MiR-195-5p suppresses the proliferation, migration, and invasion of gallbladder cancer cells by targeting FOSL1 and regulating the Wnt/β-catenin pathway.

Background: MicroRNA-messenger RNA (miRNA-mRNA) regulatory networks are essential factors that regulate tumor development and metastasis in various cancers including gallbladder carcinoma (GBC). Here, we identified the miR-195-5p/Fos-like antigen-1 (FOSL1) axis in GBC by bioinformatics analysis and aimed to investigate its role and regulatory mechanism in the development and progression of GBC.
Methods: Bioinformatics analysis was used to construct a miRNA-mRNA regulatory network. Real-time quantitative polymerase chain reaction (qRT-PCR), western blot, and dual luciferase reporter assays confirmed that miR-195-5p targets FOSL1 in GBC. Cell Counting Kit-8 (CCK-8), wound healing, transwell, flow cytometry assays, western blotting, and immunofluorescence were used to detect the biological effects of the miR-195-5p/FOSL1 regulatory axis and the Wnt/β-catenin signaling pathway on the proliferation, migration, invasion, and cell cycle of GBC cells. A nude mouse tumorigenesis model was constructed to verify the role of miR-195-5p in vivo.
Results: Bioinformatics analysis and qRT-PCR confirmed that the miR-195-5p/FOSL1 regulatory axis was closely related to GBC cells. Overexpression of miR-195-5p inhibited the proliferation, migration, and invasion of GBC cells, and the cells were blocked in the G0/G1 phase. Dual luciferase reporter gene assays and western blot analysis showed that FOSL1 is targeted by miR-195-5p. The recovery experiment showed that miR-195-5p can inhibit cell proliferation, migration, invasion, and increase of cells in the G0/G1 phase, and the overexpression of FOSL1 could restore this effect by regulating the Wnt/β-catenin signaling pathway. Finally, we confirmed that miR-195-5p inhibited the growth of transplanted tumors in vivo. Conclusions: The overexpression of miR-195-5p inhibits the proliferation and metastasis of GBC cells by directly targeting FOSL1 and regulating the Wnt/β-catenin signaling pathway. 2022 Annals of Translational Medicine. All rights reserved.

Introduction

Gallbladder carcinoma (GBC) is a malignant tumor originating from the gallbladder epithelium and is one of the most common and aggressive tumors (1). The clinical symptoms of patients with GBC are not obvious and the onset is relatively insidious, enabling cancer cells to spread widely in the early stage through direct infiltration, lymphatic metastasis, and blood circulation (2,3). Radical surgery is the most effective treatment for GBC, but most patients have already entered the middle and late stages at the time of diagnosis and have missed the optimal period for surgery (4). Moreover, the efficacy of adjuvant therapy, such as chemotherapy and radiotherapy, in patients with advanced GBC is short-lived, and chemotherapy and radiotherapy resistance is common (5). Therefore, the overall prognosis of GBC is very poor, with a 5-year survival rate of less than 5% (6). Despite major efforts to identify tumor-promoting and tumor suppressor genes in GBC over the past few decades, few independent biomarkers have been identified that can be routinely used in clinical (7,8). Therefore, a new potential GBC marker to address this issue is eagerly sought.

MicroRNAs (miRNAs) are endogenous, single-stranded small RNAs of 20–24 nt in length that are highly conserved and regulate gene expression by degrading target messenger RNAs (mRNAs) or inhibiting their translation (9,10). Accumulating evidence suggests that mature miRNAs play important roles in various physiological and pathological processes, such as cell proliferation, migration, invasion, and signal transduction (11). Previous studies have found that multiple miRNAs are abnormally expressed in GBC tissues and are associated with factors such as GBC metastasis, tumor size, and lymph node metastasis, including the upregulation of miR-181b-5p expression or the downregulation of miR-204, miR-551b-3p, and miR-30a-5p expression (12-15). It has been reported that miR-195-5p can act as a tumor suppressor in various cancers (16-18); however, whether miR-195-5p can affect the migration and invasion of GBC and thereby inhibit its progression is still unclear.

Fos-like antigen-1 (FOSL1), a member of the AP1 complex, heterodimerizes with members of the JUN family for efficient transcriptional activity (19). The mRNA and protein expression of FOSL1 is upregulated in multiple tumor types, and this molecule exerts oncogenic effects by regulating various cellular processes, such as proliferation, differentiation, invasion, epithelial-mesenchymal transition (EMT), and drug resistance (20). The Wnt/β-catenin signaling pathway is one of the key signaling pathways in cancer, and studies have shown that FOSL1 can participate in the regulation of the Wnt/β-catenin signaling pathway and promote the progression of colorectal cancer (21,22). However, the roles of FOSL1 and the Wnt/β-catenin signaling pathway in GBC are still unclear. The biological roles of miR-195-5p/FOSL1 regulatory axis and Wnt/β-catenin signaling pathway in gallbladder cancer have not been reported in other literatures.

In this study, the importance of the role of miR-195-5p, FOSL1, and the Wnt/β-catenin signaling pathway in the development of GBC was explored through bioinformatics methods combined with in vitro and in vivo experiments. We aimed to yield new insights for molecular targeted therapy. We present the following article in accordance with the ARRIVE reporting checklist (available at https://atm.amegroups.com/article/view/10.21037/atm-22-3685/rc).

