Literature DB >> 36119014

Penicillium sp. YJM-2013 induces ginsenosides biosynthesis in Panax ginseng adventitious roots by inducing plant resistance responses.

Shi-Hui Wang1, Wen-Xia Liang1, Jun Lu2,3, Lu Yao2,3, Juan Wang2,3, Wen-Yuan Gao2,3.   

Abstract

Objective: Fusarium oxysporum is a common pathogenic fungus in ginseng cultivation. Both pathogens and antagonistic fungi have been reported to induce plant resistance responses, thereby promoting the accumulation of secondary metabolites. The purpose of this experiment is to compare the advantages of one of the two fungi, in order to screen out more effective elicitors. The mechanism of fungal elicitor-induced plant resistance response is supplemented.
Methods: A gradient dilution and the dural culture were carried out to screen strains. The test strain was identified by morphology and 18 s rDNA. The effect of different concentrations (0, 50, 100, 200, 400 mg/L) of Penicillium sp. YJM-2013 and F. oxysporum on fresh weight and ginsenosides accumulation were tested. Signal molecules transduction, expression of transcription factors and functional genes were investigated to study the induction mechanism of fungal elicitors.
Results: Antagonistic fungi of F. oxysporum was identified as Penicillium sp. YJM-2013, which reduced root biomass. The total ginsenosides content of Panax ginseng adventitious roots reached the maximum (48.95 ± 0.97 mg/g) treated with Penicillium sp. YJM-2013 at 200 mg/L, higher than control by 2.59-fold, in which protopanoxadiol-type ginsenosides (PPD) were increased by 4.57 times. Moreover, Penicillium sp. YJM-2013 activated defense signaling molecules, up-regulated the expression of PgWRKY 1, 2, 3, 5, 7, 9 and functional genes in ginsenosides synthesis.
Conclusion: Compared with the pathogenic fungi F. oxysporum, antagonistic fungi Penicillium sp. YJM-2013 was more conducive to the accumulation of ginsenosides in P. ginseng adventitious roots. Penicillium sp. YJM-2013 promoted the accumulation of ginsenosides by intensifying the generation of signal molecules, activating the expression of transcription factors and functional genes.
© 2020 Tianjin Press of Chinese Herbal Medicines. Published by ELSEVIER B.V.

Entities:  

Keywords:  HPLC-ESI-MSn; Panax ginseng C. A. Meyer; antagonistic fungi; functional genes; fungi elicitors; ginsenosides biosynthesis; signal molecules; transcription factors

Year:  2020        PMID: 36119014      PMCID: PMC9476754          DOI: 10.1016/j.chmed.2020.02.003

Source DB:  PubMed          Journal:  Chin Herb Med        ISSN: 1674-6384


Introduction

Panax ginseng C. A. Meyer, belonging to the Araliaceae family, is one of the rare traditional Chinese medicines. P. ginseng is widely used in the field of food and medicine because of its anti-tumor, anti-aging and anti-fatigue properties (Lee et al., 2006, Lee et al., 2007). These active ingredients are mainly attributed to ginsenosides, which are structured into three groups, Rb, Rg and Ro groups (Cordell, 2001). At present, the endangered wild ginseng, ginseng field cultivation is the main source, however, the longer cultivation of P. ginseng growth cycle suffer the harm of environmental pollution and diseases and pests and old P. ginseng soil erosion damage ecological environment problems such as difficult to solve, and tissue culture has the advantages of short growth period which is not affected by the external environment, therefore, we can partially solve the problem of resource and production of medicinal active ingredients of P. ginseng through plant tissue culture technology. However, compared with the roots of mother plants, active compounds in tissue culture are often lower (Jung et al., 2014). Elicitors, especially fungal elicitors, are demonstrated to be a useful tool to promote the synthesis of secondary metabolites in medical plants. There is pervasive application of fungal elicitors to enhance the yields of these valuable metabolites from tissue of numerous plant species, including Isatis tinctoria L. (woad) (Jiao et al., 2018), Withania somnifera (Ahlawat, Saxena, Ali, Khan, & Abdin, 2017), Astragalus membranaceus (Gai et al., 2017) etc. Similarly, fungal elicitors are also be used in P. ginseng (Le, Im, Paek, & Park, 2018), Panax quinquefolius, and Panax sikkimensis (Ban) to promote the production of ginsenosides. With the fungal elicitors’ identification by the receptors of the plant cells, the signal molecules were also be activated, such as the presence of Ca2+ ion fluxes, activation of phospholipase A2 (PLA2) and protein kinase (Zhao, Davis, & Verpoorte, 2005) etc. Then, this series of messages trigger the formation of endogenous signaling molecules including nitric oxide (NO), ethylene (ET), abscisic acid (ABA) in NO, ET, jasmonic acid (JA) and salicylic acid (SA) signaling pathway. Then, all kinds of signals are integrated into DNA transcription factors, which eventually activate key genes expression and trigger metabolic pathways of secondary metabolites (Aharoni & Galili, 2011). A schematic illustration of the sequential signaling pathways activated in elicited ginseng were listed in Fig. 1. WRKY proteins as transcription factors, play vibrant roles in many plant growth process, including resistance responses to external stress, as well as metabolism of active ingredients.
Fig. 1

