| Literature DB >> 36120562 |
Kai Liu1,2,3, Wenhao Ju2,3,4, Shengrong Ouyang2,3, Zhuo Liu2,3, Feng He2,3, Jingyi Hao5, Hongyan Guan2,3, Jianxin Wu1,2,3,4,5.
Abstract
Heart failure with preserved ejection fraction (HFpEF) shows complicated and not clearly defined etiology and pathogenesis. Although no pharmacotherapeutics have improved the survival rate in HFpEF, exercise training has become an efficient intervention to improve functional outcomes. Here, we investigated N6-methyladenosine (m6A) RNA methylation modification in a "two-hit" mouse model with HFpEF and HFpEF with exercise (HFpEF + EXT). The manner of m6A in HFpEF and HFpEF + EXT hearts was explored via m6A-specific methylated RNA immunoprecipitation followed by high-throughput and RNA sequencing methods. A total amount of 3992 novel m6A peaks were spotted in HFpEF + EXT, and 426 differently methylated sites, including 371 hypermethylated and 55 hypomethylated m6A sites, were singled out for further analysis (fold change >2, p < 0.05). According to gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses, unique m6A-modified transcripts in HFpEF + EXT were associated with apoptosis-related pathway and myocardial energy metabolism. HFpEF + EXT had higher total m6A levels and downregulated fat mass and obesity-related (FTO) protein levels. Overexpression of FTO cancels out the benefits of exercise in HFpEF + EXT mice by promoting myocyte apoptosis, myocardial fibrosis and myocyte hypertrophy. Totally, m6A is a significant alternation of epitranscriptomic processes, which is also a potentially meaningful therapeutic target.Entities:
Keywords: FTO; HFPEF; apoptosis; m6A; myocardial energy metabolism
Year: 2022 PMID: 36120562 PMCID: PMC9478036 DOI: 10.3389/fcell.2022.954769
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
The gene-specific SELECT-PCR primers used were as follows.
| Gene | Forward and reverse primer |
|---|---|
| Fas_ | tagccagtaccgtagtgcgtgACAGCCCAGATCCACAGCATG |
| 5phos/CTGCAGCAAGGGAAAACAGCcagaggctgagtcgctgcat | |
| Capn2 | tagccagtaccgtagtgcgtgCCCCTCGGCCGCTTCGCGG |
| 5phos/CCTTGGCCAGCTTTATCGCGATGCcagaggctgagtcgctgcat | |
| Casp12 | tagccagtaccgtagtgcgtgGTCATCAAAAACCCCATCCAGCATG |
| 5phos/CCTTGGCCAAACCTTTGATCTcagaggctgagtcgctgcat | |
| Mef2a | tagccagtaccgtagtgcgtgGCTGCTGGAGCTGCTCAGACTG |
| 5phos/CCACAGGGGAGCGCCCCcagaggctgagtcgctgcat | |
| Casp7 | tagccagtaccgtagtgcgtgGAGCCTGGCTCCAATCACCATAG |
| 5phos/CCATGGTTCTAGTCTCTAGAAGGCTGCcagaggctgagtcgctgcat | |
| Jun | tagccagtaccgtagtgcgtgCCCGGCCACTTGTTACCGG |
| 5phos/CCTCTGGGTCAGGAAAGTTGCTGcagaggctgagtcgctgcat | |
| Pdia3 | tagccagtaccgtagtgcgtgTGGTTTTGCCTTCTCTGGTGTAAGAG |
| 5phos/CCTTTTATAAAGTGGTGCATTTGGCTcagaggctgagtcgctgcat | |
| Tnnt2 | tagccagtaccgtagtgcgtgGACTGCACACAGGTCTTGAGGTATCTG |
| 5phos/TCAGCCTCAGCAGGGACTGGCcagaggctgagtcgctgcat | |
| Adrb1 | tagccagtaccgtagtgcgtgCGTCCAGGCTCGAATCGCTG |
| 5phos/CCACAGTGGTTGTCCCGCCTcagaggctgagtcgctgcat | |
| Agtr1a | tagccagtaccgtagtgcgtgGTCCTTTGGTCGTGAGCCATTTAG |
| 5phos/CCGATGCTGCCCTGGTTTCTcagaggctgagtcgctgcat |
The gene-specific PCR primers used were as follows.
