| Literature DB >> 36105283 |
Xueli Jiang1, Mengying Cao1, Jian Wu1, Xiaolin Wang1, Guoping Zhang1, Chunjie Yang1, Pan Gao1, Yunzeng Zou1.
Abstract
Pathological hypertrophic myocardium under consistent adverse stimuli eventually can cause heart failure. This study aims to explore the role of BACH2, a member of the basic region leucine zipper transcription factor family, in cardiac hypertrophy and failure. Transverse aortic constriction surgery was operated to induce cardiac hypertrophy and failure in mice. BACH2 was overexpressed in mice through tail vein injection of AAV9-Bach2. Mice with systemic or cardiac-specific knockdown of Bach2 were adopted. Neonatal rat ventricular myocytes (NRVMs) were isolated and infected with lentivirus to overexpress Bach2 or transfected with siRNA to knock down Bach2. Our data showed that overexpression of BACH2 ameliorated TAC-induced cardiac hypertrophy and failure in mice and decreased isoproterenol (ISO)-triggered myocyte hypertrophy in NRVMs. Systemic or cardiac-specific knockdown of Bach2 worsened the cardiac hypertrophy and failure phenotype in mice. Further assays showed that BACH2 bound to the promotor region of Akap6 at the -600 to -587 site and repressed its expression, which functioned as a crucial scaffold for cardiac hypertrophy and failure signaling pathways. Small molecular natural product library screening suggested that myricetin could up-regulate expression of Bach2 and simultaneously suppress the transcriptional levels of hypertrophic marker genes Bnp and Myh7. Further studies showed that myricetin exerted a BACH2-dependent protective effect against cardiac hypertrophy in vivo and in vitro. Taken together, our findings demonstrated that BACH2 plays a crucial role in the regulation of cardiac hypertrophy and failure and can be a potential therapeutic target in the future.Entities:
Keywords: AKAP65; BACH21; cardiac hypertrophy2; heart failure3; myricetin4
Year: 2022 PMID: 36105283 PMCID: PMC9465486 DOI: 10.3389/fphys.2022.971424
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Primers of RT-qPCR.
| RT-qPCR: Forward primers | Reverse primers | |
|---|---|---|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| GTGGATGTGCATCTAGTTCAGC | CATTGACCGAGTAGGACAGCA |
|
| CTAGCACATCCCAGTTGCCA | GCCACCGTCAAACCAACAAA |
FIGURE 1Expression of BACH2 in hypertrophic mouse hearts and histological analyses of human hypertrophic hearts. (A) H&E, Masson and immunohistochemistry (IHC) stain of human hypertrophic and control hearts (n=7). (B–D) Quantitative analyses of myocardial cross-sectional area, perivascular fibrosis (relative to vascular area) and BACH2 immunohistochemistry. Eight fields from each sample were randomly selected for analyses. (E) The heart weight difference. (F–G) The correlation of BACH2 immunohistochemistry quantitative value with heart weight and extent of perivascular fibrosis. (H) RT-qPCR analyses showing Bach2 mRNA levels in mouse hearts at 5 weeks after sham or transverse aortic constriction (TAC) surgery (n=6- 9). (I–J) Western blot and quantification analyses of BACH2 protein levels. *P<0.05, **P<0.01, ***P<0.001.
FIGURE 2BACH2 overexpression attenuates cardiac hypertrophy and failure. (A–B) The relative Bach2 mRNA and protein levels of mouse hearts injected with Bach2 adeno-associated virus 9 (AAV9) or control virus through the tail vein. (C) Histological and quantification analyses of transverse heart sections. Hematoxylin-eosin (H&E) and wheat germ agglutinin (WGA) showed the hypertrophic cardiomyocytes. Masson stain demonstrated the perivascular (relative to vascular diameter) and interstitial fibrosis. (D) Echocardiographic analyses of cardiac systolic function and wall thickness. (E) Heart weight/body weight (HW/BW). (F) The mRNA levels of Bnp, Myh 7, Col1a1 and Fnl. (G–H) NRVMs were transfected with lentivirus vector encoding rat Bach2 or control lentivirus for 48 h. (I) Overexpression of BACH2 in NRVMs decreased the mRNA levels of Anp and Bnp after treated with 10 µM ISO for 24 h. (J) Overexpression of BACH2 decreased the cell surface area of NRVMs treated with IO µM ISO for 24 h photographed by bright-field microscope. *P<0.05, **P<0.01, ***P<0.001.