A schematic illustration of sequential signaling pathways activated in elicited ginseng (Rahimi, Kim, & Yang, 2015). Enzymes were marked in green box. The signal molecules were shown in red. ABA: abscisic acid, ACC: 1-aminocyclopropane-1-carboxylic acid, ACS: 1-aminocyclopropane-1-carboxylic acid synthase, ACO 1-aminocyclopropane-1-carboxylic acid, NO: nitric oxide, NOS: nitric oxide synthase, O2−: superoxide radical, H2O2: hydrogen peroxide, ROS: reactive oxygen species, SOD: superoxide dismutase, PLA: phospholipase, PAL: phenylalnine ammonialyase, TFs: transcription factors.

A schematic illustration of sequential signaling pathways activated in elicited ginseng (Rahimi, Kim, & Yang, 2015). Enzymes were marked in green box. The signal molecules were shown in red. ABA: abscisic acid, ACC: 1-aminocyclopropane-1-carboxylic acid, ACS: 1-aminocyclopropane-1-carboxylic acid synthase, ACO 1-aminocyclopropane-1-carboxylic acid, NO: nitric oxide, NOS: nitric oxide synthase, O2−: superoxide radical, H2O2: hydrogen peroxide, ROS: reactive oxygen species, SOD: superoxide dismutase, PLA: phospholipase, PAL: phenylalnine ammonialyase, TFs: transcription factors. Among the current application of fungal elicitor, like endophytic fungal microorganisms that colonize healthy plant tissue, or pathogenic fungi that cause plant disease are reported to be used as elicitors to stimulate the accumulation of ginsenosides (Yu et al., 2016), pytethrin (Khan et al., 2016), vindoline (Pandey et al., 2016), asiaticoside (Jisha, Gouri, Anith, & Sabu, 2018), gymnemic acid (Netala, Kotakadi, Gaddam, Ghosh, & Tartte, 2016) etc. However, few reports have described that antagonistic fungi which was resistant to pathogens could be used as elicitors to increase the content of ginsenosides. Antagonistic fungi, known as biocontrol fungi, refers to the various microorganisms that are beneficial to the prevention of plant diseases. It is reported that biocontrol fungi can balance endogenous hormones in plants (Viterbo, Landau, Kim, Chernin, & Chet, 2010), increase the activity of host defense enzymes, induce the expression of plant disease-related protein (Chen, Harman, Comis, & Cheng, 2005), and even improve the level of plant secondary metabolites (Ponce, Scervino, Erra-Balsells, Ocampo, & Godeas, 2004). Since the elicitors promote the synthesis of secondary metabolites by plants self-defense reaction (Zhang et al., 2015), we try to use the biocontrol fungi as an inducer to study the accumulation of secondary metabolites in the adventitious roots of ginseng. Hence, we compared the effect of pathogen F. oxysporum and its antagonistic fungi on accumulation of biomass and ginsenosides. Moreover, the production of signal molecules, expression of PgWRKY family and functional genes were also be evaluated to comprehend the signal transduction underlying elicitation. Also, ginsenoside composition were detected by HPLC-ESI-MSn after fungal elicitor treatment.

Materials and methods

Separating and screening of antagonistic fungi in P. notoginseng rhizosphere soil

P. notoginseng rhizosphere soil samples were collected from Guishan town, Shilin county, Kunming city (103032′ 35″ E, 1972 m ± 3.00 m, 24040′9″ N), China. A gradient dilution method was used to screen the colony of soil (Fan et al., 2016). Antagonistic F. oxysporum screening experiments was carried out by using the dural culture method (Chen et al., 2016). F. oxysporum A549 was provided by Tianjin University of Science and Technology.

Morphological identification and 18 s rDNA identification

The activated strain was inoculated on PDA medium, and cultured at 28 °C for 6–7 d, and its morphology was observed. The genomic DNA was extracted by Ezup Column Fungi Genomic DNA Purification Kit (Sangon Biotech, China) and 18S ribosomal RNA (rRNA) genes were amplified by PCR using the primers ITS1 and ITS4. The PCR cycling protocol included an initial denaturation at 94 °C for 4 min, followed by 32 cycles of 94 °C for 1 min, 56 °C for 1 min and 72 °C for 1 min, and a final elongation step of 72 °C for 10 min. PCR products were visualized on 1% agarose gels, which were then excised and purified with Nucleo-pore PCR Clean-up Gel Extraction kit (Genetix Biotech Asia Pvt. Ltd., India). DNA sequencing was performed by GENEWIZ, Inc (Suzhou, China) and sequence similarities were determined by NCBI BLAST search ().

Adventitious root culture

The ginseng adventitious roots were cultured in the 3/4 MS liquid medium supplement with 5.0 mg/L IBA, 0.1 mg/L KT and 4% sucrose (pH 5.8 ± 0.2). The medium was autoclaved for 25 min at 121 °C. The fresh adventitious roots of 1 g were inoculated into a 100 mL Erlenmeyer flask on a rotary shaker (130 rpm) at 25 °C in dark. After 35 d of cultivation, adventitious roots were harvested.

