Insight into the effect of low temperature treatment on trichome density and related differentially expressed genes in Chinese cabbage.

Trichome is important for help plant resist adversity and external damage. However, it often affects the appearance and taste of vegetables. In the present study, the trichome density of leaves from two Chinese cabbage cultivars with and without trichomes treated at low temperature are analyzed by biological microscope, and the differentially expressed genes related to trichomes formation were screened through transcriptome sequencing. The results showed that the number of leaves trichomes was reduced by 34.7% at low temperature compared with room temperature. A total of 661 differentially expression genes effecting trichomes formation were identified at the CT vs C, LCT vs LC, CT vs LCT. Several differentially expression genes from every comparison group were enriched in plant hormone signal transduction and amino acid biosynthesis pathway. Combined with the central genes obtained by WGCNA analysis, five candidate genes Bra029778, Bra026393, Bra030270, Bra037264 and Bra009655 were screened. qRT-PCR analysis verified that the gene expression differences were in line with the trend of transcriptome data. This study not only found possible new key genes and laid a foundation for revealing the molecular mechanism regulating the formation of trichome in Chinese cabbage, but also provided a new way to study plant surface trichomes.

Introduction

Trichomes are special structures on the surfaces of plants derived from epidermal cells [1, 2], and its density and size are determined by the stage and location of growth and development in plants [3]. Trichomes not only can secrete some lipids or secondary metabolites, such as changing the body and feces odor of feeding insect larvae to attract ants to prey on them [4, 5], but secrete some volatile organic compounds to attract parasitic wasps and other insect natural enemies to prey on pests. Furthermore, trichomes play a crucial role in defending against pests or bacteria [6]. It is often an important factor in response to drought, water, salt, high temperature and other abiotic stresses [7-9]. For example, the total glandular hair density on both sides of leaves of schizonepeta tenuifoliabriq chinensis was significantly increased in response to salt stress [10], and the reduction of steam pressure difference on leaf surface resulted in the decrease of glandular hair density on leaves of Birch [11]. In addition, the trichome secretions are used as raw materials for spices, medicines, food additives, resins and essential oils [12, 13], which have important ecological and economic value to human beings.

Chinese cabbage is an important vegetable in Cruciferae, rich in vitamins, crude fiber, carotene and other nutrients. It is the vegetable with the largest cultivation area, the most daily consumption and the most popular among consumers in China. Chinese cabbage can be divided into trichomes and without trichomes types. Although Chinese cabbage trichomes play an obvious role in increasing leaf thickness to reduce heat of epidermis, loss of water, and defense against insect pathogen invasion and mechanical injury [14, 15], it also affects the consumption quality, and sometimes even cause stabbing injury to human body. Therefore, how to remove trichomes or regulate the formation of trichomes is extremely important for fruit and vegetables breeding. It was found that simulated summer heating increased the number of glandular hairs of Empetrum nigrum [16]. The decrease oftemperature reduced the density of glandular hairs in the leaves of Origanum vulgare [17]. Hormone treatment showed that GA3 and MeJA could significantly increase the number and density of tomato (Solanum lycopersicum) and Arabidopsis trichome [18, 19], and ethylene treatment increased epidermal branching in cucumber [20], while SA treatment inhibited epidermal branching in Arabidopsis thaliana. It was found that jasmonate promoted the development of Arabidopsis thaliana epidermis by inhibiting the interaction between jasmonate ZIM protein and GL1 and EGL3/GL3 in the transcriptional regulatory complex [21-23]. The transcription factor MYB23 gene was involved in controlling trichome branching and leaf edge trichome initiation [24-26]. Moreover, gibberellin, cytokinin and ethylene controlled the formation of epidermal and root hair cells in Arabidopsis thaliana through GIS family and subfamily genes [27].

Li located BraGL1 gene controlling leaf trichome in Chinese cabbage and found that the DNA- binding domain of Brassica GL1 was highly homologous with Arabidopsis thaliana [28, 29]. A gene located on chromosome 6 of Chinese cabbage was found functionally complementary to the ttgll mutant of Arabidopsis thaliana and affected the formation of trichomes [30]. The major gene located on A09 through CAPS markers and RAD-seq, contributed 78% to the number of trichomes in Chinese cabbage leaves [31]. The BraGL1 gene in Chinese cabbage and showed that BraGL1 was the cause of the absence of trichomes in Chinese cabbage. Furthermore, 266 genes including GL3, EGL1, SAD2 genes and WRKY, MYB, NAC transcription factors that might be related to the development of leaf trichomes were screened from the differential expression profiles of F2 generation trichome leaves without trichomes and with trichomes [32]. The number of candidate genes that affect the density of Chinese cabbage trichomes is still limited, especially the mechanism of low temperature inhibiting the formation of Chinese cabbage trichomes remains elusive.