| Gene | Forward and reverse primer |
|---|---|
| Fas | F: 5′-AACATGGAACCCTTGAGCCA-3′ |
| R:5′ AGGCGATTTCTGGGACTTTGT 3′ | |
| Caspase-12 | F:5′ -TGCGAGTTTCATCCTGAACAAGGCTG 3′ |
| R:5′ -AACACCAGGAATGTGCTGTCTGAGGACT 3′ | |
| Mef2a | F:5′ GGTGGTGGCAGTCTTG 3′ |
| R:5′ TATCCTTTGGGCATTCA 3′ | |
| Jun | F:5′ CGCACGCTCCTAAACAAACT 3′ |
| R:5′ GTCATAGAACGGTCCGTCACTT 3′ | |
| Tnnt2 | F:5′ GCCCACATGCCTGCTT 3′ |
| R:5′ CACCTCCTCGGCGTCA 3′ | |
| Agtr1a | F:5′ CTGAGGTGGAGTGACAGGTT 3′ |
| R:5′ TTTGGTCGTGAGCCATTTA 3′ |
FIGURE 1Exercise training reverses HFpEF phenotypes by suppressing myocardial fibrosis and improving cardiac dysfunction with the changes in global m6A levels. (A) Gross morphology of hearts stained with HE, cardiac fibrosis stained with Masson, and cardiomyocyte area stained with wheat germ agglutinin (WGA). Scale bar = 1 mm with HE, 100 μm with Masson, and 50 μm with WGA. (B) Proportion of heart weight to tibia length (n = 6 mice per group). (C) Quantitative analysis of cardiac fibrosis (n = 6 mice per group). (D) Representative M-mode echocardiography images. (E) Left ventricular ejection fraction (LVEF) (n = 6 mice per group). (F) Quantitative analysis of cardiomyocyte area (n = 6 mice per group). (G,H) Representative Doppler echocardiography images and E/E′ ratio (n = 6 mice per group). (I) Ratio of lung weight to tibia length (n = 6 mice per group). (J) Running distance during exercise exhaustion test (n = 6 mice per group). (K,L) Representative dot blot showing global m6A modification levels in hearts and methylene blue (MB) staining and quantification of global m6A modification levels (n = 3 mice per group). Data are mean ± SEM, with all individual data points plotted. Two-way ANOVA and Tukey’s multiple comparison test were used. Numbers above square brackets show significant p values.
FIGURE 2Exercise training demonstrates differential m6A modification patterns in HFpEF mouse hearts. (A,B) Summary of genes with identified m6A modification present at m6A-seq. (C) Sequence logo standing for the consensus motif identified by Discriminative Regular Expression Motif Elicitation in the two groups.(D) Distribution of N6-methyladenosine peaks across the length of mRNAs in two groups.(E) Venn diagram showing distribution of m6A peaks in the indicated regions in HFpEF and HFpEF + EXT groups.(F) Identification of 371 hypermethylated and 55 hypomethylated m6A peaks.(G) N6-methyladenosine abundance in Fas and Plpp1 mRNA transcripts in HFpEF and HFpEF + EXT samples (H,I) The top 10 enriched pathways terms from MeRIR-seq for upregulated and downregulated m6A peaks. Leukocyte transendothelial mig-: Leukocyte transendothelial migration.
FIGURE 3Combined analysis of RNA-seq and MeRIP-seq data comparing HFpEF with HFpEF + EXT heart samples. (A) FPKM distribution of two groups. (B) Volcano plots showing different expression mRNAs between HFpEF and HFpEF + RE samples (fold change >2 and p < 0.05). (C) Clustering analysis of differentially expressed mRNAs. (D,E) The top 10 enriched KEGG pathways of differentially mRNA for upregulated and downregulated mRNA. (F) The distribution of transcripts with significantly changed in m6A-modification level and corresponding mRNA expression (p < 0.05) by four-quadrant graph. Red dots represent significant differences in RNA expression and m6A modification, and gray dots do not meet the conditions.