Methods

Bioinformatics analysis

We obtained the miRNA dataset GSE104165 and the mRNA dataset GSE74048 by searching the Gene Expression Omnibus database (GEO; https://www.ncbi.nlm.nih.gov/geo/) and used the Limma package of R language software to perform differential gene analysis (23). The screening criteria for differentially expressed miRNAs were |log fold change (FC)|>2 and adjusted P-value <0.05, and the screening criteria for differentially expressed mRNAs were |log FC|>2 and P-value <0.05. FunRich software (http://www.funrich.org/) was used to predict the target genes of differentially expressed miRNAs, and Perl (http://www.perl.org/) software was used to intersect the predicted target genes of differentially expressed miRNAs with the differentially expressed mRNAs in the dataset to construct a miRNA-mRNA regulatory network. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013).

Cell culture

Human intrahepatic biliary epithelial cells (HIBEpiCs) and the GBC cell lines GBC-SD and NOZ were provided by Jenniobio Biotechnology Co. (Guangzhou, China). Cells were cultured in Dulbecco’s modified Eagle medium [DMEM; fetal bovine serum (FBS) 10% + penicillin (100 U/mL) + streptomycin (100 mg/mL), Gibco, Waltham, MA, USA] at 37 ℃ and 5% CO2. Fresh culture medium was regularly replaced every 2–3 days, and cells were routinely digested and passaged when confluence reached 80%.

Cell treatment and transfection

The miR-195-5p mimic, negative control (NC) mimic, miR-195-5p inhibitor, and NC inhibitor were purchased from GenePharma (Shanghai, China). The miR-195-5p mimic (40 nM), NC mimic (40 nM), miR-195-5p inhibitor (100 nM), or NC inhibitor (100 nM) was transfected into GBC-SD or NOZ cells with Lipofectamine® 3000 (Thermo Fisher Scientific, Waltham, MA, USA).

Lentiviral human FOSL1-targeting short hairpin RNA (shRNA) was designed via the Thermo Fisher Scientific website (https://rnaidesigner.thermofisher.com/rnaiexpress/sort.do). The target shRNAs against the human FOSL1 gene (GenBank accession NM_001300844.2) for RNAi were sh-FOSL1 #1: 5'-GCTGTGGTCAAGGAGGTAAGT-3' and sh-FOSL1 #2: 5'- GCACGAAGACGTTGATATAGC -3'; PLKO.1 blank lentivector was used as a NC. For overexpression of FOSL1, the complementary DNA (cDNA) of a fragment encoding the full-length human FOSL1 open reading frame (ORF) sequence was amplified by polymerase chain reaction (PCR) and then cloned into a pSin lentiviral expression vector (oe-FOSL1) to obtain a recombinant lentivirus. An overexpression miR195-5p lentiviral plasmid was constructed using pCDH vectors (Lv-miR195-5p), and empty pCDH vectors acted as NCs (Lv-NC) (GuangZhou Yingxin Biological Technology, Guangdong, China).

The cells were treated with 2 µg/mL puromycin for 7 days to obtain stable cell lines after 72 hours of infection. Real-time quantitative PCR (qRT-PCR) was used to verify the expression levels of FOSL1 and miR195-5p, and western blotting was used to verify the expression levels of FOSL1.

In the groups treated with dimethyl sulfoxide (DMSO) or PNU74654 [MedChemExpress (MCE), Monmouth Junction, NJ, USA], 15 µL DMSO or 129.8 µM PNU74654 were added to the culture medium. After 48 hours of treatment, the cells were harvested and used for subsequent assays.

RNA isolation and quantitation

The miRNA was extracted from cultured cells using a miRNA Purification Kit, and total RNA was extracted from cultured cells using an Ultrapure RNA Kit (both from CWBIO, Beijing, China). The RNA samples were then reverse transcribed into cDNA with a miRNA cDNA synthesis kit and a HiFiScript cDNA synthesis kit (CWBIO, China). We performed qRT-PCR with the miRNA qPCR Assay Kit and UltraSYBR Mixture (CWBIO, China) using a LightCycler 480 System (Roche, Indianapolis, IN, USA). The expression of miRNA was quantified with the U6 control, and the mRNA levels were quantified with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA expression as an endogenous control. The relative levels of gene expression were calculated based on the 2-△△Ct method. The primers used were designed and synthesized by Sangon Biotech (Shanghai, China) ().

Table 1

Primer sequence

Target gene	Primer (5'-3')
miR-29c-3p	F: CGCGCTAGCACCATTTGAAATCGGTT
miR-125b-5p	F: CGCTCCCTGAGACCCTAACTTGTGA
miR-144-3p	F: CCGCGCGCGTACAGTATAGATGATGT
miR-145-5p	F: CCGTCCAGTTTTCCCAGGAATCCCT
miR-195-5p	F: CGCGCTAGCAGCACAGAAATATTGGC
U6	F: CTCGCTTCGGCAGCACA
	R: AACGCTTCACGAATTTGCGT
FOSL1	F: ACTGGAAGATGAGAAATCTGGG
	R: GGGAAAGGGAGATACAAGGTAC
ESRRG	F: CACATAGAAGATGTTGAAGCCG
	R: TGATGTTGTAGAAATGCTGCAC
CEP55	F: ATGCAGGCATGTACTTTAGACT
	R: AAGCTGTTTCAAGGATTCCAAC
CBLC	F: GTGAGTATCTACCAGTTCCACG
	R: CCCCTTTAGGAGTCTCACTTTC
EFNA1	F: TGAGGACTACACCATACATGTG
	R: CTGCCACAGAGTGATCTTCATA
GAPDH	F: GCACCGTCAAGGCTGAGAAC
	R: TGGTGAAGACGCCAGTGGA