The purpose of this study is to investigate the phenotypic changes and molecular mechanisms of leaf trichomes in Chinese cabbage in response to low temperature, and to explore a new pathway for the regulation of plant trichomes.

Materials and methods

Materials

The materials used for phenotypic and transcriptomic determination were Chuntai Chinese cabbage (CT, trichome) (purchased from Guangdong Superior Seed Import Service Company) and Chaozhou Kuai Da Xia Huang Bai (C, without trichome) (purchased from Shantou Jinxuan Seed Industry Company). CT and C are treated at room temperature, while Low temperature treatment with trichomes is denoted as LCT, low temperature treatment without trichomes is denoted as LC.

Plant culture

The full seeds were selected and placed in a petri dish covered with two layers of filter paper. The filter paper was soaked with distilled water and germinated in a light incubator at 22±1°C. After germinating and whitening, the seeds are moved to a 7×7 cm pot and placed in a light incubator simulated room temperature (temperature: 27/21°C) when growing to 4 true leaves, 20 seedlings with the same size and growth trend were selected and transferred to a low temperature (15/9°C) incubator in advance for low temperature treatment. Same number of seedlings were treated at room temperature. All plants are placed under the condition of 16 h/8 h light cycle and 6000 Lx light intensity.

Sampling and data analysis

After 10 days of treatment at low and room temperature, 3 Chinese cabbage plants were taken from each treatment and 3 leaves were selected from top to bottom. 3 holes were drilled in each leaf with a 9 mm hole punch and 3 fields were selected for each hole. The data were observed and recorded under a 10×10 biological microscope. Excel 2016, GraphPad Prism 5, Adobe Photoshop were used for data collation and mapping, and IBM SPSS Statistics 20 was used for significance test (Duncan, P < 0.05). At the same time, 0.5 g of the expanded third leaf of each plant was collected for three biological repeats for transcriptome detection.

RNA extraction and library construction

Total RNA was extracted from Chinese cabbage leaves, and the purity and integrity of sample RNA were detected. Now, all Raw date obtained by sequencing have been submitted to NCBI, SRA: PRJNA842790. All clean data were calculated using Q20 and Q30, and clean reads were sequentially compared with the reference genome using HISAT2 V2.0.5 to obtain location information on the reference genome and sequence characteristic information of the sequenced samples. Only perfectly matched reads are used for further analysis and annotation.

Differentially expressed genes (DEGs)

Differential genes were identified using FPKM (Fragments per kilobase per million reads) and DESeq2 software (1.20.0) was used for differential expression analysis between the two comparison combinations. Adjust the P value (padj) | log2FoldChange | threshold for significantly differentially expressed. In order to comprehensively obtain the functional information of differential genes, gene function annotations were carried out through the database, including GO and KEGG. GO and KEGG enrichment analysis of differentially expressed genes were realized by software.

Construction and visualization of gene network

The R package WGCNA was used to calculate the functional set of weighted association analysis, network construction, gene screening. The co-expression network was visualized using Cytoscape (v.3.7.1) software.

qRT-PCR was used to verify the differential genes

The extracted RNA was reverse transcribed using HiScript Ⅲ All-in-one RT Super Mix Perfect for qPCR kit. qRT-PCR was performed using ChamQ Universal SYBR qPCR Master Mix kit and Quant Studio 3 Real-time Quantitative PCR System (ABI, USA) instrument. The relative expression level of genes was calculated by 2-ΔΔCt method, and Actin was selected as an internal reference gene. Differential genes were selected and gene-specific primers are shown in Table 1, were designed using Primer V5.0, which were synthesized by Shenggong Bioengineering (Shanghai).

Table 1

qRT-PCR primer.