Preparation of elicitor

Penicillium sp. YJM-2013 and F. oxysporum were used in this study. They were cultivated and inoculated on PDA liquid medium for 7 d in dark at 28 °C and 150 rpm. Firstly, their mycelium was harvested and dried in drying oven at 50 °C for 48 h. Secondarily, the dry mycelium was ground to powder and dissolved in distilled water, and the concentration of this solution was 10 g/L. Finally, they were sterilized at 121 °C for 25 min, and the sterilized powder were used for the induction experiment. The elicitor concentration was determined by its carbohydrate content and the content was measured by Anthrone-sulfuric acid assay.

Elicitation treatment

Different concentrations (0, 50, 100, 200, and 400 mg/L) of Penicillium sp. YJM-2013 and F. oxysporum were appended to the 30-day-old P. ginseng adventitious roots. And after 5 d of elicitor treatment, the adventitious roots were harvested. The fresh weight and the content of ginsenosides were then analyzed. After obtaining the positive results, the 30-day-old adventitious roots were treated with the best elicitor concentration on different treatment time (0, 12, 24 and 48 h) to investigate the transduction of signal molecules (H2O2, NO, ET, PLA2 and ABA, for Ca2+, 0, 10, 20, 30 and 60 mins), the expression level of transcription factors and functional genes referred to ginsenosides biosynthesis pathway.

Quantitation of signal molecules of roots after treatment with Penicillium sp. YJM-2013 in different time

To test Ca2+, H2O2, ABA, PLA2, NO, ABA and ET, adventitious roots (0.5 g, for NO and H2O2 assays, 0.1 g) were ground into homogenate on the rice with 4.5 mL PBS. The supernatant was collected at 4 °C for subsequent experiment after centrifugation at 3000 rpm for 20 min. Then the content of Ca2+, H2O2, NO was measured by Calcium Assay Kit, Hydrogen Peroxide assay kit (colorimetric method) and Nitric Oxide assay kit (Nitrate reductase method) (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), and the content of ABA, PLA2, ET were measured by Plant Abscisic Acid Elisa Kit, Plant PLA2 Elisa Kit and Plant ET Elisa Kit (Senbejia Nanjing Biotechnology Co., Ltd, Nanjing, China) according the manufactures’ directions.

RNA isolation and quantitative real-time expression analysis

For RT-PCR, cDNA-equivalent to 200 ng total RNA was used as template in 20 μL volume and total RNA were extracted from fresh adventitious root samples using the Plant RNA Kit (OMEGA, USA), and RNA was transcribed into the first strand cDNA reversely with the use of the HiFiScript 1st Strand cDNA Synthesis Kit (CWBIO, China). Resulting reverse transcription products were stored at −80 °C until analysis. The PCR cycling protocols were as follows: 94 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, 50–58 °C for 1 min (PgWRKY8: 52 °C, GPS, FPS, SS, SE, DS, CYP716A47, CYP716A53v2, UGT74AE2, UGT94Q2, UGTPg100, UGTPg1, PgWRKY1, PgWRKY2, PgWRKY3, PgWRKY4, PgWRKY6, PgWRKY7, PgWRKY9: 56 °C, PgWRKY5, 58 °C, and 72 °C for 45 s) with a final 10 min extension at 72 °C. The relative expression value of each genes was calculated by the △△Ct method. Moreover, expression levels were normed using β-actin mRNA levels. Each analysis was repeated for three times. And the primers of genes were shown in Table 1.
Table 1

Sequence of primers.

