| Literature DB >> 36105092 |
Jinxing Du1, Shengjie Li1, Jiaqi Shao1, Hongmei Song1, Peng Jiang1, Caixia Lei1, Junjie Bai1, Linqiang Han2.
Abstract
Largemouth bass (Micropterus salmoides L.) is generally considered to comprise two subspecies, Florida bass (M. floridanus) and Northern Largemouth bass (M. salmoides), which have biological characteristic differences because of their geographical distribution. In this study, whole-genome re-sequencing was performed among 10 Florida and 10 Northern largemouth bass, respectively. In total, 999,793 SNPs and 227,797 InDels were finally identified, and 507,401 SNPs (50.75%) and 116,213 InDels (51.01%) were successfully mapped to annotated 18,629 genes and 14,060 genes, respectively. KEGG classification indicated that most of these genes were focused on the pathways including signal transduction, transport and catabolism, and endocrine system. Genetic diversity analysis indicated that Florida largemouth bass had higher genetic diversity than Northern largemouth bass, indicating that the germplasm quality of Northern largemouth bass had markedly reduced in China. To examine the accuracies of the identified markers, 23 SNPs and eight InDels (the insertions or deletions of more than 45 bp) were randomly selected and detected among Florida largemouth bass, Northern largemouth bass, and their F1 hybrids. The detection efficiencies of all the markers were higher than 95%; nineteen SNPs and three InDels could accurately distinguish the two subspecies and their F1 hybrids with 100% efficiencies. Moreover, the three InDel markers could clearly distinguish the two subspecies and their F1 hybrids with a PCR-based agarose gel electrophoresis. In conclusion, our study established a simple PCR-based method for the germplasm identification of largemouth bass, which will be useful in the germplasm protection, management, and hybridization breeding of largemouth bass.Entities:
Keywords: INDEL; SNP; genetic diversity; germplasm identification; largemouth bass
Year: 2022 PMID: 36105092 PMCID: PMC9465168 DOI: 10.3389/fgene.2022.936610
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Summary of the re-sequencing results of NB and FB.
| Basic information | NB | FB |
|---|---|---|
| Total clean reads | 619,675,540 | 633,811,124 |
| Total clean base(bp) | 92,025,014,273 | 94,176,077,761 |
| Length | 150 | 150 |
| Average Q20 | 97.52 | 97.81 |
| Average properly mapped (%) | 95.37% | 94.03% |
| Average singletons mapped (%) | 0.09% | 0.17% |
| Average map ratio (%) | 99.51 | 99.67 |
| Average depth (x) | 10.31 | 10.40 |
| Average cover ratio (%) | 97.33 | 95.57 |
| Average GC content (%) | 39.99 | 40.00 |
FIGURE 1Disruption of SNP and InDels in the genome and genes of Largemouth bass. (A) Disruption of SNP and InDels in each chromosome of the largemouth bass. (B) Annotation of the SNPs and InDels in the corresponding genes of the largemouth bass.
FIGURE 2Summary of InDels between NB and FB.
FIGURE 3KEGG classification of SNPs and InDels in the potential biology process in the largemouth bass. (A) KEGG classification of SNPs in the potential biology process. (B) KEGG classification of InDels in the potential biology process.
FIGURE 4Genetic diversity analysis among 10 NB and 10 FB. (A) The phylogenetic tree analysis of 10 NB and 10 FB. (B) Population genetic structure analysis of 10 NB and 10 FB. (C) Principal component analysis (PCA) of10 NB and 10 FB. (D) Linkage disequilibrium (LD) analysis of 10 NB and 10 FB. (E) Nucleotide diversity (π) of 10 NB and 10 FB. (F) Inbreeding coefficient (F) of 10 NB and 10 FB.