Gene ID	Forward (5’ to 3’)	Reverse (5’ to 3’)
Bra023654	GCAACAAGCAAAAGAGCAACC	GCTTGAAATGAAGGTTGGCTC
Bra039762	TCAAGTCATACCCGACCAAGAT	CGACTTTCCTCATCGCACC
Bra003253	GTGGACAAACTACCGTTGGAAT	TCCTCAACTTACGCTTACGAACT
Bra029311	GGCGAGTTTAGTTCAGAGGAGG	TGCGTGGTGGTGACAGTAGG
Bra035148	TCGGAGATGCTAACTTTGATGTG	CAATAACCGCTGAACTAACTGCT
Bra018529	GCGACGGGTCCTTGATTGT	GAACTTGGCGAAAGAAACAGC
Bra000809	CGGTTCCTTTCTCCGTTCA	CCAAAGGCAGCAAAAGTGAA
Bra025589	TCCTCGGCAACAGATGGTC	ATCGTCGTCCGTAGTGTCAAA
Bra023486	AGGTGGTCCTTGATTGCTAAAA	CAATATCACCATTACTCGGCTTG
Actin	ATCTACGAGGGTTATGCT	CCACTGAGGACGATGTTT

Results

Influence of low temperature treatment on trichome density of Chinese cabbage

The density of trichomes on the adaxial side, abaxial side and edge of leaves of the Chinese cabbage varieties after low-temperature treatment were significantly reduced, among which, the number of trichomes on the abaxial side of leaves was significantly reduced by 53.6%, and the total number of trichomes was 65.3% of room temperature treatment on the three fields (Fig 1A and 1C). The hairless variety C was still hairless before and after low temperature treatment (Fig 1A and 1B).

Fig 1

Effect of low temperature treatment on trichomes.

A, Three visual fields (adaxial, abaxial, and edge) at room temperature (CT, C) and low temperature (LCT, LC); B, Plants at room temperature (CT, C) and low temperature (LCT, LC); C, Density of trichomes at room temperature (CT) and low temperature (LCT).

Quality control of sequencing data

Refer to Brapa_sequence_V1.0. fasta database in Ensemble Plants to generate raw data in FASTQ format for this sequencing. The mismatch rate of experimental materials is low. The data volume of bases is between 6.1 and 7.3 G, and the proportion of Q20 is above 96%. The base recognition accuracy of Q30 is above 91%, and the GC content is above 45% (Table 2).

Table 2

Statistical analysis of RNA-seq reading segments.

Sample	Raw reads	Clean reads	Mapped rate (%)	GC-count (%)	Q20 (%)	Q30 (%)
C1	50397258	48687520	88.6	46.62	98.13	94.64
C2	44962240	43493470	89.07	47.1	98.07	94.56
C3	46282198	44951976	86.1	46.85	98.2	94.77
CT1	44359098	41517946	88.12	45.65	97.85	94.11
CT2	47881796	47568590	87.52	47.86	96.83	91.8
CT3	46095274	44365122	88.51	45.96	98.07	94.51
LC1	42294282	40674090	90.68	47.27	98.24	94.78
LC2	44381250	42900888	90.56	47.61	98.2	94.67
LC3	47910268	47367088	88.4	47.27	97	91.91
LCT1	48549544	48119596	89.64	47.79	96.76	91.62
LCT2	43172328	41278792	89.94	46.43	98.14	94.78
LCT3	43261326	41226126	91.36	46.48	98.27	94.99

The position of all reads aligned to the reference genome was statistically analyzed. In C, 78.86% of reads were aligned to exons, 1.83% to introns, and 19.32% to gene spacer sequences. In CT, 73.8% of reads were aligned to exons, 2.49% to introns, and 23.71% to gene intervals. In LC, 85.7% of reads were aligned to exons, 1.72% to introns, and 12.58% to gene intervals. In LCT, 85.58% of reads were aligned to exons, 1.45% to introns, and 12.96% to gene intervals (Fig 2).

Fig 2

Distribution of reads in different regions of the reference genome.

Analysis of related expression levels

DESeq2 software was used to analyze the expression levels of each sample of Chinese cabbage treated at low temperature. It has been seen from the correlation heat map of each treatment and repetition that the sample has good correlation, which can be further analyzed (Fig 3).

Fig 3

Correlation heat map between samples.

Analysis of differentially expressed genes

5684, 5814, 4944, 5310, 5806 and 9831 differentially expressed genes (DEGs) were obtained in CT vs C, LCT vs C, LCT vs CT, LCT vs LC, LC vs C, and LC vs CT respectively (Fig 4). There were 3149 up-regulated and 2535 down-regulated genes in CT vs C, and 2584 up-regulated and 2726 down-regulated genes in LCT vs LC, with 2175 common DEGs between CT vs C and LCT vs LC. 1979 up-regulated and 2965 down-regulated genes were identified in LCT vs CT, and 2761 up-regulated and 3045 down-regulated genes were screened in LC vs C, with 2039 common DEGs between LCT VS CT and LC vs C. Furthermore, it is speculated that 661 shared DEGs in CT vs C, LCT vs LC and CT vs LCT may be the candidate genes for the effect of low temperature on Chinese cabbage trichomes (Fig 5).

