites into the high-ordered branches.
Fig 6
Loss of chdp-1 affects assembly of microtubule cytoskeleton and organelle transport in the high-ordered dendrites.
(A) Confocal images of PVD dendrites (left), NLP-12 (NLP-12::Venus) (middle), overlay (right) in wild-type (upper), chdp-1(tm4947) mutant (lower). Arrows: NLP-12::Venus-positive dense-core vesicles in the high-ordered branches. Scale bar: 20 μm. (B) Quantification of NLP-12::Venus fluorescence intensity in the higher-ordered dendrites in a 100 μm area anterior to the PVD cell body (normalized to WT). Error bars: SEM. ***p < 0.001 by Student’s t test. n = 20–30 for each genotype. (C) A cartoon showing the spatial localization of SAX-7 in the epidermis and the rationale of using SAX-7 fused with anti-GFP nanobody (GFP-binding protein, GBP) to capture NLP-12::Venus secreted from PVD dendrites. (D) Confocal images of PVD dendrites (left), NLP-12 (middle), overlay (right) in wild-type (upper), sax-7(nj48) (middle), chdp-1(tm4947) (lower). Note that both sax-7(nj48) and chdp-1(tm4947) strains carrying a transgene to express GBP::SAX-7 in the epidermis. Arrows: NLP-12::Venus vesicles in the high-ordered branches. Scale bar: 5 μm. (E) Quantification of NLP-12::Venus fluorescence intensity around the high-ordered dendrites in a 100 μm area anterior to the PVD cell body (normalized to WT). Error bars, SEM. ***p < 0.001 by Student’s t test. n = 20–30 for each genotype. (F) Confocal images of GFP::TBA-1 in wild-type (left) and chdp-1(tm4947) mutant (right). Arrows: GFP::TBA-1 signals in the 2o branches. Scale bar: 10 μm. (G) Quantification of the ratio of the intensity of GFP::TBA-1 in the the 2o branches to that of the primary dendrites in wild-type and chdp-1(tm4947). Error bars: SEM. ***p < 0.001 by Student’s t-test. n = 50–60 for each genotype. (H) Confocal images from time-lapse movies showing EBP-2::GFP in PVD neurons in wild-type (upper) and chdp-1(tm4947) (lower) during early L3 stage. Arrows: a EBP-2::GFP comet moving toward the branching site in a 2o branch. Scale bar: 5 μm. (I) Kymographs of EBP-2::GFP in secondary dendrites in wild-type (left) and chdp-1(tm4947) (right) during early L3 stage. Scale bar: 1 μm. (J) Quantification of the number of EBP-2::GFP comets in the secondary branches of wild-type and chdp-1(tm4947) mutants. The comets move in an either anterograde (away from the 1o/2o intersection) or retrograde manner (toward the 1o/2o intersection).
Loss of chdp-1 affects assembly of microtubule cytoskeleton and organelle transport in the high-ordered dendrites.
(A) Confocal images of PVD dendrites (left), NLP-12 (NLP-12::Venus) (middle), overlay (right) in wild-type (upper), chdp-1(tm4947) mutant (lower). Arrows: NLP-12::Venus-positive dense-core vesicles in the high-ordered branches. Scale bar: 20 μm. (B) Quantification of NLP-12::Venus fluorescence intensity in the higher-ordered dendrites in a 100 μm area anterior to the PVD cell body (normalized to WT). Error bars: SEM. ***p < 0.001 by Student’s t test. n = 20–30 for each genotype. (C) A cartoon showing the spatial localization of SAX-7 in the epidermis and the rationale of using SAX-7 fused with anti-GFP nanobody (GFP-binding protein, GBP) to capture NLP-12::Venus secreted from PVD dendrites. (D) Confocal images of PVD dendrites (left), NLP-12 (middle), overlay (right) in wild-type (upper), sax-7(nj48) (middle), chdp-1(tm4947) (lower). Note that both sax-7(nj48) and chdp-1(tm4947) strains carrying a transgene to express GBP::SAX-7 in the epidermis. Arrows: NLP-12::Venus vesicles in the high-ordered branches. Scale bar: 5 μm. (E) Quantification of NLP-12::Venus fluorescence intensity around the high-ordered dendrites in a 100 μm area anterior to the PVD cell body (normalized to WT). Error bars, SEM. ***p < 0.001 by Student’s t test. n = 20–30 for each genotype. (F) Confocal images of GFP::TBA-1 in wild-type (left) and chdp-1(tm4947) mutant (right). Arrows: GFP::TBA-1 signals in the 2o branches. Scale bar: 10 μm. (G) Quantification of the ratio of the intensity of GFP::TBA-1 in the the 2o branches to that of the primary dendrites in wild-type and chdp-1(tm4947). Error bars: SEM. ***p < 0.001 by Student’s t-test. n = 50–60 for each genotype. (H) Confocal images from time-lapse movies showing EBP-2::GFP in PVD neurons in wild-type (upper) and chdp-1(tm4947) (lower) during early L3 stage. Arrows: a EBP-2::GFP comet moving toward the branching site in a 2o branch. Scale bar: 5 μm. (I) Kymographs of EBP-2::GFP in secondary dendrites in wild-type (left) and chdp-1(tm4947) (right) during early L3 stage. Scale bar: 1 μm. (J) Quantification of the number of EBP-2::GFP comets in the secondary branches of wild-type and chdp-1(tm4947) mutants. The comets move in an either anterograde (away from the 1o/2o intersection) or retrograde manner (toward the 1o/2o intersection).Next, we sought to determine whether loss of chdp-1 affects the transport of other types of intracellular organelles. The endoplasmic reticulum (ER) distributes in both the primary and some high-ordered dendrites in wild-type animals [31]. However, ER can only be observed in the primary dendrites in the chdp-1(tm4947) animals. Dynamic imaging analysis revealed that ER invaded and retracted in some of the 2o and 3o branches in the wild-type animals, while no such events was observed in the chdp-1(tm4947) animals. Similar defects were also observed for mitochondria (S9A–S9F Fig). We also examined DMA-1::GFP positive vesicles, presumably secretory vesicles and endosomes [30]. In wild-type animals, a small number of DMA-1::GFP positive vesicles could be observed in the high-ordered branches. However, it was extremely difficult for us to identify any vesicles in the high-ordered branches of chdp-1 mutants. DMA-1::GFP strongly labeled the high-ordered branches in wild-type and chdp-1(tm4947) mutant animals, making it a bit difficult to quantify the number of vesicles. We took advantage of the exoc-8 mutants, in which the docking/fusion of DMA-1 vesicles onto the dendritic membrane was strongly affected and confirmed that CHDP-1 was indeed required for the transport of the secretory vesicles/endosomes from the primary dendrites into the high-ordered branches (S10A–S10D Fig). Together, these results demonstrate an essential role of CHDP-1 in organelle transport in the high-ordered dendritic branches.Intracellular organelles are transported by motor proteins, dynein and kinesin, which move along the microtubule cytoskeletons. Thus, we asked whether loss of chdp-1 affects the assembly of the microtubule cytoskeleton in the PVD dendrites. To examine all the microtubules, which include both the dynamic and stable ones, we generated a GFP::TBA-1 transgene driven by the PVD promoter [25,28]. GFP signals could be observed in the primary and high-ordered dendrites in the wild-type control group. In chdp-1(tm4947) animals, GFP::TBA-1 strongly labeled the primary dendrites, while the signal was barely detected in the high-ordered branches (Fig 6F and 6G). To examine the dynamic microtubules, we expressed an EBP-2 (a plus-end binding protein)::GFP reporter in the PVD neurons [28,32]. In both strains, we found a similar number of mobile EBP-2 comets moving either towards the growth cone (anterograde) or the cell body (retrograde) in the growth cones of the anterior primary dendrites. We did not detect any difference regarding the microtubules’ running length, growth duration or pause (S11A–S11F Fig). To further test whether there is any microtubule polarity abnormality, we examined the distribution of the synaptic vesicle maker mCherry::RAB-3. We found no abnormal accumulation of RAB-3 in the dendrites, suggesting that chdp-1 mutants are not defective in microtubule assembly or polarity in the primary dendrites (S11G Fig). In contrast, we found a small number of EBP-2 comets either moving away from the 1o/2o branching sites (anterograde) or towards the branching sites (retrograde) in the 2o branches of wild-type, but not the chdp-1(tm4947) animals (Fig 6H–6J). Thus, in addition to its role in actin cytoskeleton assembly, CHDP-1 is also required for microtubule cytoskeleton assembly in the high-ordered branches.
