| Literature DB >> 36120570 |
Huijiao Lv1, Tao Wang1, Shangkun Zhai1, Zhuocheng Hou1, Sirui Chen1.
Abstract
Osteoblasts are indispensable for skeletal growth and maintenance. Bone marrow-derived mesenchymal stem cells (BMSCs) are useful in studying osteogenesis. In this study, BMSCs isolated from White Leghorns were differentiated into osteoblasts in vitro. Cells induced for -1, 0, 1, 11, and 22 d were used for transcriptomic analyses using the HISAT2-Stringtie-DESeq2 pipeline. Weighted correlation network analysis was processed to investigate significant modules, including differentially expressed genes (DEGs), correlated with osteogenic differentiation. Gene ontology and pathway enrichment analyses of DEGs were performed to elucidate the mechanisms of osteoblast differentiation. A total of 534, 1,144, 1,077, and 337 DEGs were identified between cells induced for -1 and 0, 0 and 1, 1 and 11, and 11 and 22 d, respectively (|log2FC| > 1.0, FDR <0.05). DEGs were mainly enriched in pathways related to cell proliferation in the early stage of osteogenic differentiation and pathways, such as the TGF-β signaling pathway, in the middle and late stages of osteogenic differentiation. A protein-protein interaction network of the 87 DEGs in the MEturquoise module within top 5-%-degree value was built utilizing the STRING database. This study is the first to elucidate the transcriptomic changes in the osteogenic differentiation of BMSCs isolated from White Leghorns at different times. Our results provide insight into the dynamic transcriptome changes during BMSC differentiation into osteoblasts in chicken.Entities:
Keywords: RNA-seq transcriptome analysis; bone marrow mesenchymal stem cells; chicken; differentially expressed gene; osteoblastic differentiation
Year: 2022 PMID: 36120570 PMCID: PMC9478182 DOI: 10.3389/fcell.2022.940248
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
The primers for BMSCs identification.
| Genes | Primer sequences (5′–3′) | Product length (bp) | Tm (°C) |
|---|---|---|---|
| CD29 | F: GAACGGACAGATATGCAACGG | 300 | 62 |
| R: TAGAACCAGCAGTCACCAACG | |||
| CD44 | F: GGTTTTATAGTGGGGCATATTGTTATCCC | 700 | 62 |
| R: TTAACCGCGATGCACACGGC | |||
| CD71 | F: CCCAGGCTTCCCTTCGT | 310 | 55 |
| R: GGGCTCCAATCACAACATAC | |||
| CD45 | F: CACTGGGAATCGAGAGGAAA | 574 | 55 |
| R: CTGGTCTGGATGGCACTTTT | |||
| GAPDH | F: TAAAGGCGAGATGGTGAAAG | 244 | 58 |
| R: ACGCTCCTGGAAGATAGTGAT |
F, forward; R, reverse.
FIGURE 1Immunofluorescence staining (A) and RT-PCR (B) analysis of BMSC cell surface markers. (A) Immunofluorescence showing positive staining for CD29 and CD44, but negative for CD45. (B) RT-PCR assays showed that the expression of GADPH, CD29, CD44 and CD71 were positive, while the expression of CD45 was negative.
FIGURE 2(A) ALP staining and Alizarin Red staining of BMSC osteogenic induction. (B) Principal component analysis of BMSCs induced for -1, 0, 1, 11 and 22 d. (C) Statistics of the differentially expressed genes between adjacent induction groups.
FIGURE 3KEGG pathway analysis (p < 0.05) of DEGs between 0 and -1 (A), 1 and 0 (B), 11 and 1 (C), and 22 and 11 (D) d of osteogenic induction.
FIGURE 4Identification of modules associated with osteogenic differentiation in different induction stages. (A) Clustering dendrogram of DEGs in different osteogenic induction groups. As a result, 4 modules with different colors were constructed. (B) Module-trait association and the corresponding p-value with all the DEGs (listed in Supplementary Table S4) at different osteogenic induction time. (C) The mRNA variation tendency of genes RUNX2, SPP1 and BGLAP. Horizontal coordinate represents the induction time. The ordinate represents the changes of fragments per kilobase per million (FPKM). (D) Module-gene correlations and the corresponding p-value of genes RUNX2, SPP1 and BGLAP.
KEGG pathway analysis of genes at the different induction times and corresponding modules.