Fig 4

Statistical histogram of the number of genes in different combinations.

Fig 5

Venn diagram of differentially expressed genes.

GO function analysis

The DEGs were annotated into 1041 GO terms which mainly distributed in structural constituent of ribosome, structural molecule activity and RNA binding in CT vs C. The DEGs screened from LCT vs LC were annotated into 1083 GO terms and mainly distributed in Structural constituent of ribosome, structural molecule activity and hydrolase activity, acting on glycosyl bonds. Furthermore, 1018 GO terms were annotated in CT vs LCT DEGs and also mainly distributed in structural constituent of ribosome, structural molecule activity and RNA binding.

The 661 DEGs screened out between CT vs C, LCT vs LC and CT vs LCT were annotated into 416 GO terms. Among them, the three most widely distributed differential genes in molecular function annotation are ribosomal biosynthesis, riboprotein complex and RNA modification. In the annotation of cell components, the differential genes were mainly distributed in ribosome and riboprotein complex. In the notes of biological processes, they are mainly distributed in structural components of ribosomes, structural molecular activity and RNA binding (Fig 6).

Fig 6

Histogram of differential gene GO enrichment.

Enrichment analysis of KEGG metabolic pathway

The enrichment results demonstrated that DEGs found in “CT vs C” were enriched in 119 metabolic pathways, among which more DEGs were enriched in plant hormone signal transduction, carbon metabolism, biosynthesis of amino acids, MAPK signaling pathway-plant pathways. And the ribosomal biogenesis and purine metabolism pathways in eukaryotes were significantly enriched. DEGs found in “LCT vs LC” were enriched in 119 metabolic pathways, with more DEGs enriched in biosynthesis of amino acid, carbon metabolism, plant hormone signal transduction, plant-pathogen interaction, 2-oxo-carbonyl acid metabolism pathways. DEGs found in “CT vs LCT” are enriched in 117 metabolic pathways, among which carbon metabolism, RNA transport, plant hormone signal transduction, ribosomal biogenesis in eukaryotes, biosynthesis of amino acid and other pathways are more enriched in DEGs. The ribosomal biogenesis in eukaryotes and photosynthesis—antenna protein pathway was significantly enriched. KEGG analysis indicated that 661 DEGs were enriched in 74 metabolic pathways, among which biosynthesis of amino acid, RNA degradation, ribosomal biogenesis in eukaryotes, carbon metabolism, purine metabolism and other pathways were more enriched. Moreover, ribosomal biogenesis in eukaryotes metabolic pathways were significantly enriched (Fig 7).

Fig 7

Enrichment bubble diagram of differential gene KEGG.

Differential gene analysis of plant hormone signal transduction pathways and transcription factors

According to comparison group CT vs C, LCT vs LC, CT vs LCT, KEGG metabolic pathway enrichment analysis and previous studies, the plant hormone signal transduction pathway and some significantly different transcription factors are involved in the response to the trichomes. Among the more significant difference genes, more attention was given to auxin, jasmonic acid, ethylene, gibberellin signal transduction pathway. The results showed that, 7 auxin signal transduction pathways genes including Bra027504, Bra001900, Bra011559, Bra002120, Bra003044, Bra006435 and Bra023654 were screened out of DEGs (Fig 8A), while one gene Bra007937 appeared in jasmonic acid pathway (Fig 8B), 3 genes Bra014295, Bra036542, Bra022115 in ethylene pathway (Fig 8C), 5 genes Bra039762, Bra024875, Bra017443, Bra000283 and Bra007430 in gibberellin pathways (Fig 8D). Furthermore, ten differentially expressed new transcription factors including Bra001588, Bra015882, Bra029778, Bra029311, Bra035148, Bra018529, Bra000809, Bra038033, Bra004679 and Bra012910 were obtained in 661 DEGs (Fig 8F).

Fig 8

Hormone metabolic pathway and heat map of related transcription factors.

A, B, C, D, Schematic diagram of gene expression related to hormone signal transduction pathway; E, Statistical histogram of 661 differential genes; F, Differential transcription factor heatmap.