Western blot analysis

Proteins were extracted from cells using precooled radioimmunoprecipitation assay (RIPA) buffer (CWBIO, China) with protease and phosphatase inhibitor cocktails (CWBIO, China). The protein concentration was determined using a bicinchoninic acid (BCA) protein quantification kit (Beyotime Biotechnology, Shanghai, China). Protein samples (20 µg) were separated through polyacrylamide gel electrophoresis (PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membranes were blocked in 5% nonfat dry milk for 1 hour and then incubated with primary antibodies to β-tubulin (#66240‐1‐Ig; 1:20000), FOSL1 (ab252421; 1:1000), β-catenin (ab32572; 1:1000), CCND1 (ab134175; 1:10000), or c-Myc (ab32072; 1:1000) overnight at 4 ℃. The membranes were then incubated with the corresponding secondary rabbit or mouse antibody tagged by horseradish peroxidase (CWBIO, China). Protein bands were visualized using enhanced chemiluminescence reagents (ECL; Biosharp Life Sciences, Anhui, China) and photographed using a ChemiDoc Imaging System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Densitometric analysis was performed using ImageJ 1.53c software (National Institutes of Health, Bethesda, MD, USA) with normalization to the expression of β-tubulin.

Dual-luciferase reporter assay

The free online tool TargetScan (http://www.targetscan.org/vert_72/) was used to predict the binding sites of miR-195-5p to FOSL1. The FOSL1 3'-untranslated region (3'UTR) containing the wild-type binding site predicted by miR-195-5p was amplified and cloned into the pmirGLO vector (FOSL1-WT) (Promega Corp., Madison, WI, USA). The FOSL1 3'UTR containing the binding site of the miR-195-5p mutation was obtained by site-directed mutagenesis (the possible binding sequence of miR-195-5p and FOSL1 3'UTR was deleted). The mutant sequence was amplified and cloned into pmirGLO vector to construct the FOSL1-MUT plasmid. At 48 hours after transfection with NC mimic or miR-195-5p mimic, luciferase activity was detected using a dual-luciferase reporter assay system (Solarbio Corp., Beijing, China) and normalized to Renilla activity.

Cell counting kit-8 assay

The GBC-SD and NOZ cells were cultured in a 96-well plate at a density of 5,000 cells/well for 0, 24, 48, and 72 hours. The cultured medium in each well was exchanged with fresh medium containing 10% Cell Counting Kit-8 (CCK-8; Absin Bioscience, Inc., Shanghai, China) and incubated at 37 ℃ for 2 hours. The optical density (OD) values of the medium were measured at 450 nm using a MultiskanTM FC Microplate Photometer (Thermo Fisher Scientific, USA).

Cell wound healing assays and transwell assays

For the cell wound healing assay, GBC cells were cultured in 24-well plates to generate a confluent monolayer (2×105 cells per well) and then scratched with a 200 µL sterile pipette tip. After being gently washed twice with phosphate-buffered saline (PBS), the wounded cell monolayer was incubated with FBS-free medium at 37 ℃. The scratch wounds were photographed with an inverted phase-contrast microscope (Olympus, Hamburg, Germany) at 0, 24, and 48 hours after scratching and then assessed by ImageJ software. We set the initial scratch width to 100%, and the results were expressed as the percentage of wound closure.

Cell invasion assays were performed using transwell chambers (8.0 µm pore size; Corning, Corning, NY, USA). Matrigel [Becton, Dickinson, and Co. (BD) Biosciences, Franklin Lakes, NJ, USA] was thawed at 4 ℃, and 50 µL of thawed Matrigel was added to the chambers. After incubation at room temperature for 5 hours, a total of 100 µL of serum-free medium containing 5×104 cells was added to the upper chamber, and 600 µL of 10% FBS culture medium was added to the lower chamber. After incubation at 37 ℃ and 5% CO2 for 24 hours, noninvaded cells on the top of the transwell were removed, and the invading cells were fixed with 4% paraformaldehyde and stained with crystal violet staining solution (0.1% w/v, Beyotime Biotechnology, China). Photographs were taken randomly from 5 regions of each membrane, and the number of invading cells was expressed as the average number of cells in each region. All assays were independently repeated 3 times.

Cell cycle analysis

Cell cycle distribution was measured by flow cytometry. After the appropriate treatments, cell cycle distribution was determined using a cell cycle staining kit (MultiSciences, Hangzhou, China) according to the manufacturer’s protocol. The GBC cells were collected and fixed with 70% cold ethanol. Next, propidium iodide (PI) staining solution with RNase A was added and incubated in the dark at 37 ℃ for 30 minutes. The stained samples were tested by a CytoFLEX flow cytometer (Beckman Coulter, Carlsbad, CA, USA), and the results were analyzed by ModFit (Verity Software House, Topsham, ME, USA).