| Stage | KEGG pathway |
| Genes |
|---|---|---|---|
| DEGs at 0 d | DNA replication (gga03030) | 2.42E-08 | RFC3, RFC2, MCM3, MCM4, MCM5, MCM6, DNA2, POLE, MCM2 |
| Cell cycle (gga04110) | 1.15E-02 | RBL1, MCM3, MCM4, MCM5, TTK, MCM6, MCM2 | |
| Mismatch repair (gga03430) | 4.61E-02 | RFC3, EXO1, RFC2 | |
| Homologous recombination (gga03440) | 6.89E-02 | RAD51B, RAD52, RAD54L | |
| Retinol metabolism (gga00830) | 9.46E-02 | ALDH1A2, AOX2, RDH5 | |
| DEGs at 1 d | Cell cycle (gga04110) | 1.44E-12 | PCNA, PLK1, BUB1B, CDC7, CDC6, CCNB3, CCNA2, ORC5, CDC20, WEE1, CCNE2, ESPL1, ORC1, CHEK1, CDK2, E2F1, CDK1, BUB1, MAD2L1 |
| Steroid biosynthesis (gga00100) | 1.47E-08 | SQLE, NSDHL, CYP51A1, SC5D, MSMO1, DHCR24, LSS, FDFT1 | |
| Fanconi anemia pathway (gga03460) | 1.79E-08 | BLM, RAD51, EME1, RMI1, UBE2T, RPA2, FAAP24, FANCC, FANCB, BRCA2, FANCG | |
| Biosynthesis of antibiotics (gga01130) | 9.14E-06 | FDPS, MVK, ACAA2, CYP51A1, MSMO1, HMGCR, ENO1, LSS, ACAT2, SQLE, ACLY, NSDHL, SC5D, MVD, FDFT1 | |
| Oocyte meiosis (gga04114) | 5.04E-05 | CDC20, CCNE2, ESPL1, PLK1, CDK2, CDK1, FBXO5, BUB1, AURKA, MAD2L1 | |
| Homologous recombination (gga03440) | 1.02E-04 | BLM, RAD51, EME1, RPA2, BRCA2, RAD54B | |
| Terpenoid backbone biosynthesis (gga00900) | 6.45E-04 | FDPS, MVK, MVD, HMGCR, ACAT2 | |
| p53 signaling pathway (gga04115) | 1.13E-03 | CCNB3, RRM2, CCNE2, CHEK1, CDK2, CDK1, GTSE1 | |
| DNA replication (gga03030) | 2.58E-03 | PRIM2, FEN1, PCNA, LIG1, RPA2 | |
| Progesterone-mediated oocyte maturation (gga04914) | 3.29E-03 | CCNB3, CCNA2, PLK1, CDK2, CDK1, BUB1, MAD2L1 | |
| Metabolic pathways (gga01100) | 1.59E-02 | PRIM2, ACSS3, ACAA2, MVK, DGKB, MSMO1, HMGCR, ENO1, ACAT2, DGUOK, NSDHL, B3GALT2, LIPG, SC5D, TK1, FDFT1, FDPS, DUT, RRM2, MMAB, CYP51A1, ACSL5, DHCR24, LSS, DCK, DHFR, SQLE, ACLY, AMACR, P4HA2, MVD | |
| Pyrimidine metabolism (gga00240) | 2.62E-02 | PRIM2, DGUOK, DUT, RRM2, TK1, DCK | |
| Fatty acid metabolism (gga01212) | 5.45E-02 | FADS2, ACAA2, ACSL5, ACAT2 | |
| Mismatch repair (gga03430) | 5.77E-02 | PCNA, LIG1, RPA2 | |
| DEGs at 11 d | PPAR signaling pathway (gga03320) | 1.61E-03 | FABP3, SLC27A1, FABP5, FABP7, ADIPOQ, LPL, CD36, PLIN1, PLTP, ACSBG2 |
| MAPK signaling pathway (gga04010) | 2.11E-02 | DUSP4, DUSP5, NTRK2, CACNA2D2, PDGFA, FOS, NGF, FGF1, RASGRP1, TGFBR2, RASGRP3, FGF7, PAK1, CACNB4, FGF9, FGFR3, CACNG3, FGF10 | |
| ECM-receptor interaction (gga04512) | 2.11E-02 | LAMA5, VTN, VWF, COL4A2, COL4A1, COL6A2, COL6A1, ITGA8, CD36 | |
| Neuroactive ligand-receptor interaction (gga04080) | 2.20E-02 | GRIA1, CHRNB2, GABRB2, UTS2R, GCGR, CHRNA7, PTGER3, HTR1A, HTR1B, ADRB2, LPAR4, OPRM1, SSTR2, ADRA2C, GRIN3B, GRIN3A, HTR7, BDKRB2, F2RL1, BDKRB1, S1PR3 | |
| Steroid biosynthesis (gga00100) | 4.37E-02 | SOAT1, DHCR7, HSD17B7, LIPA | |
| TGF-β signaling pathway (gga04350) | 5.96E-02 | BMP4, CDKN2B, BMP2, ID1, ID4, NOG2, ACVR2B, TGFBR2 | |
| Cell adhesion molecules (CAMs) (gga04514) | 7.21E-02 | NLGN3, CNTNAP1, ALCAM, NRXN1, SDC3, ITGA8, NRXN3, PTPRM, NCAM1, NRCAM | |
| Calcium signaling pathway (gga04020) | 7.83E-02 | RYR2, CHRNA7, PTGER3, ADRB2, RYR3, HTR7, ERBB4, CAMK4, BDKRB2, PPIF, PLCG2, BDKRB1, SLC25A4 | |
| DEGs at 22 d | TGF-β signaling pathway (gga04350) | 8.25E-04 | TGIF1, BMP2, BMPR2, ID1, ID3, ACVR2B, TGFBR2 |
| MAPK signaling pathway (gga04010) | 4.33E-03 | PDGFRB, PDGFRA, DUSP5, JUN, PAK1, DUSP1, IL1R1, FOS, DUSP8, TGFBR2 | |
| PPAR signaling pathway (gga03320) | 1.20E-02 | FABP5, APOA1, ANGPTL4, CD36, PLIN1 | |
| Cytokine-cytokine receptor interaction (gga04060) | 2.30E-02 | IL6, BMPR2, CXCL12, IL1R1, ACVR2B, CX3CL1, TGFBR2 | |
| Wnt signaling pathway (gga04310) | 3.42E-02 | WNT6, JUN, MMP7, WNT5B, WNT9A, LRP6 | |
| Focal adhesion (gga04510) | 6.02E-02 | PDGFRB, PDGFRA, JUN, PAK1, COL4A2, BCL2, ITGA9 | |
| ECM-receptor interaction (gga04512) | 9.95E-02 | COL4A2, CD36, GP5, ITGA9 |
FIGURE 5Protein–protein interaction network with DEGs in MEturquoise module within the top 5-%-degree value (Supplementary Table S6).