Analysis of gene weighted co-expression network among different varieties under low temperature treatment

Weighted gene co-expression network analysis (WGCNA) using non-redundant DEGs was performed to investigate the regulatory network of genes related to cold treatment and trichome and 32 modules were performed (Fig 9A). This is a heat map of the correlations between modules for all genes in different modules (Fig 9B). The correlation analysis of module-sample relationship, showed that it was high correlation between modules and modules, among which cyan module is correlated with CT module and pink module is correlated with LCT module (Fig 9C). It was found that seven central hub genes Bra029778, Bra037264, Bra002294, Bra030270, Bra012403, Bra026393 and Bra015780 were noteworthy in cyan module (Figs 9D and 10A). Among the 7 highly connected central genes Bra011511, Bra009655, Bra002871, Bra024095, Bra027347, Bra035988 and Bra030635 in pink module, a related network was constructed for analysis (Figs 9E and 10B). It may speculate that these genes regulate the formation of trichomes at low temperature.

Fig 9

WGCNA analysis.

A, Module hierarchy cluster tree diagram; B, Heat map of correlation between modules; C, Sample traits and module-to-module correlation heat map. The horizontal coordinates are samples, the ordinates are modules; D, E, Calorimetric map of gene expression in the module.

Fig 10

Analysis of hub gene co-expression network.

qRT-PCR analysis of differentially expressed genes

Nine DEGs closely related to the effect of low temperature on the trichomes were selected for real-time fluorescence quantitative PCR (qRT-PCR) detection (Fig 11). The qRT-PCR expression pattern is consistent with the RNA-seq trend.

Fig 11

qRT-PCR verification of differential genes.

Discussion

The density of glandular hairs at young leaves, stem tips and flower buds of many plants was higher than that of mature leaves, stems and flowers [11, 33], and the glandular hair density of the same leaf at different positions of front and back, edge and center was also different, especially represented by tomato and Artemisia annua. The external environment has a certain influence on the trichomes of Chinese cabbage. Temperature controls the phenotype by regulating the balance of various metabolic pathways in plants. Previous study reported that the differential DEGs of trichomes were mainly enriched in primary and secondary metabolic biosynthesis pathways [32]. In this study, we found that the number of trichomes on the adaxial, abaxial and edge of leaves was different, there were more trichomes on the abaxial and edge of leaves, which were 2.2 and 2.6 times of that on the adaxial, respectively. Compared with low temperature treatment, the DEGs from three comparison groups were mainly enriched in plant hormone signal transduction and biosynthesis of amino acids pathways. Furthermore, the differential genes were significantly up or down-regulated, and these genes can be involved in trichome formation.

Biosynthesis and signal transduction pathways of plant hormones are involved in the development of trichome [34]. Transcriptome analysis showed that auxin, ethylene and cytokinin regulate a set of similar root hair specific genes that control root hair elongation in Arabidopsis thaliana. Gibberellin signal transduction controls the accumulation and expression of gibberellin biosynthesis genes to regulate positive regulation of tobacco glandular hair initiation [35]. Spraying gibberellin on the surface of flue-cured tobacco increases the density of leaf glandular hairs [36]. Methyl jasmonate is a signal transduction molecule in plants, and exogenous application significantly improved the transcription level of key genes in Camptotheca acuminata coat synthesis and promoted the significant increase of Camptotheca acuminata coat density [37]. However, it has been reported that plant hormones are not directly involved in regulating trichome development, but indirectly regulate by the expression levels of positive or negative regulatory factors [38]. We identified the hormone metabolism pathways were enriched before and after low temperature treatment. At room temperature, 90 DEGs were enriched in the hormone signal transduction pathway of Chinese cabbage with or without trichomes, including 20 up-regulated DEGs and 70 down-regulated DEGs. After low temperature treatment, 105 DEGs were enriched in plant hormone signal transduction pathway, among which 28 DEGs were up-regulated and 77 DEGs were down-regulated. Compared with the trichomes before and after treatment, 59 DEGs were enriched in plant hormone signal transduction pathways, among which 29 DEGs were up-regulated and 30 DEGs were down-regulated. Therefore, this experiment further proved the relationship between burrs and hormones, and screened the hormone genes Bra039762, Bra007937, Bra017443, Bra24875, Bra027504, Bra023654 that may affect the formation of trichomes, laying a foundation for improving the molecular mechanism of hormone regulation of trichomes.