Immunofluorescent staining

The GBC cells were seeded in 15 mm confocal dishes (NEST Biotech., Jiangsu, China) and incubated for 24 hours before staining. The cells were fixed in 4% paraformaldehyde and then permeabilized in 0.1% Triton X-100 at room temperature. After being blocked for 1 h with phosphate-buffered saline/Tween (PBST) containing 10% goat serum, the cells were incubated with β-catenin primary antibodies (ab32572; 1:200) overnight at 4 ℃. After 3 washes with PBST, a cocktail of fluorescence-conjugated secondary antibody (ab150078, 1:100, Abcam, Cambridge, MA, USA) was added to the cells. Then, the cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; C0065, Solarbio Corp., China), and the cells were photographed under a confocal microscope (LSM880 with Fast Airyscan; ZEISS, Oberkochen, Germany).

Immunohistochemistry

Immunohistochemistry was performed to observe the expression of FOSL1 (ab252421; 1:500), Ki67 (A2094; 1:2,000), β-catenin (ab32572; 1:500), CCND1 (ab134175; 1:500), and c-Myc (ab32072; 1:500). Sections were incubated with a primary antibody at 4 ℃ overnight, washed with PBS 3 times, and incubated with secondary antibody at room temperature for 1 hour. Thereafter, the sections were incubated with DAB (AR1022, Boster Company, China) for immunohistochemistry staining. After counterstaining with hematoxylin, the slides were prepared for microscopic (Olympus, Germany) evaluation.

Tumor xenograft model

In this study, 10 Male BALB/c nude mice aged 4–6 weeks (16–18 g) were purchased from Beijing Vital River Laboratory Animal Technology Co. (Beijing, China) and randomly divided into 2 groups (Lv-miR-195-5p and Lv-NC) with 5 mice in each group. The animals were kept in the same environment [specific-pathogen-free (SPF) animal laboratory] to eliminate interference.

Equal numbers (3×106 cells) of Lv-miR-195-5p and Lv-NC GBC-SD cells were subcutaneously injected into BALB/c nude mice. Xenograft mouse models were kept for 36 days and tumor volumes were recorded every 4 days after injection. Tumor volumes were measured using a standard caliper and were calculated with the following formula: V=(L×W2)/2 (L, the longest tumor axis; W, the shortest tumor axis). At the end of the experiments, all nude mice were sacrificed, and the xenograft tumors were weighted and collected for immunohistochemistry. A protocol was prepared before the study without registration. Experiments were performed under a project license (No. IACUC-2021031202) granted by the Animal Ethical and Welfare Committee at the Sixth Affiliated Hospital of Sun Yat-sen University, in compliance with institutional guidelines for the care and use of laboratory animals.

Statistical analysis

All statistical analyses were performed using SPSS 26.0 statistical software (IBM Corp., Armonk, NY, USA). All data are presented as the mean ± standard deviation (SD) of at least 3 independent experiments. An unpaired 2-tailed Student’s t-test was used for comparative analysis between the 2 groups. One-way analysis of variance (ANOVA) was used to compare multiple groups, followed by Tukey’s post-hoc test. A P-value less than 0.05 was considered significant.

Results

MiRNA-mRNA coregulatory network in GBC

We retrieved and obtained relevant datasets for GBC samples from the GEO database and then performed bioinformatics analysis on these datasets (). First, we used R language to analyze the GBC miRNA dataset GSE104165 to determine the differentially expressed miRNAs (|log FC|>2, adjusted P<0.05) between GBC and normal gallbladder tissues and generated a heatmap () and a volcano map (). Moreover, we used FunRich software to predict the target genes of all differentially expressed miRNAs. Next, we analyzed the GBC mRNA dataset GSE74048, screened out the differentially expressed mRNAs between GBC and normal gallbladder tissues (|log FC|>2, P<0.05), and generated a heatmap () with a volcano plot (). Then, the target genes predicted for the miRNAs were further intersected with the mRNAs screened from the GSE74048 dataset to obtain the possible miRNA-mRNA regulatory network of GBC (). Finally, the top 5 miRNA-mRNA regulatory axes ranked by |log FC| were selected for experimental verification, and their roles and mechanisms in the progression of GBC were further studied (). We used qRT-PCR to confirm that both miR-145-5p and miR-195-5p levels were significantly downregulated in 2 GBC cell lines, GBC-SD and NOZ, compared with those in HIBEpiCs (). Therefore, we further identified the expression of potential target genes of miR-145-5p and miR-195-5p and confirmed that FOSL1 was elevated in GBC cells compared with HIBEpiCs ().

Figure 1

MiRNA-mRNA coregulatory network in GBC. (A) Bioinformatics analysis flow diagram. (B, C) Heatmap and volcano map of differentially expressed miRNAs between GBC and normal gallbladder tissues. (D, E) Heatmap and volcano map of differentially expressed mRNAs between GBC and normal gallbladder tissues. (F) MiRNA-mRNA regulatory network of GBC. (G) qRT-PCR was performed to measure the level of miRNA in HIBEpiC, GBC-SD, or NOZ cells. (H) qRT-PCR was performed to measure the level of mRNA in HIBEpiC, GBC-SD, or NOZ cells. (I) Expression of miR-195-5p in GBC tissue and normal gallbladder tissue in dataset GSE104165. (J) Expression of FOSL1 in GBC and normal gallbladder tissue in dataset GSE74048. (K) Relationship between miR-195-5p expression and prognosis in GBC dataset GSE104165. Data are mean ± SD. *P<0.05 compared with control group. The experiment was repeated 3 times. miRNA, microRNA; mRNA, messenger RNA; GBC, gallbladder cancer; qRT-PCR, real-time quantitative polymerase chain reaction; FOSL1, Fos-like antigen-1; SD, standard deviation.

