| Literature DB >> 36111156 |
Yonghua Zhou1, Anli Zuo1, Yingjie Li1, Yu Zhang1, Zilin Yi1, Dafang Zhao1, Jianzhou Tang1, Fufa Qu1, Shenping Cao1, Zhuangwen Mao1, Junyan Jin2, Zhen Liu1.
Abstract
Inosine monophosphate (IMP) is the main flavoring substance in aquatic animal, and adenosine monophosphate deaminase1 (AMPD1) gene is a key gene in IMP formation. At present, the research on the mechanism of AMPD1 regulating IMP formation in aquatic animal is still blank. In this study, in order to study the mechanism of AMPD1 regulating IMP formation in fish, the full open reading frame (ORF) of AMPD1 which was 2160bp was obtained for the first time in triploid crucian carp (Carassius auratus). It encoded 719 amino acids with a molecular mass of 82.97 kDa, and the theoretical isoelectric point value was 6.31. The homology analysis showed that the homology of triploid crucian carp and diploid Carassius auratus was the highest, up to 99%. And the phylogenetic tree showed that triploid crucian carp was grouped with diploid Carassius auratus, Culter alburnus, and Danio rerio. And real-time fluorescence quantitative results showed that AMPD1 was expressed specifically in muscle of triploid crucian carp (p < 0.05). The results of detection the localization of AMPD1 in cells indicated that the AMPD1 was mainly localized in cytoplasm and cell membrane. Further, we examined the effects of glutamate which was the promotor of IMP formation on the expression of AMPD1 and the formation of IMP in vivo and in vitro experiments, the results showed that 3% glutamate and 2 mg/ml glutamate could significantly promote AMPD1 expression and IMP formation in triploid crucian carp muscle tissue and muscle cells (p < 0.05). Then we inhibited the expression of AMPD1 in vivo and in vitro experiments, we found the formation of IMP in muscle tissue and muscle cells of triploid crucian carp all were inhibited and they affected the gene expression of AMPK-mTOR signaling pathway. The all results showed that AMPD1 mediated glutamate through AMPK-mTOR signaling pathway to regulate the formation of fish IMP.Entities:
Keywords: AMPD1; glutamate; inosine monophosphate; regulatory; triploid crucian carp
Year: 2022 PMID: 36111156 PMCID: PMC9468423 DOI: 10.3389/fphys.2022.970939
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
The sequences of the designed primers used in this study.
| Primer name | Sequence (5′→3′) | Comment | Genebank |
|---|---|---|---|
|
| TTCTACCGAAAGAGTGATAGT | CDS Cloning | XM_026245035.1 |
|
| TCATGGGCTTCACATTAACGA | ||
|
| ATCTATGGCTGTAACCCTAAT | qRT-PCR | MW435570.1 |
|
| ATGTCATAGATTCTGGGCACT | ||
|
| AAGTCCAAGCATCTCGGTGTC | qRT-PCR | MK294331.1 |
|
| TGGGTTCTTCCTCCGCACT | ||
|
| CCAAAGAGATGCAGAAGCCACA | qRT-PCR | XM_026262450.1 |
|
| CTCTCTCATACGCTCTCCCT | ||
|
| CCTCCTCATGACACCCTGCT | qRT-PCR | XM_026285746.1 |
|
| TCTTCTGGTCCGTTGGCAAA | ||
|
| CCTTCTTGGGTATGGAGTCTTG | qRT-PCR | MN184794.1 |
|
| AGAGTATTTACGCTCAGGTGGG |
F, forward primer, R, reverse primer.
Formula and nutritional composition of experimental diets.