CHDP-1 may not function through CED-10
We previously reported that CHDP-1 acts through the small GTPase CED-10/Rac1 in the BDU and PLM neurons [16]. To examine whether CHDP-1 regulates dendritic cortical actin assembly in PVD neurons via a similar mechanism, we examined dendrite morphogenesis in n3246, a strong loss-of-function allele of ced-10 [42]. ced-10 (n3246) mutants did not show an increased number of 2o and 3o branches or faint staining of the 2o branches by the myr-GFP reporter. The number of 4o branches was reduced in ced-10 (n3246) mutants, but to a lesser extent compared to the chdp-1(tm4947) animals. In addition, we found that ER distribution in the high-ordered branches was not affected in ced-10 (n3246) mutants (S12A–S12E Fig). Together, our data suggest that CHDP-1 regulates dendritic cortical actin assembly via a CED-10-independent pathway or CED-10 only plays a minor role.
Loss of sax-1 genetically suppresses defects of chdp-1 knock-out animals
To understand how dendritic cortical actin assembly is regulated, we searched genes of which loss-of-function lead to excess membrane protrusions and thus serve as negative regulators in cortical actin assembly. A previous study reported that loss of sax-1, which encodes a conserved serine/threonine protein kinase, causes ectopic membrane protrusion formation [33]. Interestingly, overexpression of CHDP-1 also causes ectopic membrane protrusion [16]. Thus, we built genetic double mutants between chdp-1(tm4947) and sax-1(ky491) and examined the genetic interaction between the two genes. Interestingly, loss of sax-1 fully suppressed the increased number of 2o and 3o branches, decreased number of 4o branches, and faint labeling of myr-GFP in the 2o branches. Loss of sax-2, which genetically acts upstream of sax-1, also suppressed the defects mentioned above in chdp-1(tm4947) (Fig 7A–7C) [34]. Conditional knock-out of sax-1 in PVD neurons and other cells derived from the seam cell lineage also suppressed these defects in chdp-1(tm4947), indicating that SAX-1 acts cell-autonomously (S13A–S13C Fig). To gain more insights into the suppression, we also analyzed actin assembly in the dendrite growth cones, microtubule assembly and distribution of NLP-12-positive dense-core vesicles in the high-ordered dendrites. Loss of sax-1 also restored actin assembly, microtubule assembly and dense-core vesicle transport/distribution in the chdp-1(tm4947) mutants (Fig 7D and 7E). The double mutant animals also showed nearly normal locomotion: both the amplitude and wavelength were similar to the wild-type control group (S13D–S13G Fig). Together, our results suggest that SAX-1 acts opposingly to CHDP-1, and we speculated that it is a negative regulator of cortical actin assembly.
Fig 7
Knockout of sax-1 suppresses dendrite development defects in chdp-1 mutants.
(A) Confocal images of PVD dendrites in wild-type, chdp-1(tm4947), sax-1(ky491), chdp-1(tm4947); sax-1(ky491), sax-2(ky216) and chdp-1(tm4947); sax-2(ky216). Scale bar: 20 μm. (B-C) Quantification of (B) the number of 2o, 3o and 4o branches, and (C) the ratio of the 2o branches to that of the intensity of the primary dendrites in the 100 μm area anterior to PVD cell body for the genotypes indicated. Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–30 for each genotype. (D) Confocal images of (top) Lifeact in early L3 stage (arrows: growth cones of 2o branches with F-actin), (middle) TBA-1 (arrows: 2o branches labeled by GFP::TBA-1), and (bottom) NLP-12::Venus and myr-mCherry (arrows: dense-core vesicles in high-ordered branches) in wild-type, chdp-1(tm4947), sax-1(ky491) and chdp-1(tm4947); sax-1(ky491). Scale bar: 10 μm. (E) Quantification of (left) the ratio of the Lifeact::GFP intensity of the 2o dendrite to that of the primary branches, (middle) the ratio of the TBA-1::GFP intensity of the 2o dendrite to that of the primary dendrites, (right) NLP-12::Venus fluorescence intensity in high-ordered dendrites in the 100 μm area anterior to PVD cell body for the genotypes indicated (normalized to WT). Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–30 for each genotype.
Knockout of sax-1 suppresses dendrite development defects in chdp-1 mutants.
(A) Confocal images of PVD dendrites in wild-type, chdp-1(tm4947), sax-1(ky491), chdp-1(tm4947); sax-1(ky491), sax-2(ky216) and chdp-1(tm4947); sax-2(ky216). Scale bar: 20 μm. (B-C) Quantification of (B) the number of 2o, 3o and 4o branches, and (C) the ratio of the 2o branches to that of the intensity of the primary dendrites in the 100 μm area anterior to PVD cell body for the genotypes indicated. Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–30 for each genotype. (D) Confocal images of (top) Lifeact in early L3 stage (arrows: growth cones of 2o branches with F-actin), (middle) TBA-1 (arrows: 2o branches labeled by GFP::TBA-1), and (bottom) NLP-12::Venus and myr-mCherry (arrows: dense-core vesicles in high-ordered branches) in wild-type, chdp-1(tm4947), sax-1(ky491) and chdp-1(tm4947); sax-1(ky491). Scale bar: 10 μm. (E) Quantification of (left) the ratio of the Lifeact::GFP intensity of the 2o dendrite to that of the primary branches, (middle) the ratio of the TBA-1::GFP intensity of the 2o dendrite to that of the primary dendrites, (right) NLP-12::Venus fluorescence intensity in high-ordered dendrites in the 100 μm area anterior to PVD cell body for the genotypes indicated (normalized to WT). Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–30 for each genotype.
Discussion
Here, we reported that the cell cortex-localized protein CHDP-1 acts cell-autonomously in the multi-dendritic PVD neurons to promote cortical actin assembly, which is critical for dendrite formation, maintenance and microtubule-based organelle transport (Fig 8).
Fig 8
Working model of CHDP-1 in dendrite development and transport.
A cartoon showing how CHDP-1 regulates cortical actin assembly in the multi-dendritic neurons. In the wild-type animals, CHDP-1 localizes to the cell cortex and promotes cortical actin assembly. In the high-ordered dendrites, CHDP-1-dependent cortical actin assembly is likely required for microtubule assembly and microtubule-based transport. In chdp-1 knockout animals, cortical actin assembly in the high-ordered branches is reduced, and microtubule assembly and organelle transport are defective. Motor: kinesin or dynein. DCV: dense-core vesicle.
Working model of CHDP-1 in dendrite development and transport.
A cartoon showing how CHDP-1 regulates cortical actin assembly in the multi-dendritic neurons. In the wild-type animals, CHDP-1 localizes to the cell cortex and promotes cortical actin assembly. In the high-ordered dendrites, CHDP-1-dependent cortical actin assembly is likely required for microtubule assembly and microtubule-based transport. In chdp-1 knockout animals, cortical actin assembly in the high-ordered branches is reduced, and microtubule assembly and organelle transport are defective. Motor: kinesin or dynein. DCV: dense-core vesicle.