Table 2

Top 5 miRNA-mRNA regulatory axes in GBC ranked by |log FC|

miRNA	Target	mRNA	miRNA LogFC	mRNA LogFC
hsa-miR-145-5p	Target	EFNA1	−4.852705757	2.113080402
hsa-miR-125b-5p	Target	ACHE	−4.057789761	2.117387521
		ESRRG	−4.057789761	2.733009085
		SGOL1	−4.057789761	2.245136804
		VAV3	−4.057789761	2.504915294
hsa-miR-29c-3p	Target	MYBL2	−3.696319794	2.020220853
hsa-miR-144-3p	Target	CEP55	−3.675952033	2.771505528
		PMAIP1	−3.675952033	2.208247395
		STIL	−3.675952033	2.388986806
hsa-miR-195-5p	Target	CBLC	−3.672802065	2.16986385
		CEP55	−3.672802065	2.771505528
		ESRRG	−3.672802065	2.733009085
		FOSL1	−3.672802065	2.155042439

miRNA, microRNA; mRNA, messenger RNA; GBC, gallbladder cancer; FC, fold change.

Moreover, we analyzed the expression of miR-195-5p and FOSL1 in their respective GEO datasets. The expression of miR-195-5p in GBC was significantly lower than that in normal gallbladder tissue () and the expression of FOSL1 in GBC was higher than that in normal gallbladder tissue (). Further analysis of the relationship between miR-195-5p and patient survival prognosis in the data set showed that the decreased expression of miR-195-5p was associated with poor patient prognosis ().

The relationship between the miR-195-5p/FOSL1 regulatory axis and GBC was preliminarily determined.

Overexpression of miR-195-5p inhibits the proliferation, migration, and invasion of GBC cells

To study the biological function of miR-195-5p in GBC cells, we first used qRT-PCR to detect the transfection efficiency of miR-195-5p. As shown, the expression of miR-195-5p was significantly upregulated in both cell lines after transfection of the miR-195-5p mimic, whereas the miR-195-5p inhibitor had the opposite effect (). The results of CCK-8 assays and statistical analysis showed that the proliferation of the GBC-SD and NOZ cells overexpressing miR-195-5p was significantly lower than that of the control group, and the proliferation of the miR inhibitor-transfected cells was significantly enhanced (). The effect of miR-195-5p on GBC-SD and NOZ cell migration was examined using wound healing assays. After statistical analysis, overexpression of miR-195-5p was shown to significantly inhibit the movement of GBC-SD and NOZ cells, and the migration of the miR inhibitor-transfected group was significantly higher than that of the control group (). Transwell assays were used to detect the effect of miR-195-5p on the invasion of GBC-SD and NOZ cells. The statistical results showed that the number of GBC-SD and NOZ cells with high expression of miR-195-5p in the transwells was significantly lower than that of the control cells. The number of cells transfected with the miR inhibitor was significantly higher than that of the control cells, and the difference was significant compared with that of the control group (). Flow cytometry and statistical analysis showed that miR-195-5p overexpression resulted in GBC-SD and NOZ cell cycle arrest in the G0/G1 phase and a significant reduction in cells in the S phase. Transfection of the miR inhibitor reduced the cells in the G0/G1 phase and increased those in the S phase, and the difference was significant (). In conclusion, miR-195-5p has a tumor suppressor effect in GBC.

Figure 2

Overexpression of miR-195-5p inhibits the proliferation and migration of GBC Cells. (A) qRT-PCR analyses of miR-195-5p levels were performed after treatment of GBC-SD and NOZ cells with miR-195-5p mimics and inhibitor or NC. (B) CCK-8 assays were used to examine cell viability of GBC-SD and NOZ cells after transfection with miR-195-5p mimics and inhibitor or NC. (C,D) Wound healing assays were shown in GBC-SD and NOZ cells after transfection with miR-195-5p mimics and inhibitor or NC. Cell migration was observed using a microscope (original magnification, ×100). (E,F) Transwell assays were used to detect cell invasion capacities of GBC-SD and NOZ cells after transfection with miR-195-5p mimics and inhibitor or NC (dyeing with crystal violet; original magnification, ×200). (G,H) Flow cytometry was used to assess the cell cycle distribution of GBC-SD and NOZ cells transfected with miR-195-5p mimics and inhibitor or the control cells for 24 h and stained with PI. Data are mean ± SD. *P<0.05 compared with control group. The experiment was repeated 3 times. GBC, gallbladder cancer; qRT-PCR, real-time quantitative polymerase chain reaction; NC, negative control; CCK-8, Cell Counting Kit-8; PI, propidium iodide; SD, standard deviation.