Primer namesPrimer sequences (5′ to 3′)
β-actinFor: CAG AAG AGC ACC CTG TTC TTTRev: ATA AAT GGG GAC TGT GTG GCT
GPSFor: GTC AGA ATT GAT ATT CTT GCC CGC CCRev: ATG TCT CGC ACG TGT GTC TTC T
FPSFor: CTG AAA TCC GAG CTA CTC AAC GARev: GCC ATT CAA TGC ACC AAC CA
SSFor: ATG GGA AGT TTG GGG GCA ATT CTRev: GTT CTC ACT GTT TGT TCA GTA GTA GGT T
SEFor: AGC AGC AGT TGA CAA AGGRev: GCC ACA TTC GTT TTG GTG AAG G
DSFor: CGG AAA CGT GTT TGG TTG CCRev: CAA ACA ACA CCT ATT TCC GAT T
CYP716A47For: ATG GTG TTG TTT TTC TCC CTA TCTRev: TTA ATT GTG GGG ATG TAG ATG AAT
CYP716A53v2For: ATG GAT CTC TTT ATC TCATCT CAARev: TTA AAG CGT ACA AGG TGA TAG ACG
UGT74AE2For: ATG CTG AGC AAA ACT CAC ATT ARev: AAC TCC CAT ATA AGC CTG CAT
UGT94Q2For: GGT AGA ATC AGT ATA GCG TTG CRev: TCT GAG TGG GAG CAT GAG ATG GGA A
UGTPg100For: CGCGGATCCATGAAGTCAGAATTGATATTRev: CCGCTCGAGTTACATAATTTCCTCAAATA
UGTPg1For: GGA ATG GTG GAG ATG GCT ARev: TTG AGT GTC TGG AGA TGG AA
PgWRKY1For: CAAGCGAAAGTGCAGTTCAARev: CTGGGCAACCCCTTACACTA
PgWRKY2For: TTTATCTCCTCGTTGAGTGTCGRev: ACCTTCGTTTGTGCTGGTATG
PgWRKY3For: CGGAAACCCAGACTCACGRev: TCGGGACCCATTAGACATCA
PgWRKY4For: CACCAACAGCATCAACAGCGRev: ATTCGGGACCCATTAGACATCA
PgWRKY5For: GGAGCAATAGTGGCATCAACCTGRev: GAGTCGCACCAATTAAATGGAAAG
PgWRKY6For: CCATTCCCGTCAAGTTTCCACRev: CGGCAAAGTCTATGTTGTCAGG
PgWRKY7For: CGACATTATCTTCCTTCAACTTTARev: ACTCGCATTTGGGACGGC
PgWRKY8For: ATGGATAACTCTCCCTCCCCTARev: CATTCTCTTCAATCTTCACTGC
PgWRKY9For: GCAGAAAAGAGTGGTGTCCGRev: AGGCTTTTGACCATACTTTC
Sequence of primers.

Quantification of ginsenoside contents

Samples are prepared according to the experimental requirements (Liu et al., 2013). To identify and quantify the ginsenosides Rg1, Re, Ro, Rf, Rb1, Rg2, Rh1, Rc, Rb2, Rd, Rg3, Rb3 and Rh2, the extract was used and all standards (purity: ≥98%) were purchased from Suzhou Star Ocean Ginseng Bio-pharmaceutical Co., Ltd. (Suzhou, China). Performed on an Agilent 1200 series HPLC instrument, the analysis samples were separated on a Kromasil C18 (4.6 mm × 250 mm, 5 μm) column using a gradient phase composed of CH3CN (A) and water (B), and the column was kept at 35 °C. The flow rate was 1.0 mL/min and the flow program was: 0–35 min, 20% A; 35–40 min, 30% A; 40–50 min, 31% A; 50–60 min, 32% A; 60–70 min, 45% A; 70–100 min, 60% A. The injected volume was 20 μL and the peaks were monitored at 203 nm.

HPLC-ESI-MSn

The analysis were carried out by an Agilent 1260 series HPLC (Agilent 6420 Triple Quad LC/MS), and the source conditions were as follows: full scan of ions ranging from m/z 100–1400 in the negative code, capillary voltage at 4000 V, nebulizer pressure at 15 bar, dry gas flow rate of 11 L/min, and dry gas temperature at 300 °C. High-purity nitrogen and He were used as sheath and collision gases, respectively. The data were operated on the Qualitative Analysis B.06.00 software.

Statistical analysis

The fresh weight and ginsenoside contents were expressed as means ± standard deviation (SD). Statistical analyses were carried out by using SPSS17.0 (SPSS Inc., Chicago, USA). P < 0.05 indicated significant difference.

Results

Morphological characteristics and 18S rRNA gene analysis for identification and phylogenetic analysis

The morphology of the test strain on PDA medium was shown in Fig. 2A: oval, grayish green with a dense, flat surface and white edges, which is similar to that of Penicillium. Moreover, phylogenetic analysis (Fig. 2B) based on 18S rRNA gene sequences indicated that the test strain was most close to Penicillium sp. YJM-2013 (KF313086.1, 99%).
Fig. 2

Penicillium on PDA plate medium (A); Phylogenetic tree based on 18S rDNA gene sequences showing the phylogenetic relationships between Penicillium sp. YJM-2013 and closely related species (B).

Penicillium on PDA plate medium (A); Phylogenetic tree based on 18S rDNA gene sequences showing the phylogenetic relationships between Penicillium sp. YJM-2013 and closely related species (B).

Roots growth and ginsenoside production in P. ginseng adventitious roots following Penicillium sp. YJM-2013 and F. oxysporum A549 elicitation

Different elicitor has different influence on biomass of adventitious roots. Penicillium sp. YJM-2013 did not significantly decrease the fresh weight of adventitious roots at concentration of less than 50 mg/L, but significantly more than 100 mg/L (Table 2). However, F. oxysporum A549 could increase it at different concentrations (Table 3).
Table 2

Effect of Penicillium sp. YJM-2013 elicitor concentration on biomass and ginsenoside accumulation of P. ginseng adventitious roots after 5 d of elicitation (mean ± SD, n = 3).