Dendrite development and maintenance rely on the proper assembly of cortical actin
Neurons are specialized cell types, usually with a long unbranched axon and multiple high-branched dendrites. For dendrites, it has been known for decades that dendrite morphogenesis relies on actin assembly, which is regulated by Rac and Cdc42 [43]. Cortical actin is an enigmatic subset of the actin cytoskeleton. Assembly of cortical actin requires Rac1 and Arp2/3 [16,44,45]. However, these regulators may localize to both cell cortex and cytosol and thus not specific cortical actin regulators. To understand whether cortical actin assembly plays an important role during dendrite morphogenesis and maintenance, a manipulation that disrupts actin assembly at the cell cortex but not anywhere else is required. Our previous study and this study identified that CHDP-1, a cell cortex-localized actin assembly regulator, fulfils this requirement [16]. Through genetic analyses of the putative null mutants of chdp-1, we found that loss of chdp-1 caused an increased number of 2o and 3o branches, and a decreased number of 4o branches. Disruption of actin assembly has been reported to cause less dendrite branching [24,25]. Thus, it is somehow unexpected that chdp-1 mutants contain increased 2o and 3o branches. From time-lapse recording, it seems this could be explained by increased 2o initiation (although 2o branch retraction was also observed). Possibly, deceased cortical actin assembly enables more filopodia formation derived from the primary dendrite. However, for the 4o branching, disrupted intracellular transport probably affects branch initiation and stabilization. Using the STED super-resolution microscopy, we also observed opposite defective phenotypes for the diameters of 1o dendrites vs 2o branches: the former was enlarged and the latter was decreased. In addition, the diameter became less uniform for the 1o dendrite in chdp-1 mutants, reminiscent of the dendrite width in unc-70/beta-spectrin mutants [10]. Future study is needed to fully understand why defective cortical actin assembly causes different effects for 1o dendrites and 2o branches. Loss of chdp-1 also resulted in spontaneous dendrite degeneration in the adults. Interestingly, loss-of-function mutations in unc-70 and alpha-adducin also led to axon degeneration phenotypes [15,46]. Thus, our finding is consistent with the notion that membrane skeleton assembly is critical for neurite maintenance.
Cortical actin assembly is likely required for microtubule assembly and organelle transport
In the high-ordered branches, loss of chdp-1 reduced the cortical actin assembly and the microtubule assembly. Two models can explain the decreased microtubule cytoskeleton. (1) CHDP-1 directly acts as a microtubule assembly factor. (2) The effect of CHDP-1 on microtubule assembly is secondary to its function in cortical actin assembly. Actin cytoskeleton often interacts with microtubule cytoskeleton [1,47]. Numerous proteins have been reported to mediate structural interactions between microtubules and actin, such as coronin and Drebrin-EB3 [48,49]. Disrupting of actin cytoskeleton can lead to microtubule assembly defects [50]. Thus, it is conceivable to hypothesize that the cortical actin in the high-ordered branches can serve as a platform to promote microtubule assembly and stabilization. Future studies are needed to tell which model is correct.
The evolutionarily conserved serine/threonine protein kinase SAX-1/NDR1 is a putative negative regulator of cortical actin assembly
SAX-1 shares high homology with its homolog in multiple species, including CBK1 in yeasts, Trc in flies, and NDR1/2 in humans [51]. Mutants of sax-1 was initially identified as the cell body of several types of neurons showed ectopic lamellipodia-like protrusions. Disrupting the endogenous RhoA function by expressing a dominant-negative RhoA transgene phenocopied the sax-1 loss-of-function phenotype, indicating that SAX-1 might act to modulate actin assembly [33]. Trc is required for proper cell shape and wing hair initiation in flies. Trc mutant cells contained more F-actin than that of the wild-type cells [52]. Knock-out of Trc in the class IV DA neurons results in ectopic dendrite branching and dendritic tilling defects. For dendritic branching, Trc kinase negatively regulates Rac signaling pathway [53]. However, it is unclear whether Rac is a phosphorylation target of Trc kinase. In the present study, we found that loss of sax-1 suppressed all the defects in the chdp-1mutant animals, including abnormal dendrite branching pattern, faint labeling of the 2o branches by the myr-GFP reporter, reduced actin assembly in the growth cones of high-ordered branches, decreased microtubule assembly in the 2o branches, defective organelle transport from the 1o dendrites into the high-ordered branches and impaired proprioception. Very likely, restoration of the cortical actin assembly is the primary effect of sax-1 knock-out, and other phenotypic restorations are secondary. To the best of our knowledge, this is the first time that the SAX-1/NDR1 kinase family has been proposed as a putative negative regulator for cortical actin assembly. Currently, the direct phosphorylation target of SAX-1 in this process is not clear. Ultanir et al. identified several membrane traffic-related phosphorylated targets for NDR1 kinase using a chemical genetical approach [54]. A future study using a similar strategy will likely uncover the direct downstream player(s) of SAX-1 in the negative regulation of cortical actin assembly.Together, our results showed that CHDP-1 promotes cortical actin assembly in multi-dendritic neurons. Compromising this process causes defects in dendrite branching, microtubule assembly, organelle transport, neuropeptide secretion and proprioception. Furthermore, our data also suggest that the evolutionarily conserved SAX-1/NDR1 kinase is a putative negative regulator of cortical actin assembly. CHDP-1 and SAX-1 function in an opposing manner to balance cortical actin assembly in neurons and perhaps other non-neuronal cell types. Our study will shed light on the enigmatic mechanisms and functions of neuronal cortical actin assembly.
Materials and methods
C. elegans genetics
N2 Bristol was used as the wild-type strain. Worms were grown on nematode growth medium plates seeded with OP50 E. coli at 20°C [55]. The mutant alleles used in this study were chdp-1(zac135), chdp-1(tm4947), dma-1(wy686), sax-1(ky491), sax-2(ky216), ced-10(n3246), exoc-8(ok2523). For details and complete lists of strains, see S1 Table.
DNA manipulations and transgenes
Plasmids were constructed by standard methods. pPD49.26 and pSM delta (a derivative of pPD49.26 with additional cloning sites, which was kindly provided by Prof. Kang Shen) were used as vector backbones for most plasmids except the ones for expressing single guide RNAs. Transgenes expressed from extrachromosomal arrays were generated using standard gonad transformation by injection [56]. Podr-1::rfp, Punc-122::rfp, Pmyo-2::mcherry, Pmyo-3::mcherry were used as co-injection markers and were injected at 2–50 ng/μl.The single-copy transgene zacTi22[Phsp-16.48::chdp-1::sl2::bfp] was generated using the miniMos-based protocol [38]. Briefly, the sequences of Phsp-16.48, chdp-1 cDNA and sl2::bfp were amplified from N2 genomic DNA or home-made cDNA library and cloned into pWZ393 (a modified version of pCFJ909, with additional restriction sites and two loxP sites) to generate pZT116. pTZ116 (20 ng/μl), pCFJ601 (Peft-3::mos1 transposase, 50 ng/μl), Pmyo-3::mcherry (5 ng/μl), Podr-1::rfp (50 ng/μl) and Punc-122::rfp (50 ng/μl) were injected into the unc-119(ed4) animals. Successful single copy transgenes were obtained by screen for animals non-unc and without co-injection marker expression. BFP expression was used during the genetic cross. For details and complete lists of plasmids and transgenes, see S1 Table.
Isolation and mapping of chdp-1(zac135) mutants
The chdp-1(zac135) mutant was isolated from an F2 semi-clonal screen of 30,000 haploid genomes in wyIs594 (ser2p3::myr-gfp and Podr-1::rfp) genetic background. Worms were mutagenized with 50 mM ethyl methanesulfonate (EMS). SNP mapping and whole genome sequencing were performed using standard protocols previously described [57,58]. zac135 was mapped between Chr I: 0.03 and 2.17. Whole genome sequencing identified five homozygous nonsynonymous mutations in exons of the protein-coding genes (T27A3.5, chdp-1, pdi-3, F13G3.12 and T25G3.4). Transgenic rescue experiments were carried out, and the results showed that zac135 was an allele of the chdp-1 gene.