Transcription factors are important regulatory factors widely existing, and play a significant role in the regulation of trichome development. R2R3-MYB transcription factor and bHLH-like transcription factor can jointly form a trimer complex activator MYB-bHLH-WD40 [39, 40], directly acting on GL2/TTG2, positively regulates the development of Arabidopsis trichome [41, 42]. It has been found that R2R3-MYB transcription factor genes, bHLH transcription factors and HD-ZIP IV transcription factor genes are involved in the regulation of plant surface trichome development [43-49]. In addition, the AP2/ERF transcription factor OsHL6 protein interacts with OsWOX3B, a key regulator of rice surface coat initiation, to promote surface coat initiation and elongation [50]. Some WRKY, ERF and bZIP transcription factors can be specifically expressed in glandular hairs, and different types interact with each other. Bra001588, Bra015882, Bra029778, Bra029311, Bra035148, Bra018529, Bra000809, Bra038033, Bra004679 and Bra012910 were screened according to expression level and CT vs C, LCT vs LC and CT vs LCT comparison group. The 10 transcription factors are related to the effect of low temperature on the trichomes. Among them, Bra029778 gene was also screened in the co-expression network, which is the central hub gene and can be verified for subsequent function. It can be seen that the regulation of transcriptional interaction induced by low temperature in plant trichome formation needs to be further explored.

Plant trichomes often secrete and synthesize different types of defense substances, such as terpenoids, amino acids, phenylpropanes, lipid derivatives. These secondary metabolites can protect plants from biological and abiotic stress and play an important role in defense. Phenylalanine, tryptophan and tyrosine are all aromatic amino acids, among which tryptophan is the precursor of auxin, alkaloids, indoline and plant antitoxin, while tyrosine is the precursor of isoquinoline alkaloids, betaine and quinones [51, 52], phenylalanine is the precursor of phenylcyclopropane pathway, and p-coumaryl coenzyme A is the intermediate of phenyl-propane metabolic pathway, as well as the precursor of various substances such as phenyl-propylene and flavonoids [53]. The amino acid biosynthesis pathway of Chinese cabbage with or without trichomes was enriched in 88 DEGs, including 59 up-regulated DEGs and 29 down-regulated DEGs. After low temperature treatment, 76 DEGs were enriched in amino acid biosynthesis pathway, among which 30 DEGs were up-regulated and 46 DEGs were down-regulated. Compared with trichomes before and after treatment, 78 DEGs were enriched in amino acid biosynthesis pathway, 13 DEGs were up-regulated and 65 DEGs were down-regulated. Bra026393, Bra030270, Bra037264, Bra009655, Bra019206, Bra021682, Bra020605, Bra040146, Bra016680 may be related to the effect of low temperature on trichomes. Bra026393, Bra030270, Bra037264 and Bra009655 were also selected in the gene co-expression network as the central hub genes.

Hormone signal transduction pathway and amino acid biosynthesis pathway were obtained by KEGG enrichment, and 661 differential genes were enriched in the three comparison groups. The differential genes were screened for qRT-PCR analysis. Bra029311, Bra035148, Bra018529, Bra000809, Bra003253, Bra025589 and Bra023486 were selected transcription factors in 661 genes. Bra039762 and Bra023654 were screened genes in plant hormone signal transduction pathway. The results were consistent with the transcriptome trend, which proved the reliability of transcriptome data. The expression levels of 9 genes were significantly different between trichome Chinese cabbage CT and without trichome Chinese cabbage C. After low temperature treatment, the expression level increased or decreased, and the difference was significant. It may be related to the effect of low temperature on the trichomes. The genes enriched in related pathway and comparison group were combined with WGCNA for analysis, and five genes Bra029778, Bra026393, Bra030270, Bra037264 and Bra009655 were screened together. The reliability was strong, and the subsequent functional verification could be carried out. In order to study the phenotypic changes and molecular mechanism of Chinese cabbage leaf trichomes in response to low temperature, a new path was explored.

11 Aug 2022

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Maoteng Li

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for submitting the above manuscript to PLOS ONE. During our internal evaluation of the manuscript, we found significant text overlap between your submission and previous work in the [introduction, conclusion, etc.].

We would like to make you aware that copying extracts from previous publications, especially outside the methods section, word-for-word is unacceptable. In addition, the reproduction of text from published reports has implications for the copyright that may apply to the publications.

Please revise the manuscript to rephrase the duplicated text, cite your sources, and provide details as to how the current manuscript advances on previous work. Please note that further consideration is dependent on the submission of a manuscript that addresses these concerns about the overlap in text with published work.