Elicitor concentrations/ (mg·L−1)Fresh weight /gGinsenoside content /(mg·g−1)
Rb groupRg groupRoTotal
07.71 ± 0.30a4.69 ± 0.47d11.59 ± 0.25d2.64 ± 0.02d18.92 ± 0.74e
506.91 ± 0.36ac10.60 ± 0.35c13.03 ± 0.66d3.81 ± 0.16c27.44 ± 0.85d
1005.86 ± 0.56bc12.21 ± 0.73c15.50 ± 0.61c4.82 ± 0.12b32.54 ± 1.23c
2005.78 ± 0.35b21.42 ± 1.05a21.74 ± 0.22a5.79 ± 0.30a48.95 ± 0.97a
4005.16 ± 0.33b15.35 ± 0.28b17.27 ± 0.53b3.79 ± 0.46c36.41 ± 0.20b

Note: Rb group = Rb1 + Rb2 + Rb3 + Rc + Rd + Rg3 + Rh2; Rg group = Re + Rg1 + Rg2 + Rf + Rh1. Mean values followed by the same letters within a column are not significantly different according to Duncan’s multiple range test at 5% level.

Table 3

Effect of F. oxysporum A547 concentration on biomass and ginsenoside accumulation of P. ginseng adventitious roots after 5 d of elicitation (mean ± SD, n = 3).

Elicitor concentration / (mg·L−1)Fresh weight/gGinsenoside content /(mg·g−1)
Rb groupRg groupRoTotal
06.82 ± 0.05e6.21 ± 0.12c11.57 ± 0.36b2.32 ± 0.01c20.10 ± 0.23d
507.33 ± 0.06d6.06 ± 0.16c17.07 ± 1.05a1.90 ± 0.10c25.03 ± 0.99c
1008.43 ± 0.12c9.89 ± 0.56b17.77 ± 2.15a8.94 ± 1.36a36.60 ± 0.36a
2008.94 ± 0.33b11.44 ± 0.13a16.75 ± 0.35a7.13 ± 0.28b35.31 ± 0.50a
40010.10 ± 0.09a9.41 ± 0.51b11.78 ± 0.57b10.30 ± 0.35a31.50 ± 1.48b

Note: Rb group = Rb1 + Rb2 + Rb3 + Rc + Rd + Rg3 + Rh2; Rg group = Re + Rg1 + Rg2 + Rf + Rh1. Mean values followed by the same letters within a column are not significantly different according to Duncan’s multiple range test at 5% level.

Effect of Penicillium sp. YJM-2013 elicitor concentration on biomass and ginsenoside accumulation of P. ginseng adventitious roots after 5 d of elicitation (mean ± SD, n = 3). Note: Rb group = Rb1 + Rb2 + Rb3 + Rc + Rd + Rg3 + Rh2; Rg group = Re + Rg1 + Rg2 + Rf + Rh1. Mean values followed by the same letters within a column are not significantly different according to Duncan’s multiple range test at 5% level. Effect of F. oxysporum A547 concentration on biomass and ginsenoside accumulation of P. ginseng adventitious roots after 5 d of elicitation (mean ± SD, n = 3). Note: Rb group = Rb1 + Rb2 + Rb3 + Rc + Rd + Rg3 + Rh2; Rg group = Re + Rg1 + Rg2 + Rf + Rh1. Mean values followed by the same letters within a column are not significantly different according to Duncan’s multiple range test at 5% level. Both Penicillium sp. YJM-2013 and F. oxysporum A549 could promote the accumulation of total ginsenosides (Table 2, Table 3) with individual differences. Penicillium sp. YJM-2013 was optimal for Rb, Rg group and Ro at 200 mg/L, especially for Rb group, which was 4.57 fold of the control group (4.69 ± 0.47 mg/g). F. oxysporum A549 was optimal for Rb group and Rg group at 200 mg/L and 100 mg/L, respectively, whereas 400 mg/L was more conducive to the accumulation of Ro, and the Ro content increased 4.44-fold compared with the control group (2.32 ± 0.01 mg/g). The maximum of total ginsenosides (48.95 ± 0.97 mg/g) was obtained at 200 mg/L of Penicillium sp. YJM-2013, and this content was 2.59 fold higher than the control group (18.92 ± 0.74 mg/g). Therefore, Penicillium sp. YJM-2013 at concentration of 200 mg/L was selected for the following experiments.

Signal molecules accumulation in P. ginseng adventitious roots following Penicillium sp. YJM-2013 elicitation

Penicillium sp. YJM-2013 effectively improved the accumulation of Ca2+, H2O2, ABA, PLA2, NO and ET in P. ginseng adventitious roots. As shown in Fig. 3A, Ca2+ (8.58 ± 0.37 mmol/g prot) generated immediately and reached its peak value at 20 min, H2O2 (16.78 ± 0.59 mmol/g prot) (Fig. 3B), ABA (29.50 ± 0.99 ng/mL) (Fig. 3C), NO (609.22 ± 25.02 μmol/g prot) (Fig. 3D) and ET (151.74 ± 5.20 ng/L) (Fig. 3E) reached the highest level at 12 h. PLA2 (233.27 ± 5.78 U/L) (Fig. 3F) also increased after Penicillium sp. YJM-2013 elicitor treatment and reached its highest at 24 h.
Fig. 3

Accumulation of Ca2+ (a), H2O2 (b), ABA (c), PLA2 (d), NO (e), ET (f) in P. ginseng adventitious roots affected by Penicillium sp. YJM-2013 elicitor. Data represent as mean values ± SD of three replicates. Mean separation within column by Duncan’s multiple range test at P ≤ 0.05.