CRISPR/Cas9-mediated genome editing
The coding sequence of gfp was inserted into the N-terminus of the chdp-1 locus via CRISPR/Cas9-mediated genome editing [37,39]. Briefly, Peft-3::cas9+U6::sgRNA for dpy-10 (50 ng/μl, kindly provided by Dr. Suhong Xu), U6::chdp-1-sgRNA #1 (20 ng/μl, target sequence: 5’AACACATCAACT ATGTCTG3’), U6::chdp-1-sgRNA #2 (20 ng/μl, target sequence: 5’GAGGAAATCAAGAAGATCG3’), U6::chdp-1-sgRNA #3 (20 ng/μl, target sequence: 5’GAGGTCGCCGAGCAAGACA3’), repair template (50 ng/μl) and Pmyo-2::mcherry (2 ng/μl) were co-injected into N2. Dumpy or roller F1 animals were picked and cultured for one more generation. Successful knock-in animals were obtained through PCR-based genotyping, and no additional mutation was found based on Sanger sequencing.Conditional knock-out of sax-1 in PVD neurons and other cells derived from the seam cell lineage was performed as described previously [30,59]. Briefly, Pnhr-81::cas9 (50 ng/μl), U6::sax-1-sgRNA #1 (20 ng/μl, target sequence: 5’GGAAATATCGCAGTACACAA3’), U6::sax-1-sgRNA #2 (20 ng/μl, target sequence: 5’AAAGCGTGTCACACAATGTG3’), U6::sax-1-sgRNA #3 (20 ng/μl, target sequence: 5’AGTCTCAAAGTGATTGGACG3’), Podr-1::rfp (50 ng/μl) and Pmyo-2::mcherry (2 ng/μl) were co-injected into chdp-1(tm4947); wyIs592 strain. Transgenic lines were obtained by tracking the expression of co-injection markers.
Confocal imaging of C. elegans
For static imaging, worms were immobilized using 1 mM levamisole solution and placed on 4% agarose pads, and then imaged using an Olympus IX83 fluorescence microscope equipped with a spinning-disk confocal scanner (Yokogawa CSU-W1), an sCMOS camera (Prime 95B), and a 60x oil Apochromat objective (NA: 1.49). Z stack images were processed by the projection of maximum intensity except for Figs 2A and S5A.Time-lapse imaging was performed as previously described with some modifications [60]. Briefly, 2 μl of 1 mM levamisole solution was added into the center of the glass bottom of a microwell dish, then about 20 worms were transferred into the drop of levamisole solution. Next, a 4% agarose pad was gently added onto the animals. All time-lapse movies were taken using the spinning-disk confocal microscope, and Z stack images were processed by projection of maximum intensity except for S10 and S11 Figs, in which single-layer images were shown.For Stimulated Emission Depletion Microscopy (STED) imaging, worms were immobilized using 1 mM levamisole solution and placed on 4% agarose pads. A Leica TCS SP8 STED fluorescence microscope equipped with 592/660/775 nm lasers, and a HC PL APO CS2 100×/1.40 oil objective was used for imaging. Z stack images were processed by the projection of maximum intensity.
Split-GFP assay for cell-specific detection of CHDP-1 expression
This assay was performed as described by Siwei He et al. [39]. Briefly, the coding sequence for GFP117x was amplified from a previously published plasmid (Addgene #70224). The PCR product was assembled with two homology arms (~ 500 bp each) amplified from the N2 genomic DNA, and the digested pSM delta plasmid as the backbone via the Gibson assembly protocol to generate the repair template plasmid pZT105. A similar CRISPR knock-in strategy was used as how gfp::chdp-1 was generated, except that pZT105 was used in this experiment. Successful knock-in animals were obtained through PCR-based genotyping, and no additional mutation was found by Sanger sequencing. The coding sequence for GFP1-10 was amplified from a previously published plasmid (Addgene # 70219). The PCR product was cloned into a plasmid in which the PVD-specific promoter ser2prom3 was previously inserted. This plasmid (pZT106, 20 ng/μl), Podr-1::rfp (50 ng/μl) and Pmyo-2::mcherry (2 ng/μl) were injected into the zac283[gfp11(7x)::chdp-1] strain. Stable transgenic lines were isolated via the expression of the co-injection markers and subjected to confocal imaging.
Local neuropeptide secretion assay
This assay was performed as described by Li Tao et al. [27]. Briefly, pZT143 ser2rom3::nlp-12::venus::sl2::mcherry (20 ng/μl), pLT110 Pdpy-7::gbp::sax-7 (10 ng/μl, kindly provided by Dr. Kang Shen), Pmyo-2::mcherry (2 ng/μl) and Podr-1::rfp (50 ng/μl) were injected into sax-7(nj48) or chdp-1 (tm4947) mutant animals. Stable transgenic lines were obtained and subjected to confocal imaging.
Locomotion assay
This assay was performed following a previous protocol with some modifications [61]. Briefly, 10–20 worms in the late L4 stage were transferred individually into fresh NGM plates, and then the plates were put in a 20°C incubator for 1–2 hours. Images of the crawl tracks were taken using a Nikon SM218 stereo microscope with a 1x SHR Plan Apo objective (NA: 0.15). The trajectory’s amplitude (the distance between opposite peaks) and wavelength (the distance between two successive peaks) were measured using ImageJ. For each strain, the crawling trajectories of 10–20 worms were measured.
Quantification and statistical analysis
For PVD dendrites, the number of dendrites of 2°, 3°, and 4° is the number within the 100 μm region anterior to the PVD cell body. For the fluorescence intensity and width of dendrites, ImageJ is used for statistics. The numerical data that underlies graphs or summary statistics were summarized in S2 Table. The Student’s t-test (for the difference between two groups) or one-way analysis of variance with Tukey correction (for the difference between three or more groups) was used for statistical analysis.
Loss of chdp-1 causes PVD dendrite branching defects.
(A) Confocal images showing the PVD morphologies of wild-type (left), chdp-1(zac135) (middle) and chdp-1(tm4947) (right) animals labeled using wdIs51 which expresses cytosolic GFP driven by the F49H12.4 promoter in PVD neurons and a few other neurons. Scale bar: 20 μm. (B) Quantification of the number of 2o, 3o and 4o branches in a 100 μm area anterior to the PVD cell body, and the ratio of the intensity in the 2o branches to that of the primary dendrites in wild-type, chdp-1(zac135) and chdp-1(tm4947). The dendrites are labeled using wdIs51. Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. n = 20–30 for each genotype. (C) Confocal images showing the PVD morphologies of wild-type (left), chdp-1(zac135) (middle) and chdp-1(tm4947) (right) animals labeled using otIs138, which expresses cytosolic GFP driven by the ser2prom3 promoter (the expression level is much lower than that of wyIs592). Scale bar: 20 μm. (D) Quantification of the number of 2o, 3o and 4o branches in a 100 μm area anterior to the PVD cell body, and the ratio of the intensity in the 2o branches to that of the primary dendrites in wild-type, chdp-1(zac135) and chdp-1(tm4947). The dendrites are labeled using otIs138. Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. n = 20–30 for each genotype. (E) Images taken by the STED super-resolution microscopy for primary dendrites (left) and secondary dendrites (right) in wild-type and chdp-1(tm4947). Note that the orientation for the 2o branches is as following: left: close to the 1o dendrite. Right: close to the 3o branches. Scale bar: 500 nm. (F) Plots of the width along the representative primary dendrite and 2o branches in a 10 μm area. (G) Quantification of the mean width of the primary dendrite and 2o branches in wild-type and chdp-1(tm4947). Error bars: SEM. ***p < 0.001 by Student’s t test. n = 20 for each genotype.(TIFF)Click here for additional data file.