[If the overlap is with the authors’ own works: Moreover, upon submission, authors must confirm that the manuscript, or any related manuscript, is not currently under consideration or accepted elsewhere. If related work has been submitted to PLOS ONE or elsewhere, authors must include a copy with the submitted article. Reviewers will be asked to comment on the overlap between related submissions (http://journals.plos.org/plosone/s/submission-guidelines#loc-related-manuscripts).]

We will carefully review your manuscript upon resubmission and further consideration of the manuscript is dependent on the text overlap being addressed in full. Please ensure that your revision is thorough as failure to address the concerns to our satisfaction may result in your submission not being considered further.

3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

4. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

6. Please upload a new copy of Figure 9 as the detail is not clear. Please follow the link for more information: "" ext-link-type="uri" xlink:type="simple">https://blogs.plos.org/plos/2019/06/looking-good-tips-for-creating-your-plos-figures-graphics/"" "" ext-link-type="uri" xlink:type="simple">https://blogs.plos.org/plos/2019/06/looking-good-tips-for-creating-your-plos-figures-graphics/""

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript entitled ‘Insight into the Effect of Low Temperature Treatment on Trichome Density and Related Differentially Expressed Genes in Chinese Cabbage’ provide valuable information related to trichome formation in Chinese cabbage.

I have few suggestions for the authors before this research get publication.

1: The English writing is very difficult to understand such as ‘Now, all Raw dates obtained by sequencing have been submitted to NCBI, login number: PRJNA842790.’ which might be ‘Raw data’. Therefore, the manuscript needs native English editing.

2: The references are not match with the citation in MS correctly, such as ‘Chinese cabbage trichomes play an obvious role in increasing leaf thickness to reduce heat of epidermis [26], loss of water [27], and defense against insect pathogen invasion and mechanical injury [28-29], but it also affects the consumption quality of cabbage.’ The references of 26 and 27 the authors listed are not mentioned about Chinese cabbage trichomes at all. Check it please.

Ref.

26. Kenzo T, Yoneda R, Azani MA, Majid NM. Changes in leaf water use after removal of leaf lower surface hairs on Mallotus macrostachyus (Euphorbiaceae) in a tropical secondary forest in Malaysia. Journal of forest research. 2018;13(2): 137-142. doi: https://doi.org/10.1007/s10310-008-0062-z.

27. Hamaoka N, Yasui H, Yamagata Y, Inoue Y, Furuya N, Araki T, et al. A hairy-leaf gene,BLANKET LEAF, of wild Oryza nivara increases photosynthetic water use efficiency in rice.Rice. 2017;10(1): 20. doi: 10.1186/s12284-017-0158-1. Epub 2017 May 12. PMID: 28500411;PMCID: PMC5429320.

3: The authors need describe the materials and methods clearly, such as ‘CT and C are treated at room temperature, while LCT and LC are treated at low temperature.’ What are LCT and LC exactly? Moreover, give the numbers of seedlings in each treatment instead of ‘some of’ and ‘the remaining’.

4: ‘After 10 days of treatment at low and normal temperature, 3 cabbage plants were taken from each treatment and 3 leaves were selected from top to bottom.’ Pay attention to Chinese cabbage and cabbage which are totally different.

5: Table 1 need remove to results part.

6:The authors need rewrite the table and figure legends clearly.

7: the most important data analysis process of the final selected 9 genes for qRT-PCR validation is not mentioned in results part.

8: The abstract and conclusion need reorganize carefully.

Reviewer #2: This MS investigated the different expression genes related with trichome density of Chinese cabbage that treated with low temperature by transcriptome analysis. It is valuable for understand the regulating mechanism of trichome density in Chinese cabbage. Following is my suggestions for this MS:

The authors focused on the DEGs derived from comparison groups of ‘CT vs C, LCT vs LC and CT vs LCT’, while the underlying biological significances should be addressed and explained in this MS.

I did not find the result descriptions of Fig 10., looks like this part was missed in Results part or perhaps this is not a necessary Fig to this MS. Fig 11. should include the statistically significant analysis since these 9 genes are significant DEGs selected from RNA-seq data. The ‘Conclusion’ part actually is the ‘Discussion’, please modify accordingly and add the proper conclusion of this MS. In this MS, the low temperature treatment also affected the Chinese cabbage plant growth (size), how to distinguish the DEGs are truly related with trichome density regulation rather than involving in plant growth (size) or growth speed (slow or quick). Besides, this manuscript needs further editing for language and writing quality.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

23 Aug 2022

Dear Academic Editors and reviewers,

I appreciate the comments on my paper from Academic Editors and reviewers very much. According to your opinions, I have carefully revised my paper again. Please see the revised draft for details. The answers to specific questions are as follows:

Question：During our internal evaluation of the manuscript, we found significant text overlap between your submission and previous work in the [introduction, conclusion, etc.].