Accumulation of Ca2+ (a), H2O2 (b), ABA (c), PLA2 (d), NO (e), ET (f) in P. ginseng adventitious roots affected by Penicillium sp. YJM-2013 elicitor. Data represent as mean values ± SD of three replicates. Mean separation within column by Duncan’s multiple range test at P ≤ 0.05.

PgWRKYs accumulation in P. ginseng adventitious roots following Penicillium sp. YJM-2013 elicitation

We implemented qRT-PCR analysis of PgWRKY1-9 at different time intervals (0, 12, 24, 48 h). Seven PgWRKY genes were significantly up-regulated, while the PgWRKY4 and PgWRKY8 genes were notably down-regulated at 48 h. As shown in Fig. 4, the expression level of PgWRKY1, PgWRKY5, PgWRKY6, PgWRKY7, PgWRKY9 reached the maximum at 12 h, however, PgWRKY2, PgWRKY3 had the highest expression level at 24 h.
Fig. 4

Effects of Penicillium sp. YJM-2013 elicitor on expression of PgWRKY1-9 transcription factors via ginsenoside biosynthetic pathway in P. ginseng adventitious root. Data represent as mean values ± SD of three replicates. Mean separation within column by Duncan’s multiple range test at P ≤ 0.05.

Effects of Penicillium sp. YJM-2013 elicitor on expression of PgWRKY1-9 transcription factors via ginsenoside biosynthetic pathway in P. ginseng adventitious root. Data represent as mean values ± SD of three replicates. Mean separation within column by Duncan’s multiple range test at P ≤ 0.05.

Biosynthetic genes expression and ginsenosides production in P. ginseng adventitious roots following Penicillium sp. YJM-2013 elicitation

We investigated the compound of ginsenosides and the changes in transcriptional levels of eleven genes involved in ginsenosides biosynthetic pathway at different time intervals (0, 12, 24, 48 h). As shown in Fig. 5, all tested genes were significantly up-regulated during the elicitation period, indicating that the increased accumulation of ginsenosides was due to the elevated transcription of these functional genes. Also, the expression levels of UDP-glycosyltransferases (UGT) genes UGT74AE2, UGT94Q2 and UGTpg100, reached the highest at 48 h, 12 h, 12 h differently, and they consisted in the production of monomer ginsenoside Rh2, Rg3 and Rh1.
Fig. 5

Expression profile for genes involved in terpenoid biosynthesis and content of monomer ginsenoside in P. ginseng adventitious root elicited by Penicillium sp. YJM-2013 elicitor. Data represent as mean values ± SD of three replicates. Mean separation within column by Duncan’s multiple range test at P ≤ 0.05.

Expression profile for genes involved in terpenoid biosynthesis and content of monomer ginsenoside in P. ginseng adventitious root elicited by Penicillium sp. YJM-2013 elicitor. Data represent as mean values ± SD of three replicates. Mean separation within column by Duncan’s multiple range test at P ≤ 0.05.

HPLC-ESI–MSn analysis of ginsenosides

We performed secondary metabolites profiling in Penicillium sp. YJM-2013 treatment group and control group using HPLC-ESI-MSn. As shown in Table 4, a total of 11 compounds were identified via comparisons with authentic standards or data found in previous reports, including Rg1, Re, Malonyl-Rg1, Ro, Rf, Rb1, Rg2, Rc, Rb2, Rb3, Rd, and they all existed in control group and Penicillium sp. YJM-2013 treatment group. And the structures of 11 kinds of identified ginsenosides were shown in Table 5.
Table 4

HPLC-MSn data of ginsenosides in Penicillium sp. YJM-2013 elicitor treated P. ginseng adventitious root.

No.tR/minIdentificationMS/ (m/z)ESI(-)MSnDistributionReference
136.45Rg1800835.3[M + Cl] AllStandards
239.70Re946981.4[M + Cl] AllStandards
341.53Malonyl-Rg1885885[M − H] All(MacCrehan & White, 2013)
445.34Ro957885[M − H] AllStandards
552.12Rf801835.3[M + Cl] AllStandards
659.19Rb111081107.3[M − H] AllStandards
760.45Rg2784819.4[M + Cl] AllStandards
862.43Rc10781191.3[M-H + CH3COONa] AllStandards
965.82Rb210781191.4[M-H + CH3COONa] AllStandards
1066.67Rb310781091.3[M-H + CH3COONa] AllStandards
1169.21Rd946981.3[M + Cl]AllStandards
Table 5

Structures of 11 kinds of identified ginsenosides (Glc, β-D-glucose; Rha, α-rhamnose; Ara (p), α- L-arabinose (pyranose); Ara (f), α-L-arabinose (furanose); Xyl, β-D-xylose; GlcUA, β-D-glucuronic acid).