Time-lapse analyses of dendrite formation in wild-type and chdp-1 mutant animals in early L3 stage.
(A) Confocal images from time-lapse movies showing dendrite branching, outgrowth and retraction in wild-type (upper) and chdp-1(tm4947) mutant animals (lower) during early L3 stage. Arrows: 2o outgrowth, arrowheads: 2o retraction. Scale bar: 5 μm. (B-C) Quantification of the number of 2o branches initiation (B) and retraction (C) per hour in a 100 μm area anterior to the PVD cell body. Error bars: SEM. ***p < 0.001 by Student’s t-test. n = 10 animals for each genotype. (D-E) Quantification of the speed of 2o dendrite growth (D) and retraction (E). Error bars: SEM. ns: non-significant by Student’s t-test. For D, n = 100 branches for each genotype. For E, n = 36 branches for wild-type, and n = 29 branches for chdp-1(tm4947).(TIF)Click here for additional data file.
Loss of chdp-1 causes an age-dependent dendrite degeneration in adult animals.
(A) A cartoon showing the simplified morphologies and locations of OLL neurons in the head region and PVD neurons. Area is defined to the distance between the cell bodies of OLL and vulva. (B) Confocal images of the PVD dendrites in wild-type and chdp-1(tm4947) mutants at the fourth larval, 1 day-old adult (DOA), 5 DOA, 9 DOA stages. Arrows: the distal tip of the anterior primary dendrite. Asterisks: cell bodies of OLL neurons. Scale bar: 50 μm. (C) Quantification of the number of 2o and 4o branches per area in wild-type and chdp-1(tm4947) mutant at six different developmental stages, including L4, 1 DOA, 3 DOA, 5 DOA, 7 DOA and 9 DOA. Error bars: SEM. *p < 0.05, ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 50–60 animals for each group.(TIF)Click here for additional data file.
GFP knock-in does not affect the function of endogenous CHDP-1.
(A-B) Quantification of the number of (A) 2o, 3o and 4o branches in a 100 μm area anterior to the PVD cell body, and (B) the ratio of the intensity in the 2o branches to that of the primary dendrites in wild-type and gfp::chdp-1 knock-in animals. Error bars: SEM. ns: non-significant by Student’s t-test. n = 20–30 for each genotype. (C) Confocal images showing the expression patterns of GFP(7x)::CHDP-1 (left), mCherry (middle) and overlay (right) in the PVD neurons. Scale bar: 20 μm. (D-E) Quantification of (D) the number of 2o, 3o and 4o branches in a 100 μm area anterior to the PVD cell body, and (E) the ratio of the intensity of the 2° branches to that of the primary dendrite in wild-type and gfp(7x)::chdp-1 knock-in animals. Error bars: SEM. ns: non-significant by Student’s t-test. n = 20–30 for each genotype.(TIF)Click here for additional data file.
Endogenous CHDP-1 localizes to the cell cortex.
(A) Left: Confocal images showing the localization of endogenously expressed GFP::CHDP-1 (left), myr-mCherry (middle), and overlay (right) in the embryonic stages. Right: Normalized intensity of GFP::CHDP-1 and myr-mCherry around the cell membrane. Scale bar: 20 μm. (B) Left: Confocal images showing the localization of endogenously expressed GFP::CHDP-1 (left), myr-mCherry (middle), and overlay (right) in the PVD cell body. Right: Normalized intensity of GFP::CHDP-1 and myr-mCherry around the PVD cell body membrane. Scale bar: 5 μm.(TIFF)Click here for additional data file.
CHDP-1 is required for actin assembly in the 4o dendritic growth cones in early L4 stage.
(A) Left: Confocal images of GFP::moesinABD in wild-type (upper), chdp-1(tm4947) mutant (lower) at the early L4 stage. Scale bar: 10 μm. Right: Confocal images from time-lapse movies of GFP::moesinABD in wild-type (upper) and chdp-1(tm4947) mutant (lower) during the early L4 stage. Arrows: growth cones in wild-type, arrowheads: growth cones in chdp-1(tm4947). Scale bar: 5 μm. (B) Quantification of the average growth cones area labeled by GFP::moesinABD, and the ratio of the intensity of the growth cones in the 4o branches to that of the primary dendrite in wild-type and chdp-1(tm4947) during the early L4 stage. n = 100 growth cones for each group.(TIFF)Click here for additional data file.
CHDP-1 is required for actin assembly during dendrite formation.
(A) Left: Confocal images of Lifeact::GFP in wild-type (upper) and chdp-1(tm4947) mutant (lower) at early L3 stage. Scale bar: 10 μm. Right: Confocal images from time-lapse movies showing actin assembly in wild-type (upper) and chdp-1(tm4947) mutant (lower) during the early L3 stage. Arrows: growth cones of 2o branches labeled by Lifeact::GFP in wild-type, arrowheads: growth cones in chdp-1(tm4947). Scale bar: 5 μm. (B) Quantification of the average growth cones area, and the ratio of the intensity in the growth cones of the 2o branches to that of the primary dendrite in wild-type and chdp-1(tm4947) during the early L3 stage. n = 100 growth cones for each group. (C) Left: Confocal images of Lifeact::GFP in wild-type (upper) and chdp-1(tm4947) mutant (lower) at early L4 stage. Scale bar: 10 μm. Right: Confocal images from time-lapse movies showing actin assembly in wild-type (upper) and chdp-1(tm4947) mutant (lower) during the early L4 stage. Arrows: growth cones of 4o branches labeled by Lifeact::GFP in wild-type, arrowheads: growth cones in chdp-1(tm4947). Scale bar: 5 μm. (D) Quantification of the average growth cones area, and the ratio of the intensity in the growth cones of the 4o branches to that of the primary dendrite in wild-type and chdp-1(tm4947) during the early L4 stage. n = 100 growth cones for each group.(TIFF)Click here for additional data file.
Distribution of the NLP-12-positive dense-core vesicles in the primary dendrites.
(A) Confocal images of PVD dendrites (left), NLP-12 (NLP-12::Venus) (middle), overlay (right) in wild-type (upper), chdp-1(tm4947) mutant (lower). Arrows: NLP-12::Venus-positive dense-core vesicles in primary dendrites. Scale bar: 10 μm. (B) Quantification of NLP-12::Venus fluorescence intensity in primary dendrites in a 100 μm area anterior to the PVD cell body (normalized to WT). Error bars: SEM. ***p < 0.001 by Student’s t test. n = 20–30 for each genotype.(TIFF)Click here for additional data file.
ER and mitochondria transport into the high-ordered branches is defective in chdp-1 mutant animals.
(A) Confocal images of PVD neuron (left), ER (labeled using a mCherry::SP12 reporter) (middle) and overlay (right) in wild-type (upper) and chdp-1(tm4947) mutant (lower). Arrows: ER in the high-ordered branches. Scale bar: 20 μm. (B) Quantification of the number of 2° branches with ER invasion in a 100 μm area anterior to the PVD cell body. Error bars: SEM. ***p < 0.001 by Student’s t-test. n = 20–30 for each genotype. (C) Confocal images from time-lapse movies showing transport of ER (upper) and overlay of ER (red) and PVD neuron (green) in wild-type (left) and chdp-1(tm4947) mutant (right) during early L3 stage. Arrows: ER in high-ordered branches. Scale bar: 5 μm. (D) Confocal images of PVD neuron (left), mitochondria (TOMM-20 1-54AA::GFP) (middle), overlay (right) in wild-type (upper) and chdp-1(tm4947) mutant (lower). Arrows: mitochondria in high-ordered branches. Scale bar: 20 μm. (E) Quantification of the number mitochondria in the high-ordered dendrites in a 200 μm area anterior to PVD cell body. Error bars: SEM. ***p < 0.001 by Student’s t test. n = 20–30 for each genotype. (F) Confocal images from time-lapse movies showing transport of mitochondria in PVD dendrites in wild-type (left) and chdp-1(tm4947) mutant (right) during L4 stage. Arrows: mitochondria in high-ordered branches. Scale bar: 5 μm.(TIFF)Click here for additional data file.