FOSL1 is the direct target of miR-195-5p in GBC

We used the online bioinformatics tool TargetScan to find the possible binding sequence of miR-195-5p and FOSL1 and constructed the pmirGLO dual luciferase FOSL1-WT and FOSL1-MUT reporter plasmids (). The results showed that the miR-195-5p mimic decreased the luciferase activity of the FOSL1-WT-transfected GBC cells but did not affect the luciferase activity of the FOSL1-MUT-transfected GBC cells (). In addition, our western blot results showed that the transfected miR-195-5p mimic significantly downregulated the protein level of FOSL1 in GBC cells, and correspondingly, the changes after transfection with the miR-195-5p inhibitor were reversed (). Thus, FOSL1 is a direct target of miR-195-5p in GBC cells and negatively correlated with miR-195-5p.

Figure 3

FOSL1 is the direct target of miR-195-5p in GBC. (A) The 3'-UTR of the FOSL1 gene contains binding sites for miR-195-5p, according to bioinformatics analysis. (B) Dual-luciferase reporter assay was used to verify the relationship between miR-195-5p and FOSL1 in GBC-SD and NOZ cells. (C) Western blotting was used to determine the level of FOSL1 in GBC-SD and NOZ cells after transfection with miR-195-5p mimics and inhibitor or NC. Data are mean ± SD. *P<0.05 compared with control group. The experiment was repeated three times. GBC, gallbladder cancer; UTR, untranslated regions; FOSL1, Fos-like antigen-1; NC, negative control; SD, standard deviation.

MiR-195-5p targets FOSL1 to inhibit the proliferation, migration, and invasion of GBC cells

To further explore the biological role of the miR-195-5p/FOSL1 axis in GBC, we established the GBC cell line GBC-SD with stable overexpression of FOSL1 (oe-FOSL1) by lentivirus and constructed a NOZ GBC cell line with stable knockdown of FOSL1 (sh-FOSL1 #1, sh-FOSL1 #2) by lentivirus. The transfection efficiency was verified by qRT-PCR and western blots (Figure S1A,S1B). We separately treated the FOSL1-overexpressing GBC-SD and FOSL1 knockdown NOZ cells and examined their proliferation (), migration (), invasion (), and cell cycle (). The results and statistical analysis showed that the proliferation, migration, and invasion of GBC cells were enhanced after overexpression of FOSL1 (P<0.05). Compared with those of the GBC cells in the NC-mimic+oe-FOSL1 group, the proliferation, migration, and invasion of the GBC cells in the miR-195-5p mimic + oe-FOSL1 group were decreased (P<0.05). After overexpression of FOSL1, the proportion of cells in the G0/G1 phase was significantly decreased, and the proportion of cells in the S phase was significantly increased (P<0.05). Compared with that of the GBC cells in the NC-mimic + oe-FOSL1 group, the proportion of cells in the G0/G1 phase in the miR-195-5p mimic + oe-FOSL1 group was significantly increased, and the proportion of cells in the S phase was significantly decreased (P<0.05). Correspondingly, after knockdown of FOSL1, the proliferation, migration, and invasion of GBC cells were weakened, the proportion of cells in the G0/G1 phase was significantly increased, and the proportion of cells in the S phase was significantly decreased (P<0.05), but the miR-195-5p inhibitor could reverse these changes (P<0.05). Therefore, miR-195-5p targeted the regulation of FOSL1 to inhibit the proliferation, migration, and invasion of GBC cells.

Figure 4

MiR-195-5p targets FOSL1 to inhibit the proliferation and migration of GBC cells. (A) CCK-8 assays were used to examine cell viability of stable GBC-SD and NOZ cell lines after transfection. (B,C) Wound healing assays were shown in stable GBC-SD and NOZ cell lines after transfection. Cell migration was observed using a microscope (original magnification, ×100). (D,E) Transwell assays were used to detect cell invasion capacities of stable GBC-SD and NOZ cell lines after transfection (dyeing with crystal violet; original magnification, ×200). (F,G) Flow cytometry was used to assess the cell cycle distribution of stable GBC-SD and NOZ cell lines transfected with miR-195-5p mimics and inhibitor or the control cells for 24 h and stained with PI. Data are mean ± SD. GBC-SD: *P<0.05 compared with NC-mimic + oe-NC group; #P<0.05 compared with NC-mimic + oe-FOSL1 group. NOZ: *P<0.05 compared with NC-inhibitor + sh-NC group; #P<0.05 compared with NC-mimic + sh-FOSL1 #1 group; &P<0.05 compared with NC-mimic + sh-FOSL1 #2 group. The experiment was repeated 3 times. oe-NC, overexpress negative control; oe-FOSL1, overexpress Fos-like antigen-1; sh-FOSL1, short hairpin Fos-like antigen-1; sh-NC, short hairpin negative control; GBC, gallbladder cancer; CCK-8, Cell Counting Kit-8; PI, propidium iodide.

MiR-195-5p regulates the Wnt/β-catenin signaling pathway by targeting FOSL1

In this study, after transfection of the miR-195-5p mimic and miR-195-5p inhibitor, western blotting was used to detect changes in Wnt/β-catenin signaling pathway proteins in GBC cells. The results showed that the miR-195-5p mimic could reduce the protein expression levels of β-catenin, c-Myc, and CCND1 (), and the miR-195-5p inhibitor could increase their expression levels (). We also studied the mechanism by which the miR-195-5p/FOSL1 axis regulates the Wnt/β-catenin signaling pathway by rescue experiments. Western blot and immunofluorescence results indicated that overexpression of FOSL1 could increase the nuclear expression of β-catenin and activate the Wnt/β-catenin signaling pathway, and this effect could be reversed by the miR-195-5p mimic (). Correspondingly, knockdown of FOSL1 reduced the nuclear expression of β-catenin and inhibited the activation of the Wnt/β-catenin signaling pathway, and the miR-195-5p inhibitor reversed this effect (). These results suggest that miR-195-5p regulates the Wnt/β-catenin signaling pathway by targeting FOSL1.