FIGURE 3BACH2 deficiency exacerbates myocardial hypertrophy and dysfunction. (A–B) The Bach2 mRNA and protein expression levels. (C) H&E stain showed the hypertrophic hearts. (D) Echocardiographic analyses of cardiac wall thickness and function. (E) Heart weight/Body weight (HW/BW). (F) RT-qPCR analyses of the Bnp mRNA expression level. (G) The protein expression level of BACH2 in conditional Bach2 knockout mice compared with Flox/F/ox mice. (H–J) H&E stain, Heart weight/Body weight (HW/BW) and echocardiographic analyses of cardiac function. (K) TheBach2 mRNA and protein levels in NRVMs after transfected with siRNA targeting Bach2 (siBach2) or negative control (NC). (L) RT-qPCR analyses showed that Bach2 silence decreased the mRNA levels of Anp, Bnp and Myh7. (M) Representative aαactinin staining immunofluorescence images of NRVMs treated with 10 µM ISO for 24h after transfected with siBach2 or NC and quantitative analysis of cell surface area. *P < 0.05, **P < 0.01, ***P < 0.001.
FIGURE 4BACH2 regulates the expression level of Akap6. (A) The Akap6 mRNA expression levels in Bach2 overexpressed and GFP control mice (n=5). (B) The Akap6 mRNA expression levels in Bach2 overexpressed and control NRVMs. (C) Schematic diagrams showing the estimated binding site of BACH2 in Akap6 promotor region based on the JASPAR database. (D) ChlP-qPCR analysis using ChIP-grade BACH2 antibody or IgG antibody to detect the binding of BACH2 to Akap6 promotor. (E–F) Relative luciferase activity in HEK-293 cells transfected with reporter plasmids and Bach2 expression or control plasmid (n=8). (G) The mRNA expression levels of Akap6. (H) The hypertrophic marker gene Bnp expression levels (n=6). *P<0.05, **P<0.01, ***P<0.001.
FIGURE 5Myricetin attenuates myocyte hypertrophy partially via up-regulating BACH2 expression levels in vitro. (A) Heat map of the relative Anp, Bnp, Myh 7 and Bach2 mRNA levels in the NRVMs treated with both ISO and natural products compared to the group treated with only 10 µM ISO. (B) The Bach2 mRNA levels in indicated NRVMs (n=4). (C) Western blot showed the relative protein levels of BACH2 in the NRVMs exposed to 5 and 20 µM myricetin (n=3). (D–E) Myricetin inhibited ISO-induced increased hypertrophic gene expression levels, whereas Bach2 deficiency blocked this effect. (F) Representative a-actinin staining immunofluorescence images of NRVMs treated with 10 µM ISO and 20 µM myricetin for 24 h after transfected with siBach2 or NC and quantitative analysis of cell surface area. *P<0.05, **P<0.01, ***P<0.001.
FIGURE 6Myricetin attenuates TAC-induced cardiac hypertrophy and failure partially via upregulating BACH2 expression levels in vivo. (A) Bach2 transcriptional levels in the indicated groups of mice (n=4-6). (B) Representative H&E images showed heart transverse sections. (C) The representative M mode echocardiographic images. (D–G) Echocardiographic indicators showed that myricetin treatment alleviated TAC-induced wall thickening and cardiac dysfunction whereas this effect was blocked in the Bachr1·mice. (H) Heart weight/Body weight (HW/BW). (l–J) The mRNA and protein level of Myh 7 in the indicated groups. *P<0.05, **P<0.01, ***P<0.001.