Chemical structuresSaponinsR1R2
Ginsenoside Rb1Glc(2–1)GlcGlc(6–1)Glc
Ginsenoside Rb2Glc(2–1)GlcGlc(6–1)Ara(p)
Ginsenoside Rb3Glc(2–1)GlcGlc(6–1)Xyl
Ginsenoside RcGlc(2–1)GlcGlc(6–1)Ara(f)
Ginsenoside RdGlc(2–1)GlcGlc
Ginsenoside Rg1GlcGlc
Ginsenoside ReGlc(2–1)RhaGlc
Ginsenoside RfGlc(2–1)GlcH
Ginsenoside Rg2Glc(2–1)RhaH
Ginsenoside malonyl-Rg1Glc(6)MalGlc
Ginsenoside RoGlcUA(2–1)GlcGlc
HPLC-MSn data of ginsenosides in Penicillium sp. YJM-2013 elicitor treated P. ginseng adventitious root. Structures of 11 kinds of identified ginsenosides (Glc, β-D-glucose; Rha, α-rhamnose; Ara (p), α- L-arabinose (pyranose); Ara (f), α-L-arabinose (furanose); Xyl, β-D-xylose; GlcUA, β-D-glucuronic acid).

Discussion

Effects of Penicillium sp. YJM-2013 and F. oxysporum A549 on ginsenosides accumulation

Fungal elicitors were added to the adventitious, hairy root or cell culture of Panax for the improvement of ginsenoside production. It is reported that treatment with the extract of pathogenic fungi Alternaria panax Whetz. and Cylindrocarpon destructans could induce the production of ginsenosides in adventitious roots culture of P. quinquefolius (Yu et al., 2016). However, few reports tried to compare the effects of pathogenic fungi and its antagonistic fungi on the production of secondary metabolites in plant tissue culture. This study found that the mycelium of Penicillium sp. YJM-2013 could increase total ginsenosides content by 2.59 times compared with control. Moreover, Penicillium sp. YJM-2013 had a rather significantly positive effect on the accumulation of PPD-type ginsenosides, which have drawn more and more people’s attention for their better anti-tumor effect than PPT-type ginsenosides and more safe anti-depressant effects (Xu et al., 2010). It was the first time to use the antagonistic fungi as biotic elicitor to enhance ginsenosides accumulation, and this method provides a new way to substitute resources.

Effects of Penicillium sp. YJM-2013 on signal molecule generation

Fungal elicitors can be recognized by plant receptors located in plasma membrane or cytoplasm of plant cells, which will initiate a signal transduction network that activates plant defensive secondary metabolism. Ca2+ spiking, burst of ROS and NO are early physiological response of plant cells reacted to elicitors, and plays a core role in various signal transduction (Almagro, Bru, Pugin, & Pedreno, 2012). H2O2 was the main intermediate product in the metabolic reactions of elicitors inducing the accumulation of ginsenosides in P. ginseng (Hu, Neill, Cai, & Tang, 2010). Besides, ethylene was proved to be a phytohormone which involved in ginseng growth and development and mediated ginsenosides accumulation (Bae, Choi, Shin, Kim, & Kim, 2006). Moreover, ABA and PLA2 were also involved in secondary metabolites induced by fungal elicitors, but studies on these were limited. In order to understand how signal molecules reacted to Penicillium sp. YJM-2013, contents of Ca2+, H2O2, ABA, PLA2, NO and ET in fresh root samples harvested at different time points were determined in this work. And present study showed that signal molecules of the elicitor-treated group were transiently expressed, which proved that Ca2+, H2O2, ABA, PLA2, NO, ET were upstream signal molecules that might contribute to gene activation involved in plant secondary metabolism for the enhanced production of ginsenosides in the culture of P. ginseng adventitious roots.

Effects of Penicillium sp. YJM-2013 on PgWRKY1-9 expression

The activation of defense gene expression depends on the transcription factors, which can integrate multiple signaling pathways, activate functional genes and then lead the production of secondary metabolites (Aharoni & Galili, 2011). The expression of PgWRKY1-9 genes was obviously affected by MeJA, SA, ABA, and NaCl treatments (Nuruzzaman et al., 2016, Xiu et al., 2016). This study explored the obvious influence of fungal elicitors on the expression of the PgWRKY1-9, providing a comprehensive understanding of the WRKYs in P. ginseng. The information offered here was facilitated to explore the functions of these PgWRKYs on the production of ginsenosides.

Effects of Penicillium sp. YJM-2013 on ginsenosides biosynthetic genes expression

Fungal-induced signal transduction induce the synthesis of secondary metabolites probably by increasing the expression of genes involved in the synthesis of secondary metabolites (Du, Liang, Han, Yu, & Liang, 2015). In this study, the content of ginsenosides was changed at different time intervals, which is consistent with the expression levels of biosynthetic genes in ginsenosides biosynthesis pathway. The similar phenomenon was observed in other tissue culture P. ginseng, FPS, SS, SE, DS, CYP716A47 and CYP716A53v2 expression levels were significantly elevated by Tween 80 (Liang et al., 2015), MeJA (Lee et al., 2017), SA and yeast extract (Rahimi et al., 2014), resulting in ginsenosides accumulation. Studies of these regulators may elucidate ginsenoside biosynthesis mechanism and further make it possible to manipulate ginsenoside accumulation.

