| Literature DB >> 36120358 |
Qianqian Luo1, Yuanyi Ling1,2, Yufei Li1, Xiaoqin Qu1, Qiaoqing Shi1, Shuangyan Zheng3, Yanhong Li4, Yonghong Huang1,5, Xiaoyan Zhou1,5.
Abstract
Liver fibrosis is a pathological process which can progress to hepatocirrhosis, even hepatocellular carcinoma. Phosphatidylethanolamine-binding protein 4 (PEBP4) is a secreted protein involved in regulating many molecular pathways, whereas its roles in diseases including hepatic fibrosis remain undefined. The nuclear factor-κappa B (NF-κB) signaling pathway has been found to be involved in the development of liver fibrosis. In this study, we generated a hepatocyte-conditional knockout (CKO) mouse model of PEBP4, and explored the potential functions of PEBP4 on liver fibrosis and the NF-κB signaling pathway in a mouse model of carbon tetrachloride (CCl4)-induced liver fibrosis. We demonstrated that PEBP4 CKO aggravated CCl4-triggered liver fibrosis, as evidenced by altered histopathology, an increase in the activities of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and hydroxyproline (HYP) levels, and more collagen deposition, as well as by enhanced expression of fibrotic markers including α-smooth muscle actin (α-SMA), collagen I and collagen III. Mechanistically, PEBP4 deficiency activated the NF-κB signaling pathway, as indicated by increased phosphorylation of NF-κB p65 and inhibitor protein κB inhibitor-α (IκB-α), and nuclear NF-κB p65 expression in the fibrotic liver. Notably, the NF-κB inhibitor pyrrolidine dithiocarbamate (PDTC) partially blocked the activation of the NF-κB pathway, and reversed the pro-fibrotic effect of PEBP4 deletion in CCl4-treated mice. Together, these results suggest that PEBP4 deficiency results in aggravation of liver fibrosis and activation of the NF-κB signaling pathway, supporting a novel concept that PEBP4 is a crucial player in hepatic fibrosis, but also might be a negative regulator of the NF-κB signaling in liver fibrosis.Entities:
Keywords: NF-κB; PEBP4; liver fibrosis; mouse model; signaling pathway
Year: 2022 PMID: 36120358 PMCID: PMC9478609 DOI: 10.3389/fphar.2022.964829
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
Sequence used for PCR.
|
|
|
|
|
|---|---|---|---|
| P1 | loxP F | GATCCTGGAGCTACTGAAAGCACTGAG | flox = 251 bp |
| loxP R | GCTATTTACACCACCATGCCCTGC | WT = 188 bp | |
| P2 | Alb-Cre F | GAAGCAGAAGCTTAGGAAGATGG | Alb-Cre = 390 bp |
| Alb-Cre R | TTGGCCCCTTACCATAACTG | ||
| P3 | PEBP4 del-F | GATCCTGGAGCTACTGAAAGCACTGAG | PEBP4 KO = 277 bp |
| PEBP4 del-R | ACAACCAGAAGGATGAAATCGGAAAC | ||
| P4 | GAPDH F | TGGATTTGGACGCATTGGTC | GAPDH = 251 bp |
| GAPDH R | TTTGCACTGGTACGTGTTGAT |
FIGURE 1Construction and identification of PEBP4 hepatocyte-conditional knockout (CKO) mice. (A) Western blotting demonstrated that PEBP4 was downregulated in the liver tissue of WT CCl4 mice compared with the WT control mice. GAPDH was used as a loading control. (B) Schematic diagram of PEBP4 CKO mice (PEBP4 , Alb-Cre mice) construction using the breeding technique. (C) Genotyping of mice by PCR analysis. The loxP sites (lane 1), the Alb-Cre transgene (lane 2), and PEBP4 allele (lane 3) of tail DNA and liver DNA were detected. (D) The loxP sites (lane 1) and PEBP4 allele (lane 2) in different tissues of WT and CKO mice were detected by PCR and agarose gel electrophoresis. (E) PEBP4 protein expression in different tissues of WT and CKO mice was detected by western blotting. Data are expressed as mean ± SD. *p < 0.05 vs. WT mice in the control group (Student’s t-test).
FIGURE 2PEPB4 CKO aggravates CCl4-induced liver fibrosis. (A) Histological changes of liver tissues by HE staining (×200 magnification). (B) Collagen deposition of liver tissues by Masson staining (×100 magnification) and its quantitative analysis. Arrowhead indicates accumulated collagen. (C) The AST and ALT activities in the serum of mice (n = 6). (D) The HYP activity in the serum of mice (n = 6). (E) The protein expression of α-SMA was detected by western blotting (n = 3). (F) The protein expressions of collagen I and collagen III were detected by western blotting (n = 3). Data are expressed as mean ± SD. *p < 0.05, **p < 0.01 and ***p < 0.001 vs. the WT control group. ## p < 0.01 and ### p < 0.001 vs. the CKO control group. Δ P < 0.05 and ΔΔ P < 0.01 vs. the WT CCl4 group. NS, p > 0.05 not significant (ANOVA Test).
FIGURE 3PEBP4 knockout activates NF-κB pathway. Protein expressions of nuclear NF-κB p65, p-NF-κB p65 and p-IκB-α were measured by western blotting, and Lamin B1 and GAPDH were applied as internal references of the nuclear and total protein. Data are expressed as mean ± SD. **p < 0.01 and ***p < 0.001 vs. the WT control group. ## p < 0.01 and ### p < 0.001 vs. the CKO control group. Δ P < 0.05 and ΔΔ P < 0.01 vs. the WT CCl4 group (ANOVA Test).
FIGURE 4PDTC partially reverses the effects induced by PEBP4 knockout. (A) Histological changes of liver tissues by HE staining (×200 magnification). (B) Collagen deposition of liver tissues by Masson staining (×100 magnification) and its quantitative analysis. Arrowhead indicates accumulated collagen. (C) The AST and ALT activities in the serum of mice (n = 6). (D) The HYP activity in the serum of mice (n = 6). (E) The protein expression of α-SMA was detected by western blotting (n = 3). (F) The protein expressions of collagen I and collagen III were detected by western blotting (n = 3). Data are expressed as mean ± SD. Δ P < 0.05, ΔΔ P < 0.01 and ΔΔΔ P < 0.001 vs. the WT CCl4 group. && p < 0.01 and &&& p < 0.001 vs. the CKO CCl4 group. ▲ p < 0.05 vs. the WT CCl4+PDTC group (ANOVA Test).
FIGURE 5Effects of PDTC on the NF-κB pathway in liver fibrosis. Protein expressions of nuclear NF-κB p65, p-NF-κB p65 and p-IκB-α were measured by western blotting. Data are expressed as mean ± SD. Δ P < 0.05 and ΔΔ P < 0.01 vs. the WT CCl4 group. && p < 0.01 vs. the CKO CCl4 group. ▲ p < 0.05 vs. the WT CCl4+PDTC group (ANOVA Test).