Transport of DMA-1::GFP vesicles in wild-type and chdp-1 mutants.
(A) Upper: Confocal images of DMA-1::GFP in wild-type (left) and chdp-1(tm4947) mutant (right). Scale bar: 20 μm. Lower: Confocal images from time-lapse movies showing transport of DMA-1::GFP vesicles in wild-type (left) and chdp-1(tm4947) mutant (right) at adult stages. Arrows: DMA-1::GFP vesicles moving in high-ordered branches. Scale bar: 5 μm. (B) Quantification of the number DMA-1::GFP vesicular units in the high-ordered dendrites in a 100 μm area anterior to the PVD cell body. Note that a DMA-1::GFP vesicular unit is defined as a punctum that is at least 2-fold brighter than the diffused signal along the dendrites. Error bars, SEM. ***p < 0.001 by Student’s t-test. n = 20–30 for each genotype. (C) Upper: Confocal images showing the distribution of DMA-1::GFP vesicular units in exoc-8 (ok2523) mutant background in wild-type (left) and chdp-1(tm4947) mutant (right). Scale bar: 20 μm. Lower: Confocal images from time-lapse movies showing transport of DMA-1::GFP vesicles in exoc-8 (ok2523) mutant background in wild-type (left) and chdp-1(tm4947) mutant (right) in adult. Arrows: DMA-1::GFP vesicles in the high-ordered branches. Note that loss of exoc-8 disrupts fusion between vesicles and the dendritic membranes, which make it easier to compare vesicular transport in wild-type and chdp-1 mutant animals. Scale bar: 5 μm. (D) Quantification of the number DMA-1::GFP vesicular units in the high-ordered dendrites in a 100 μm area anterior to the PVD cell body in exoc-8 (ok2523) background. Error bars, SEM. ***p < 0.001 by Student’s t-test. n = 20–30 for each genotype.(TIFF)Click here for additional data file.
Microtubule assembly in the growth cones of the anterior primary dendrite in WT and chdp-1 mutants.
(A) A cartoon showing the area imaged to analyze the microtubule dynamics in the growth cone of the anterior primary dendrite. Scale bar: 2 μm. (B) Kymographs of EBP-2::GFP in a growth cone of the anterior primary dendrite in wild-type (left), chdp-1(tm4947) (right) during mid to late L2 stage. Scale bar: 2 μm. (C) Quantification of the number of EBP-2::GFP comets either moving away from the cell body (anterograde) or towards the cell body (retrograde) in wild-type and chdp-1(tm4947) mutant animals. Error bars, SEM. ns: non-significant by one-way ANOVA with the Tukey correction. n = 10 worms for each genotype. (D) Quantification of the length of tracks of the EBP-2 comets in wild-type and chdp-1(tm4947) mutant animals. Error bars, SEM. Ns: non-significant by one-way ANOVA with the Tukey correction. n = 10 worms for each genotype. (E) Quantification of the growth duration of tracks of the EBP-2 comets in wild-type and chdp-1(tm4947) mutant animals. Error bars, SEM. ns: non-significant by one-way ANOVA with the Tukey correction. n = 10 worms for each genotype. (F) Quantification of MT pause frequency in wild-type and chdp-1(tm4947) mutant animals. Error bars, SEM. ns: non-significant by one-way ANOVA with the Tukey correction. n = 10 worms for each genotype. (G) Left: Confocal images of PVD (top) dendrites and (down) axon (left), RAB-3 (middle), overlay (right) in wild-type (upper), chdp-1(tm4947) mutant (lower). Right: A cartoon showing the localization of RAB-3 in PVD dendrites and axon in wild-type and chdp-1(tm4947) mutants. Scale bar: 10 μm.(TIFF)Click here for additional data file.
Loss of ced-10 does not phenocopy chdp-1 mutants in PVD dendrite development.
(A) Confocal images showing the PVD morphologies of wild-type, chdp-1(tm4947) and ced-10(n3246) mutant animals at 1DOA stage. Scale bar: 10 μm. (B-C) Quantification of (B) the number of 4o branches in a 100 μm area anterior to the PVD cell body, and (C) the ratio of the intensity in 2o branches to that of 1o dendrites for the genotypes indicated. Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–30 for each genotype. (D) Confocal images of PVD dendrites (left), ER (labeled using a mCherry::SP12 reporter) (middle), overlay (right) in ced-10(n3246) mutant. Arrows: ER in high-ordered branches. Scale bar: 20 μm. (E) Quantification of the number of 2° branches with ER invasion in wild-type, chdp-1(tm4947), ced-10(n3246) mutant in a 100 μm area anterior to the PVD cell body. Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–30 for each genotype.(TIFF)Click here for additional data file.
Loss of sax-1 restores the proprioceptive function of the PVD neurons in chdp-1 mutants.
(A) Confocal images showing the PVD dendrite morphology of wild-type, chdp-1(tm4947) and chdp-1(tm4947); sax-1(PVD KO) mutant animals at the 1-day-old adult stage. Scale bar: 20 μm. (B-C) Quantification of (B) the number of 2o, 3o and 4o branches, and (C) the ratio of the intensity of the 2o branches to that of the primary dendrites in wild-type, chdp-1(tm4947) and chdp-1(tm4947); sax-1(PVD KO) in the 100 μm area anterior to PVD cell body. Error bars, SEM. *p < 0.05, **p < 0.01, ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 20–40 for each genotype. (D) The representative moving tracks in wild-type, chdp-1(tm4947), sax-1(ky491) and chdp-1(tm4947); sax-1(ky491) mutants. Scale bar: 200 μm. (E-G) Quantification of the (E) body length, (F) amplitude and (G) wavelength of tracks in late L4 for the genotypes indicated. Error bars, SEM. ***p < 0.001 by one-way ANOVA with the Tukey correction. ns: non-significant. n = 10 worms for each genotype.(TIFF)Click here for additional data file.
Strains and plasmids used in this study.
(DOCX)Click here for additional data file.
Source data file for quantifications.