Figure 5

MiR-195-5p regulates the Wnt/β-catenin signaling pathway by targeting FOSL1. (A, B) Western blotting was used to detect changes in Wnt/β-catenin signaling pathway proteins in GBC-SD and NOZ cells after transfection with miR-195-5p mimics and inhibitor or NC. (C, D) Western blotting was used to detect changes in Wnt/β-catenin signaling pathway proteins in stable GBC-SD and NOZ cell lines after transfection. (E, F) Immunofluorescence staining of β-catenin in stable GBC-SD and NOZ cell lines after transfection (original magnification, ×200). Data are mean ± SD. GBC-SD: *P<0.05 compared with control group; #P<0.05 compared with NC-mimic + oe-FOSL1 group. NOZ: *P<0.05 compared with control group; #P<0.05 compared with NC-mimic + sh-FOSL1 #1 group; &P<0.05 compared with NC-mimic + sh-FOSL1 #2 group. The experiment was repeated 3 times. oe-NC, overexpress negative control; oe-FOSL1, overexpress Fos-like antigen-1; sh-FOSL1, short hairpin Fos-like antigen-1; sh-NC, short hairpin negative control; SD, standard deviation.

We treated the FOSL1-overexpressing GBC-SD cells with miR-195-5p or PNU74654 and examined their proliferation (), migration (), invasion (), and cell cycle (). The results and statistical analysis showed that the Wnt/β-catenin signaling pathway involved in miR-195-5p/FOSL1 axis mediated the proliferation, migration, and invasion of GBC cells.

Figure 6

MiR-195-5p targets FOSL1 and regulates the Wnt/β-catenin pathway to inhibit the proliferation, migration, and invasion of GBC Cells. (A) CCK-8 assays were used to examine cell viability of stable GBC-SD cell lines after transfection and treating with DMSO or PNU-74654. (B) Wound healing assays were shown in stable GBC-SD cell lines after transfection and treating with DMSO or PNU-74654. Cell migration was observed using a microscope (original magnification, ×100). (C) Transwell assays were used to detect cell invasion capacities of stable GBC-SD cell lines after transfection and treating with DMSO or PNU-74654 (dyeing with crystal violet; original magnification, ×200). (D) Flow cytometry was used to assess the cell cycle distribution of stable GBC-SD cell lines after transfection and treating with DMSO or PNU-74654 for 24 h and stained with PI. Data are mean ± SD. *P<0.05 compared with NC-mimic + oe-NC + DMSO group; #P<0.05 compared with NC-mimic + oe-FOSL1 + DMSO group; &P<0.05 compared with miR-195-5p mimic + oe-FOSL1 + DMSO group. The experiment was repeated 3 times. oe-NC, overexpress negative control; oe-FOSL1, overexpress Fos-like antigen-1; GBC, gallbladder cancer; CCK-8, Cell Counting Kit-8; DMSO, dimethyl sulfoxide; PI, propidium iodide; SD, standard deviation.

Upregulation of miR-195-5p expression suppresses xenograft tumor growth in BALB/c-nu mice

To confirm whether miR-195-5p affects the tumorigenesis of GBC in vivo, we established the GBC cell line GBC-SD with stable overexpression of miR-195-5p (Lv-miR-195-5p) mediated by lentivirus and the blank control (Lv-NC), and the transfection efficiency was detected by fluorescence microscopy and qRT-PCR (). We subcutaneously injected Lv-miR-195-5p and Lv-NC GBC cells to establish a xenograft model, and after the 8th day, the subcutaneous tumor volume was measured every 4 days. On day 36, the mice were sacrificed, and the tumors were photographed and weighed (). Compared with those of the control group, the tumor volume and weight of the mice in the Lv-miR-195-5p group decreased significantly (P<0.05). Immunohistochemistry was used to verify the effect of miR-195-5p overexpression on tumor proliferation and the expression of Ki67, FOSL1, β-catenin, c-Myc, and CCND1. The expression of Ki67, FOSL1, β-catenin, c-Myc, and CCND1 was lower in the tumors of the Lv-miR-195-5p group mice (). These results indicate that miR-195-5p inhibits the growth of xenograft tumors in BALB/c-nu mice.

Figure 7

Upregulation of miR-195-5p expression suppresses xenograft tumor growth in BALB/c-nu mice. (A) The transfection efficiency in GBC-SD which stable overexpression of miR-195-5p was detected by fluorescence microscopy (original magnification, ×100) and qRT-PCR. (B,C) Photographs of the mice and dissected tumors that were treated with Lv-NC or Lv-miR-195-5p. (D,E) The volumes and weights of the tumors grown in the xenograft mouse model. (F) Immunohistochemistry of tumor tissues treated with Lv-NC or Lv-miR-195-5p (original magnification, ×100). Data are mean ± SD. *P<0.05 compared with control group. n=5. qRT-PCR, real-time quantitative polymerase chain reaction; Lv-NC, lentiviral negative control; Lv-miR-195-5p, lentiviral miR-195-5p; SD, standard deviation.