| Ingredients | Glutamate (Glu)levels | ||||
|---|---|---|---|---|---|
| 0.0% | 1.0% | 1.5% | 2.5% | 3.0% | |
| Glu | 0.00 | 1.00 | 1.50 | 2.50 | 3.00 |
| Fish meal | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 |
| Soybean meal | 28.00 | 28.00 | 28.00 | 28.00 | 28.00 |
| Rapeseed meal | 18.00 | 18.00 | 18.00 | 18.00 | 18.00 |
| Cottonseed meal | 10.80 | 10.80 | 10.80 | 10.80 | 10.80 |
| Flour plant | 16.00 | 16.00 | 16.00 | 16.00 | 16.00 |
| Fish oil | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 |
| Soya-bean oil | 2.50 | 2.50 | 2.50 | 2.50 | 2.50 |
| α-starch | 4.00 | 4.00 | 4.00 | 4.00 | 4.00 |
| Corn starch | 4.00 | 4.00 | 4.00 | 4.00 | 4.00 |
| Choline | 0.11 | 0.11 | 0.11 | 0.11 | 0.11 |
| Mineral premixa | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| CMC | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Cellulose | 6.59 | 5.59 | 5.09 | 4.09 | 3.59 |
| Nutrition level | |||||
| Crude protein | 31.2 | 32.02 | 32.52 | 33.52 | 34.02 |
| Crude lipid | 6.03 | 6.03 | 6.03 | 6.03 | 6.03 |
| Ash | 5.66 | 5.78 | 5.85 | 5.55 | 5.62 |
| Gross energy (MJ kg−1) | 17.45 | 17.62 | 17.70 | 17.87 | 17.95 |
Note: Mineral premixa (mg kg−1 diet): NaCl, 250.0; NaH2PO4 2H2O, 6250.0; MgSO4 7H2O, 4077.8; KH2PO4, 8000.0; CaH2PO4 2H2O, 3825.3; C6H10CaO6 5H2O, 875.0; FeSO4 7H2O, 1143.1; ZnSO4 7H2O, 89.0; MnSO4·H2O, 30.7; CuSO4 5H2O, 7.75; CoSO4 7H2O, 0.46; KI, 0.75; Na2SeO3,0.30; Corn starch, 499.9.
FIGURE 1The open reading frame (ORF) and amino acid sequences of AMPD1.
The amino acid sequence of AMPD1 was compared with that of other species.
| Protein name | Accession no. | Amino acid comparison | |
|---|---|---|---|
| Similarity (%) | Identity (%) | ||
|
| NP_000027.3 | 81 | 68.2 |
|
| NP_001093819.1 | 81 | 69 |
|
| NP_001116548 | 82 | 69 |
|
| NP_001028475.2 | 82 | 69 |
|
| XP_009330198.1 | 70 | 82 |
|
| NP_957187.1 | 92 | 95 |
|
| XP_026100821.1 | 99 | 99 |
|
| NP_001135149.1 | 81 | 88 |
|
| XP_004070279.1 | 81 | 89 |
|
| XP_019944239.1 | 82 | 90 |
|
| AKQ62701.1 | 91 | 95 |
| Triploid crucian carp AMPD1 | MW435570 | — | — |
FIGURE 2Adjacency phylogenetic tree based on AMPD1 amino acid sequences of different species. Node values represent the percent bootstrap confidence level derived from 1000 replicates. The bar (0.05) indicates the genetic distance.
FIGURE 3The relative expression levels of AMPD1 gene in different tissues of triploid crucian carp were analyzed by real-time fluorescence quantitative PCR. Error bars represent the means ± SD; n = 3. p < 0.05.
FIGURE 4Localization analysis of AMPD1 in cells. Scale bars represent 50 µm.
FIGURE 5Effects of glutamate (Glu) on the relative mRNA expression of AMPD1 and the IMP content in vivo (A) and in vitro (B). Error bars represent the means ± SD; n = 3. p < 0.05.
FIGURE 6Effects of AMPD1 inhibitor injection on IMP content and the relative mRNA expression of AMPK-mTOR signaling pathway related genes for 48 h and 72 h in vivo. (A) IMP content; (B) the relative mRNA expression of AMPK-mTOR signaling pathway related genes. Error bars represent the means ± SD; n = 3. p < 0.05.
FIGURE 7Effects of 40 μM AMPD1 inhibitor on the IMP content and AMPK-mTOR signaling pathway related genes in vitro. (A) the sixth generation of muscle cells, (B) the sixth generation of muscle cells treated with 40 μM inhibitor for 16 h, bar = 100 μm, (C) the detection diagram of IMP content by HPLC; (D) the effects on the expression of AMPK-mTOR signaling pathway related genes. Error bars represent the means ± SD; n = 3. p < 0.05.