Genotypes and annotation of 23 randomly selected SNPs in 30 NB, 30 FB, and 30 NF individuals, respectively.
| Number/disruption | Genotype | Annotated gene or related region | ||
|---|---|---|---|---|
| NB (number) | FB(number) | NF(number) | ||
| SNP1/Chr1 | AA (30) | GG (30) | AG (30) | Intergenic region |
| SNP2/Chr2 | TT (30) | AA (30) | AT (30) | Son of seven less homolog 1 |
| SNP3/Chr3 | GG (30) | AA (30) | AG (30) | Intergenic region |
| SNP4/Chr4 | GG (30) | AA (30) | AG (30) | Leucine-rich repeat N-terminal domain |
| SNP5/Chr5 | TT (30) | GG (30) | GT (30) | 5-Formyltetrahydrofolate cyclo-ligase |
| SNP6/Chr6 | AA (30) | CC (30) | AC (30) | Ubiquitin-conjugating enzyme E2 L3b |
| SNP7/Chr7 | TT (30) | CC (27) | GT (30) | Epidermal growth factor-like domain |
| SNP8/Chr8 | TT (28) | CC (30) | GT (30) | Nuclear apoptosis inducing factor 1 |
| SNP9/Chr9 | CC (30) | AA (30) | AC (30) | Intergenic region |
| SNP10/Chr10 | GG (30) | TT (30) | GT (30) | Prohibition |
| SNP11/Chr11 | CC (30) | TT (30) | CT (30) | Synaptotagmin XIa |
| SNP12/Chr12 | CC (30) | TT (30) | CT (30) | Intergenic region |
| SNP13/Chr13 | GG (30) | AA (30) | AG (30) | Intergenic region |
| SNP14/Chr14 | GG (30) | AA (30) | AG (30) | Solute carrier family 35 member |
| SNP15/Chr15 | AA (30) | TT (30) | AT (30) | Peptide methionine sulfoxide reductase MsrA |
| SNP16/Chr16 | TT (30) | AA (30) | AT (30) | Intergenic region |
| SNP17/Chr17 | TT (30) | AA (30) | AT (30) | Intergenic region |
| SNP18/Chr18 | GG (30) | TT (30) | TT (30) | Intergenic region |
| SNP19/Chr19 | CC (30) | AA (30) | AC (30) | Microtubule-actin cross-linking factor 1 |
| SNP20/Chr20 | TT (28) | CC (30) | GT (30) | Holocarboxylase synthetase |
| SNP21/Chr21 | AA (30) | TT (30) | AT (30) | Intergenic region |
| SNP22/Chr22 | AA (30) | GG (30) | AG (30) | Ankyrin 3b |
| SNP23/Chr23 | AA (28) | TT (30) | AT (30) | Podocalyxin-like protein |
Primers and annotation of eight selected InDels in largemouth bass.
| Indel location | Insertion/deletion size | Primer (5′-3′) | Annotated gene or related region |
|---|---|---|---|
| ID1/Chr17 | +100 | F: ACATTCAGCCCTCTTGACCG | Intergenic region |
| R: GACACGGGGAGATCATGCAA | |||
| ID2/Chr2 | +90 | F: CCTTTGTTAACCTGCCCCCT | Intergenic region |
| R: GTAGTCATGGGACCATCCCC | |||
| ID3/Chr3 | +46 | F: GCATCGTTTCCACAGGTGTC | Intergenic region |
| R: GCAGCTTCCAATGCAACTGTA | |||
| ID4/Chr6 | +87 | F: TCACGCCACATCCAGGTAAG | Intergenic region |
| R: TGCCATAGGTAACTCCCCAGT | |||
| ID5/Chr20 | +83 | F: CGTGTCAGCTAACTACACCTGA | Intergenic region |
| R: ATACTGCCCCGCAAAGGAAA | |||
| ID6/Chr5 | −84 | F: GTCAACCGGTGAACACAACG | Neural-cadherin-like |
| R: ACGTTATCAGCACTGTGCCA | |||
| ID7/Chr17 | −51 | F: AGGGAGAAACCTCATTGGGC | Intergenic region |
| R: TTGCTGGCATCCTCCATAGC | |||
| ID8/Chr23 | −61 | F: CACCAGCCTGCAGGTAAGAA | Intergenic region |
| R: CTTCCAACCACACAAGGTCAG |
“+” and “-” mean insert and deletion in NB, in comparison with FB, respectively.
FIGURE 5PCR amplification results of ID1, ID5, and ID8 in 5 NB, five FB, and five NF individuals, respectively. M, DNA Marker DL 2000. NB, Northern largemouth bass. FB, Florida largemouth bass. NF, the F1 hybrid of the Northern largemouth bass ♀ × Florida largemouth bass ♂.