Discussion

Characteristically, GBC has an insidious onset and a high degree of malignancy, is prone to metastasis, has limited advanced treatment options, and has a 5-year survival rate of less than 5% (24). Therefore, identification of highly specific markers for GBC is urgently needed.

In recent years, miRNAs have been confirmed to play an important role in the progression of a variety of solid tumors, are closely related to survival and prognosis, and are considered one of the most valuable tumor markers (25). Recent studies have shown a strong relationship between miRNAs and gallbladder cancer. MiR-365 can inhibit the progression of gallbladder cancer and predict the prognosis of gallbladder cancer patients (26); circulating miR-141 is a potential biomarker for the diagnosis, prognosis and therapeutic target of gallbladder cancer (27); miR-4733-5p promotes gallbladder cancer progression via directly targeting kruppel like factor 7 (28). An important mechanism of miRNAs in tumors is to bind to the complementary sequence of the 3'UTR of specific target mRNAs to degrade or inhibit these molecules, thereby regulating biological behaviors such as tumor proliferation, migration, and invasion. The miRNA-mRNA coregulatory networks are ubiquitous in organisms and are closely related to cancer. For example, in glioma, miR-29a-5p alters cell proliferation, migration, and invasion by targeting DHRS4 (29); miR-29c-3p targeting CCNA2 regulates migration, invasion, and the cell cycle in esophageal cancer (30). Therefore, determining the important miRNA-mRNA coregulatory network in cancer and further elucidating its mechanism are key to cancer research. In this study, the abnormally expressed miRNAs and mRNAs in GBC patients were screened out by bioinformatics analysis, and the miRNA-mRNA coregulatory network was constructed according to their interactions. We confirmed that the expression of miR-195-5p was decreased and the expression of FOSL1 was increased in 2 GBC cell lines, preliminarily indicating that this miRNA-mRNA coregulatory network may play an important role in the progression of GBC.

MiR-195-5p is a multitarget regulator involved in various aspects of cancer cell behavior (31). It can regulate the cell cycle and inhibit the growth of leukemia cells; its expression is increased and is an important prognostic factor (32). Furthermore, stable expression of miR-195-5p in a mouse xenograft model of ovarian cancer significantly reduced tumor growth, increased tumor doubling time, and improved overall survival (33). In the present study, after we treated GBC cells with the miR-195-5p mimic, the proliferation, migration, and invasion were significantly reduced, and cell cycle arrest in the G0/G1 phase was confirmed by flow cytometry. The opposite results were obtained after treating GBC cells with a miR-195-5p inhibitor. These results confirmed the important role of miR-195-5p in the progression of GBC.

As a member of the AP1 complex, FOSL1 acts as an oncogenic factor in tumor development. FOSL1 is involved in a complex network of interactions with miRNAs, EMT-inducing transcription factors (EMT-TFs), and cytokines (34). In this study, the overexpression of miR-195-5p resulted in inhibition of the target gene FOSL1, as shown by luciferase reporter and western blot analyses. Recent studies have shown that FOSL1 is a major regulator in head and neck squamous cell carcinoma (HNSCC), suggesting that FOSL1 is a potential prognostic biomarker in HNSCC (35). In our study, overexpression of FOSL1 in GBC-SD enhanced its proliferation, migration, and invasion and promoted the transition of the cell cycle of GBC cells from the G0/G1 phase to the S phase. The opposite biological changes were observed in FOSL1 knockdown NOZ cells, which confirmed the cancer-promoting effect of FOSL1 in GBC. Moreover, we demonstrated in further rescue experiments that the oncogenic effect of FOSL1 in GBC is directly mediated by miR-195-5p.

Abnormalities in the Wnt/β-catenin signaling pathway can promote cancer stem cell renewal, cell proliferation, and differentiation, thus playing a key role in tumorigenesis and treatment response (36). Activation of the Wnt/β-catenin signaling pathway can affect changes in the downstream molecules CCND1 and c-Myc (37). Our experiments showed that miR-195-5p targets FOSL1 to regulate the Wnt/β-catenin signaling pathway in GBC, thereby promoting changes in GBC cell proliferation, migration, and invasion. The downstream molecule CCND1 of this signaling pathway is a marker protein of the cell cycle transition from the G0/G1 phase to the S phase (38). When the cell cycle is blocked in G0/G1 phase, the expression of CCND1 decreases, which is consistent with our experimental results. In nude mouse tumorigenesis experiments, we also showed that miR-195-5p regulates FOSL1 and the Wnt/β-catenin signaling pathway in GBC, thereby affecting tumor growth.

This study still had certain limitations. The interaction mechanism between FOSL1 and the Wnt/β-catenin signaling pathway is not fully understood; moreover, the diagnostic value of miR-195-5p in GBC still needs to be verified with a large number of clinical specimens. Therefore, we hope to conduct more basic experiments in the future and collect more specimens of GBC cases and follow-up data to address these issues.

Conclusions

The overexpression of miR-195-5p inhibits the proliferation, invasion, and migration of GBC cells through direct targeting of FOSL1 and regulation of the Wnt/β-catenin signaling pathway, which provides new ideas for the diagnosis and treatment of GBC.

The article’s supplementary files as