The introduction, conclusion etc are revised further.

Reply to Reviewer 1:

Question 1: The English writing is very difficult to understand such as ‘Now, all Raw dates obtained by sequencing have been submitted to NCBI, login number: PRJNA842790.’ which might be ‘Raw data’. Therefore, the manuscript needs native English editing.

The English language expression and format have been further modified.

Question 2: The references are not match with the citation in MS correctly, such as ‘Chinese cabbage trichomes play an obvious role in increasing leaf thickness to reduce heat of epidermis [26], loss of water [27], and defense against insect pathogen invasion and mechanical injury [28-29], but it also affects the consumption quality of cabbage.’ The references of 26 and 27 the authors listed are not mentioned about Chinese cabbage trichomes at all. Check it please.

The two references cited have been removed.

Question 3: The authors need describe the materials and methods clearly, such as ‘CT and C are treated at room temperature, while LCT and LC are treated at low temperature.’ What are LCT and LC exactly? Moreover, give the numbers of seedlings in each treatment instead of ‘some of’ and ‘the remaining’.

It has been revised. See the revised manuscript for details.

Question 4: ‘After 10 days of treatment at low and normal temperature, 3 cabbage plants were taken from each treatment and 3 leaves were selected from top to bottom.’ Pay attention to Chinese cabbage and cabbage which are totally different.

It is revised to Chinese cabbage.

Question 5: Table 1 need remove to results part.

The primers were placed in the experimental methods section in most articles.

Question 6: The authors need rewrite the table and figure legends clearly.

These have been revised, please see the revised manuscript that will be uploaded.

Question 7: The most important data analysis process of the final selected 9 genes for qRT-PCR validation is not mentioned in results part.

qRT-PCR analysis has been added to conclusions and results. Detailed in manuscript 257-259 and 332-346.

Question 8: The abstract and conclusion need reorganize carefully.

The abstract and conclusion have been greatly revised.

Reply to Reviewer 2:

Question 1: The authors focused on the DEGs derived from comparison groups of ‘CT vs C, LCT vs LC and CT vs LCT’, while the underlying biological significances should be addressed and explained in this MS.

It has been revised. See the revised manuscript for details.

Question 2: I did not find the result descriptions of Fig 10., looks like this part was missed in Results part or perhaps this is not a necessary Fig to this MS.

Fig 10 analysis has been added to conclusions and results. Detailed in manuscript 242-247.

Question 3: Fig 11. should include the statistically significant analysis since these 9 genes are significant DEGs selected from RNA-seq data. The ‘Conclusion’ part actually is the ‘Discussion’, please modify accordingly and add the proper conclusion of this MS.

Fig 11 analysis has been added to conclusions. Detailed in manuscript 257-259 and 332-346.

Question 4: In this MS, the low temperature treatment also affected the Chinese cabbage plant growth (size), how to distinguish the DEGs are truly related with trichome density regulation rather than involving in plant growth (size) or growth speed (slow or quick). Besides, this manuscript needs further editing for language and writing quality.

Two reasons for DEGs selection as follows. The first is the comparison between with and without trichome Chinese cabbage, and between room temperature and low temperature, which does not involve the development stage. Secondly, the correlation between trichome and gene expression was analyzed by WGCNA.

I appreciate the reviewer's comments and accept them. Thank you very much for your review.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

31 Aug 2022

Insight into the effect of low temperature treatment on trichome density and related differentially expressed genes in Chinese cabbage

PONE-D-22-18944R1

Dear Dr. Cheng,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Maoteng Li

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: figure legends in Fig 1. A, Three visual fields (front, back, and edge) at room temperature (CT, C)of CT, C at room temperature and low temperature (LCT, LC); As I know, it should be adaxial and abaxial instead of front and back, check it please.

Reviewer #2: Minor issues: Line 39 should be '... on the surfaces of plants ...'; In Table 1, the gene ID should be written with italic format; Conclusion and discussion are very different sections in the main text of a manuscript, Line 260 should be Discussion rather than Conclusion.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

6 Sep 2022

PONE-D-22-18944R1

Insight into the effect of low temperature treatment on trichome density and related differentially expressed genes in Chinese cabbage

Dear Dr. Cheng:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Maoteng Li

Academic Editor

PLOS ONE