Effects of Penicillium sp. YJM-2013 on ginsenosides profile

Some studies have shown that induction treatment could increase the variety of secreted compounds as well as several types of phytochemicals. (Singh, 2016). Probably, it was because the existence of different elicitors would active different signaling pathways, speed up enzyme activities, thereby leading to synthesis of different components (Cheng, Yuan, & Graham, 2011). Our previous experiments also found that Rb3 was only detected in the adventitious roots of P. ginseng treated with Aspergillus niger (Li et al., 2016). Therefore, the LC-MSn technology was used to investigate the influence of Penicillium sp. YJM-2013 on ginsenoside profile. However, we found no significant differences in the composition of ginsenosides in the experiment. The content in the tissue culture can be further increased by methods of mixed induction or microbial embedding.

Conclusion

As biocontrol fungi, Penicillium sp. YJM-2013 was more conducive to the accumulation of ginsenosides in P. ginseng adventitious roots. Penicillium sp. YJM-2013 promoted the accumulation of ginsenosides by intensifying the generation of signal molecules, activating the expression of transcription factors and functional genes. This result is conducive to the industrial production of ginsenosides.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
  30 in total

1.  Panax ginseng induces human Type I collagen synthesis through activation of Smad signaling.

Authors:  Jongsung Lee; Eunsun Jung; Jiyoung Lee; Sungran Huh; Jieun Kim; Mijung Park; Jungwoon So; Younggeun Ham; Kwangseon Jung; Chang-Gu Hyun; Yeong Shik Kim; Deokhoon Park
Journal:  J Ethnopharmacol       Date:  2006-07-03       Impact factor: 4.360

2.  Fungal elicitors enhance ginsenosides biosynthesis, expression of functional genes as well as signal molecules accumulation in adventitious roots of Panax ginseng C. A. Mey.

Authors:  Jinxin Li; Shujie Liu; Juan Wang; Jing Li; Dahui Liu; Jianli Li; Wenyuan Gao
Journal:  J Biotechnol       Date:  2016-10-13       Impact factor: 3.307

3.  Early signaling network in tobacco cells elicited with methyl jasmonate and cyclodextrins.

Authors:  Lorena Almagro; Roque Bru; Alain Pugin; María A Pedreño
Journal:  Plant Physiol Biochem       Date:  2011-10-13       Impact factor: 4.270

Review 4.  Metabolic engineering of the plant primary-secondary metabolism interface.

Authors:  Asaph Aharoni; Gad Galili
Journal:  Curr Opin Biotechnol       Date:  2010-12-06       Impact factor: 9.740

5.  BcGs1, a glycoprotein from Botrytis cinerea, elicits defence response and improves disease resistance in host plants.

Authors:  Yi Zhang; Yunhua Zhang; Dewen Qiu; Hongmei Zeng; Lihua Guo; Xiufen Yang
Journal:  Biochem Biophys Res Commun       Date:  2015-01-19       Impact factor: 3.575

6.  Two ginseng UDP-glycosyltransferases synthesize ginsenoside Rg3 and Rd.

Authors:  Suk-Chae Jung; Woohyun Kim; Sung Chul Park; Jinkil Jeong; Myung Keun Park; Soohwan Lim; Yeon Lee; Wan-Taek Im; Jun Hyoung Lee; Giltsu Choi; Sun Chang Kim
Journal:  Plant Cell Physiol       Date:  2014-10-14       Impact factor: 4.927

7.  Enhancing phytochemical levels, enzymatic and antioxidant activity of spinach leaves by chitosan treatment and an insight into the metabolic pathway using DART-MS technique.

Authors:  Shachi Singh
Journal:  Food Chem       Date:  2015-11-28       Impact factor: 7.514

8.  Diversity, distribution, and antagonistic activities of rhizobacteria of Panax notoginseng.

Authors:  Ze-Yan Fan; Cui-Ping Miao; Xin-Guo Qiao; You-Kun Zheng; Hua-Hong Chen; You-Wei Chen; Li-Hua Xu; Li-Xing Zhao; Hui-Lin Guan
Journal:  J Ginseng Res       Date:  2015-05-21       Impact factor: 6.060

9.  Elicitation of gymnemic acid production in cell suspension cultures of Gymnema sylvestre R.Br. through endophytic fungi.

Authors:  Vasudeva Reddy Netala; Venkata Subbaiah Kotakadi; Susmila Aparna Gaddam; Sukhendu Bikash Ghosh; Vijaya Tartte
Journal:  3 Biotech       Date:  2016-10-28       Impact factor: 2.406

10.  Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones.

Authors:  Hao Xiu; Mohammed Nuruzzaman; Xiangqian Guo; Hongzhe Cao; Jingjia Huang; Xianghui Chen; Kunlu Wu; Ru Zhang; Yuzhao Huang; Junli Luo; Zhiyong Luo
Journal:  Int J Mol Sci       Date:  2016-03-04       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.