(XLSX)Click here for additional data file.4 May 2022Dear Dr Zou,Thank you very much for submitting your Research Article entitled 'CHDP-1-dependent cortical actin assembly is required for dendritic development and transport in C. elegans neurons' to PLOS Genetics.The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time.As you will see, reviewers have raised some concerns that can be addressed by clarifying the presentation, and others that may require further experimental work. Although some suggested approaches such as super-resolution microscopy may not be technically feasible, other experiments may be appropriate within the timeframe for a revision.Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsPlease be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.[LINK]We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.Yours sincerely,Andrew D. ChisholmAssociate EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS GeneticsReviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1: Review PGENETICS-D-22-00369 (Zao…. Wei Zou)Zhao et al. described the role of the cell cortex protein CHDP-1 in shaping the dendritic architecture of the C. elegans multidendritic neuron PVD. Through extensive genetic and imaging investigations, they showed that CHDP-1 controls the morphology of higher order PVD dendrites, promotes actin and microtubule assembly and facilitates the transport of the NLP-12 neuropeptide as well as organelles such as mitochondria and ER. All these likely translate into maintaining an intact PVD function for proprioception, as the chdp-1 mutant displays locomotion features of defective proprioception, including shallower and shorter waveforms in its sinusoidal movement. Interestingly, mutations in the sax-1 kinase gene suppressed the defects in PVD dendrite morphology, actin assembly and proprioceptive functions of the chdp-1 mutant, suggesting that SAX-1 antagonizes CHDP-1 functions. In general, the experiments were well planned and rigorously executed, and most of the results were convincing. Below I list a few concerns that the authors should address before the paper can be considered for publication in PLoS Genetics.Major comments:1. A key point in the paper is the localization of CHDP-1 to the cell cortex. However, the regular confocal microscopy used in Figure 4 is unlikely to provide the spatial resolution required to document CDHP-1 localization to the cell cortex. The authors should attempt STED super-resolution microscopy of GFP::CHDP-1 with an appropriate membrane marker such as myristoylated mCherry.2. Figure S3 should be included in the formal text as domain-function analysis is important for understanding the molecular functions of CHDP-1. Line 192-193: CHDP-1 lacking the CH domain shows punctate signals in the cytosol and CHDP-1 without the helix domain shows diffuse cytosolic distribution. These changes should be explicitly described and discussed in the Results.3. Line 149: The coverage index is a bit misleading, as it quantifies the length of the anterior primary dendrite, a phenotype that is distinct from that of the higher order dendrites described in Figures 1 and 2. It will be better to quantify the number of higher order dendrites in adulthood during the course of aging, as this is more coherent with the developmental phenotypes of the chdp-1 mutant. One could actually see that even in the wild type, the peripheral PVD dendrites deteriorate during aging, consistent with a prior report (Lezi et a., Neuron 2018).4. Line 202-203: The authors may want to briefly explain how NATF works to detect the endogenous expression pattern of CHDP-1. In Figure 5B, the fluorescent signals of GFP::CHDP-1 are diffuse in the PVD dendrites. One cannot conclude that CHDP-1 and moesinABD colocalize on the basis of such diffusely distributed signals, and I do not think this supports the statement that CHDP-1 is enriched in the growth cone. The seven consecutive GFP(11) modules attached to the CHDP-1 protein could be a source of technical concern. The authors should address this issue with alternative methods.5. Figure 5D and 5F: It seems to the reviewer that at L3, the dendrite growth cones in the wild type display extended palm-shaped morphology and undergo dynamic changes in their appearance, whereas those in the chdp-1 mutants are thin, pointed and less dynamic. The current quantification of the growth cone area does not highlight the dynamic nature of the growth cone morphology. Did the authors quantify the same 100 growth cones in respective genotypes? This is hard to imagine, as not all growth cones are present at any given time points during the recording: some are yet to appear while others are retracting. The authors need to provide more detailed account of their time-lapse imaging methods and characterize the dynamic nature of the dendrite growth cones.6. Line 235-238: The authors imply that NLP-12 is secreted from the peripheral PVD dendrites, which is quite unusual. They should also examine whether NLP-12::Venus in the PVD axon is also altered in the chdp-1 mutant. NLP-12::Venus puncta in the peripheral PVD dendrites are sparse (Figure 7A, 7B, 7D and 7E), with a mean density of one puncta per 100 um of dendrite length. This seems to be a pretty low number for something that is so important for proprioception and neuromuscular function. Figure 7C and 7D were poorly explained in the text. Please explain the design of the GBP assay and the interpretation of the data. In Figure 7D, does the “wild type” animal also express Pdpy-7::GBP::SAX-7, as in the sax-7 and chdp-1 mutants? The label of Pdpy-7::GBP::SAX-7 is inconsistent between 7D and 7E.7. Line 243-244: To show that NLP-12 dendritic transport is disrupted in the chdp-1 mutant, the authors should quantify NLP-12::Venus puncta in the primary PVD dendrite and/or measure NLP-12::Venus movement by kymograph analysis.8. It is unclear how CHDP-1, which the authors claim to be involved in the assembly of cortical actin near the cell membrane, is required for vesicle transport and trafficking, as actin species for this transport function is distinct from that underneath the cell cortex. The authors should offer some speculation.9. Figure 8: The data showed that both plus end-out and minus end-out microtubules (MTs) exist in the secondary PVD dendrites, based on the EBP-2 comet patterns. In the chdp-1 mutant, all EBP-2 comets were absent, raising an intriguing possibility that CHDP-1 is required for the assembly of both plus end-out and minus end-out MTs. Given that CHDP-1 is a cell cortex protein, how does it regulate the assembly of MTs, especially for MTs of opposite polarity? Although in Discussion (Line 343-344), the authors favored the model that CHDP-1 regulates MTs indirectly via actin assembly, there is no evidence for this. The authors may want to explore whether CHDP-1 is associated with the microtubule cytoskeleton.Minor comments:1. The Materials and Methods section should be significantly substantiated. Many experiments are inadequately explained, preventing the readers to grab essential details of the experiments. This is particularly evident with the split-GFP assay for cell-specific detection of CHDP-1 expression and the local neuropeptide secretion assays.2. Figure 1D: What is the orientation of the STED images of secondary dendrites here?3. The genotype label chdp-1(tm4947) in all the figures should be italicized. Please carefully check this.4. Line 129: Change chdp-1-/- to chdp-1(tm4947) throughout the paper, and indicate that tm4947 is a representative null, deletion allele where it first appears in the manuscript.5. Line 130-133, 137-140: There is no need to describe the quantitative results in numerical details, as these could be read from the respective figures directly. Please simplify tis and remove redundant descriptions throughout the paper.6. Figure 2A and 2F: Please show snapshots of time-lapse imaging that have both growing and retracting secondary dendrites. There are only growing dendrites in the current figure.7. Figure 6: The dendrite defects of the chdp-1 mutant are “relatively mild” compared to those in the dma-1 mutant. However, both display similar proprioceptive defects quantified by the amplitude and wavelength of the sinusoidal movements on the agar. The authors should offer some explanation.8. Line 234: Please change “why” to “how”. As scientists, we deal with HOW things happen rather than WHY they happen.9. Line 247: It is endoplasmic “reticulum”, not “reticulon”.10. Figure 7F: The signal of ER labeled by SP12 is continuous and diffuse in the primary, secondary and some of the tertiary PVD dendrites. I would have expected a puncta appearance, as other subcellular compartments in the neuronal process. Could the authors explain this peculiar pattern of dendritic ER or confirm it with another ER marker such as KDEL?11. Figure S5A: There seems to be a diffuse background GFP signal in addition to the more punctate DMA-1::GFP. It is not easy to appreciate the presence of the punctate signals. The authors need to provide their criteria of quantifying DMA-1::GFP vesicles. Please explain the exoc-8 genetic background in the main text.12. Line 303: The statement that SAX-1 is a negative regulator of actin assembly is based on its antagonism of CHDP-1. However, direct evidence in support of this conclusion is missing in the current study. The authors are suggested to tone it down or clearly indicate that this is a speculation.Reviewer #2: The manuscript by Zhao et al. describes the role for the calponin homology containing protein, CHDP-1 in dendritic morphogenesis of the nociceptive receptor neuron, PVD in C. elegans. CHDP-1 was previously shown by the authors to be associated with the CED-10/RAC-1 to regulate actin cytoskeleton in BDU & PLM neuron. In this study, they extend the functional analysis of CHDP-1 to PVD morphogenesis. Through a set