FIGURE 4Identification of the downstream target genes and mechanisms of exercise improvement of HFpEF. (A) Single-base elongation and ligation-based qPCR amplification method (SELECT) validation of m6A level changes of ten related genes. (B) The relative mRNA levels of six genes determined by real-time PCR in HFpEF and HFpEF + EXT samples. n = 3 mice per group. Data are presented as mean ± SEM. Multiple unpaired t tests were used. (C,D) Representative images of TUNEL and TEM and quantitative analysis of TUNEL-positive cells. n = 3 mice per group. Data are presented as mean ± SEM. Two-way ANOVA and Tukey’s multiple comparison test were used. Numbers above square brackets display great p values.
The ranking of the top 10 genes in each quadrant graph.
| Gene name | Pattern | Chromosome | m6A level change | mRNA level change | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Peak region | Peak start | Peak end | fold_enrchment | diff. lg. p | Strand | log2FC |
| |||
| Casp12 | Hyper-down | 9 | CDS | 5345459 | 5346656 | 1.72 | −9.81 | + | −1.27477 | 0.000628688 |
| Capn2 | Hyper-down | 1 | five_prime_utr | 182517278 | 182517608 | 22.6 | −6.37 | − | −0.30561 | 0.032386574 |
| Fas | Hyper-down | 19 | CDS | 34290658 | 34309091 | 1.79 | −17.3 | + | −1.03262 | 0.002731876 |
| Casp7 | Hypo-down | 19 | three_prime_utr | 56441600 | 56441809 | 3.37 | −2.04 | + | −0.53649 | 0.022176301 |
| Jun | Hypo-down | 4 | CDS | 95049867 | 95052222 | 34.9 | −1.45 | − | −0.98579 | 5.99E-08 |
| Pdia3 | Hypo-down | 2 | three_prime_utr | 121435993 | 121437910 | 3.93 | −4.47 | + | −0.50359 | 0.005265144 |
| Tnnt2 | Hyper-up | 1 | exon | 135836353 | 135836534 | 2.41 | −8.85 | + | 0.730282 | 0.001676025 |
| Mef2a | Hyper-up | 7 | five_prime_utr | 67349856 | 67372858 | 2.8 | −5.61 | − | 0.439723 | 0.005269679 |
| Adrb1 | Hypo-up | 19 | CDS | 56723142 | 56724091 | 72.7 | −5.32 | + | 0.530445 | 0.01782968 |
| Agtr1a | Hypo-up | 13 | CDS | 30381099 | 30382388 | 14.5 | −1.97 | + | 0.5337 | 0.033615285 |
FIGURE 5FTO is Downregulated in HFpEF + EXT compared to HFpEF. (A–E) Representative Western blots plots of FTO, Mettl3, ALKBH5 and Mettl14, and quantitative analysis of FTO/GAPDH, Mettl3/GAPDH protein, ALKBH5/GAPDH and Mettl14/GAPDH expressions. n = 3 per group. Data are presented as mean ± SEM. Two-way ANOVA and Tukey’s multiple comparison test were used. Numbers above square brackets show significant p values.
FIGURE 6Overexpression of FTO cancels out the benefits of exercise in HFpEF + EXT mice. (A) Gross morphology of hearts stained with Masson, WGA, TUNEL, TEM, and Doppler echocardiography from HFpEF, HFpEF + EXT and HFpEF + EXT + AAV9 mice. (B) Quantitative analysis of interstitial fibrosis (n = 6 mice per group). (C) Quantitative analysis of cardiomyocyte cross-sectional area (n = 6 mice per group). (D) Quantitative analysis of TUNEL-positive cells (n = 3 per group). (E) Quantitative analysis of E/E′ ratio (n = 6 mice per group). (F) Ratio of lung weight to tibia length (n = 6 mice per group). (G) Running distance during exercise exhaustion test (n = 6 mice per group). (H) The relative mRNA levels of six genes determined by real-time PCR in HFpEF, HFpEF + EXT and HFpEF + EXT + AAV9 mice (n = 3 mice per group). Data are presented as mean ± SEM. One-way ANOVA and Tukey’s multiple comparison test were used. Numbers above square brackets show significant p values.