of experiments, they show that CHDP-1 function is required for proper dendritic arborization. CHDP-1 function in the PVD to modulate actin assembly, distribution of organelles and microtubules and proprioception. The authors suggest that CHDP-1 regulates actin assembly which in turn affects the intracellular cytoskeleton and that this is necessary for the development, maintenance, and function of the PVD dendrites. This an interesting paper with several well executed experiments and adds a new player into the mix of components that is required for the dendritic patterning in the PVD.In general, I found the paper to be very dense with a lot of different experiments testing various hypotheses. Some of the data are strongly supported by the evidence provided by the authors however a few I find to be preliminary. It would be useful if the authors could distil the information in the main figures by only including the data that shows the strongest evidence. The main takeaway for me is that chdp-1 is involved in proper organization of the cytoskeleton and organelles in the higher order branches. This is a cell autonomous function and that this requires the CH and the helix within chdp-1. Lack of chdp-1is leads to dendrite degeneration and defective proprioception due to impaired branches. This function may not be through the ced-10 protein but is suppressed by the sax-1 kinase which can affect the actin protrusion dynamics arguing that chdp-1 is affecting an actin dependent process.Specific comments.1. Results for chdp-1 mutant effects on 2º branches are confusing. Figure 1B shows an increase of 2º branches in mutants of chdp-1 vs. WT. Representative images (Figure 1A), however, appear to show similar 2º branches in all three panels. It is that clear chdp-1 mutants affect the 2º, 3º & 4º branching dynamics/frequency based on the time lapse data. The strongest phenotype lies in the branching defects of higher order dendrites. Given the penetrance of that phenotype it, focusing on the 3º & 4º branching defects alone would be sufficient to do the functional analysis done with the CHDP-1 protein. Also, Figures 1D, E & F which shows the width of the primary dendrite is not adding much as it is difficult to know the exact parameters that is being measured as well as the reason for swelled 1º dendrite.2. In Fig5 the authors very nicely use a splitgfp system to visualize CHDP-1 exclusively in PVD. They also use mCherry:moesinABD as a growth cone marker and states that “GFP7x::CHDP-1 was enriched in the dendritic growth cones, and colocalized with the F-actin 205 probe mCherry::moesin actin binding domain (moesinABD)”. I am struggling to see the enrichment of CHDP-1 in the growth cones. From the images in Fig.5A it does look like the CHDP-1 is uniform. Would it be possible to use a different counter marker such as membrane to support that CHDP-1 is indeed enriched in growth cone? An alternate possibility is to look at the growth cones of 1º dendrite which are much larger in size and is also much more defined.Minor comments/suggestionFigures 1 & 2 could be combined and some of the data from figure 1 (STED & 2º branch quantification) could be moved to supplemental data section. The data in on higher order branching and the time lapses are clearly strong to support chdp-1 mutant phenotype. Also, it might be worth combining the dendritic regeneration and proprioception data as it is a functional consequence to the neuron.Reviewer #3: The manuscript by Zhao et al describes the function of CHDP-1 in PVD neuron development. The mutant shows some interesting phenotype: there are ectopic 2o and 3o dendrites, however, less 4o dendrite. The 4o dendrites are not abolished though like other F-actin cytoskeleton related mutants such as hpo-30, tiam-1, act-4, dma-1. The phenotype seems to be more specific to ectopic 2o branches emerging from the primary one. Although it is an interesting study and it can be published in PLOS-GENETICS. However, several questions remain in terms of how CHDP-1 regulates the cytoskeleton element in the PVD neuron.1) It is not clear how they conclude CHDP-1 affects cortical actin cytoskeleton specifically. It may affect cytosolic F-actin structures as well. It seems in general F-actin cytoskeleton is dim in the mutant dendrites.2) It is not clear whether CHDP-1 promotes assembly or disassembly of F-actin. Some photo-bleaching experiment followed by recovery could tell how F-actin dynamics is affected.3) Can it affect cross-linking of F-actin through non-muscle myosin? I think both drugs and mutants are available to test this4) It is also not clear how it affects microtubule cytoskeleton. The primary effect could be microtubule cytoskeleton as well.5) Related to this question: The ectopic 2o dendrites could be due to the over stabilization of microtubules. Or is it due to the instability of microtubules. Treating the mutant with colchicine or taxol might shed some light.6) Thickening of the primary dendrites could be a sign of abnormal microtubule cytoskeleton. Although according to the Supple Figure 6, authors conclude that EBP-2 tracks in primary dendrites are unaffected, I recommend to show a better kymograph from the mutant. It looks like there is some movement during imaging. I also suggest to look at the growth duration and length of these tracks in wild type and mutant. Also check the pause frequency. It might tell whether there is any effect on growth or depolymerization.7) Author may discuss the possibility that CHDP-1 can affect microtubule cytoskeleton directly in an unknown mechanism. Since it is not tested yet whether it associates with microtubule or not, this possibility always remains. Although I am not asking to do more experiments on this.8) Did they check the synaptic vesicles in the mutant dendrites? RAB-3 reporters?9) The connection with SAX-1 is also not clear. Activity or amount of SAX-1 might be upregulated in chdp-1 mutant? Is there any SAX-1 reporter available to test? If it is possible, it can be addressed.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #1: YesReviewer #2: NoneReviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: No4 Aug 2022Submitted filename: Response to the review comments.pdfClick here for additional data file.17 Aug 2022Dear Dr Zou,We are pleased to inform you that your manuscript entitled "The cell cortex-localized protein CHDP-1 is required for dendritic development and transport in C. elegans neurons" has been editorially accepted for publication in PLOS Genetics. Congratulations!Please note that Reviewer #1 has some minor suggestions (see below) that you can attend to as you prepare the final draft of your manuscript for the production team (the editorial team will not need to re-evaluate).Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!Yours sincerely,Andrew D. ChisholmAcademic EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS Geneticswww.plosgenetics.orgTwitter: @PLOSGenetics----------------------------------------------------Comments from the reviewers (if applicable):Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1: The authors had addressed my comments nicely with additional experiments and revision of the manuscript. The work is significantly improved after these revisions and could be considered for publication at PLoS Genetics. I have a few minor suggestions for the authors before they finalize the paper, as listed below.Figures 1C/2E/2H/3C/6G/7C: It will be more intuitive to present the ratio of myr-mCherry fluorescence or TBA-1 intensity between the primary and secondary branches as secondary/primary, which will make the values for the chdp-1 mutants lower than those for the wild type. The only such example is Fig.7E (LifeAct).Manuscript typos and errors: for example,Line 143: "were" should be "was"...Line 250/259: reference #27 seems to be "Tao et al.", not "Li et al."?Please carefully check the manuscript again and correct all these errors. In particular, panel labels for the supplemental figures should be specified, such as "S3A Fig".Reviewer #2: In the revised manuscript, the authors have satisfactorily addressed my concerns, and I recommend publication.Reviewer #3: The authors have addressed all my comments and it is significantly improved.I recommend publication.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #1: YesReviewer #2: No: This is not necessaryReviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: No----------------------------------------------------Data DepositionIf you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-22-00369R1More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.----------------------------------------------------Press QueriesIf you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.15 Sep 2022PGENETICS-D-22-00369R1The cell cortex-localized protein CHDP-1 is required for dendritic development and transport in C. elegans neuronsDear Dr Zou,We are pleased to inform you that your manuscript entitled "The cell cortex-localized protein CHDP-1 is required for dendritic development and transport in C. elegans neurons" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!With kind regards,Anita EstesPLOS GeneticsOn behalf of:The PLOS Genetics TeamCarlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdomplosgenetics@plos.org | +44 (0) 1223-442823plosgenetics.org | Twitter: @PLOSGenetics
Authors: Yehuda Salzberg; Carlos A Díaz-Balzac; Nelson J Ramirez-Suarez; Matthew Attreed; Eillen Tecle; Muriel Desbois; Zaven Kaprielian; Hannes E Bülow Journal: Cell Date: 2013-10-10 Impact factor: 41.582
Authors: Massimiliano Gaetani; Sara Mootien; Sandra Harper; Patrick G Gallagher; David W Speicher Journal: Blood Date: 2008-01-24 Impact factor: 22.113
Authors: Li Tao; Daniel Porto; Zhaoyu Li; Sylvia Fechner; Sol Ah Lee; Miriam B Goodman; X Z Shawn Xu; Hang Lu; Kang Shen Journal: Dev Cell Date: 2019-11-14 Impact factor: 13.417