Literature DB >> 36102968

Vector-borne pathogens of zoonotic concern in dogs from a Quilombola community in northeastern Brazil.

Lucia Oliveira de Macedo1,2, Marcos Antonio Bezerra-Santos3, Carlos Roberto Cruz Ubirajara Filho1,2, Kamila Gaudêncio da Silva Sales4, Lucas C de Sousa-Paula4, Lidiane Gomes da Silva4, Filipe Dantas-Torres4, Rafael Antonio do Nascimento Ramos2, Domenico Otranto5,6.   

Abstract

Canine vector-borne pathogens (CVBPs) comprise a group of disease agents mainly transmitted by ticks, fleas, mosquitoes and sand flies. In this study, we assessed the presence of CVBPs in an Afro-descendent community (Quilombola) of northeastern, Brazil. Dog blood samples (n = 201) were collected and analyzed by rapid test for the detection of antibodies against Leishmania spp., Anaplasma spp., Ehrlichia spp. and Borrelia burgdorferi sensu lato (s.l.), and antigens of Dirofilaria immitis. In addition, polymerase chain reactions were performed for Anaplasmataceae, Babesia spp., Hepatozoon spp., Rickettsia spp. and B. burgdorferi s.l. Overall, 66.7% of the dogs scored positive to at least one pathogen at serological and/or molecular methods. Antibodies against Ehrlichia spp. were the most frequently detected (57.2%; n = 115/201), followed by Anaplasma spp. (8.5%; n = 17/201), Leishmania spp. (8.5%; n = 17/201) and B. burgdorferi s.l. (0.5%; n = 1/201). For D. immitis, 11 out of 201 (5.5%) animals scored positive. At the molecular analysis, 10.4% (n = 21/201) of the samples scored positive for Babesia spp./Hepatozoon spp., followed by Anaplasmataceae (5.0%; n = 10/201) and Rickettsia spp. (3.0%; n = 6/201). All samples were negative for B. burgdorferi s.l. Our data demonstrated the presence of CVBPs in the studied population, with a high seropositivity for Ehrlichia spp. In addition, considering the detection of zoonotic pathogens in dogs and their relationship with people from Quilombola communities, effective control strategies are advocated for minimizing the risk of infection in this socially vulnerable human population and their pets.
© 2022. The Author(s).

Entities:  

Keywords:  Fleas; Hepatozoon canis; Rickettsia felis; Ticks; Vectors; Zoonotic pathogens

Mesh:

Year:  2022        PMID: 36102968      PMCID: PMC9556415          DOI: 10.1007/s00436-022-07661-x

Source DB:  PubMed          Journal:  Parasitol Res        ISSN: 0932-0113            Impact factor:   2.383


Introduction

Canine vector-borne diseases (CVBDs) are caused by a group of pathogens mainly transmitted by ticks (e.g., Babesia spp., Ehrlichia spp., Anaplasma spp., Rickettsia spp.), fleas (e.g., Rickettsia felis, Dipylidium caninum), mosquitoes (e.g., Dirofilaria spp.) and sand flies (e.g., Leishmania spp.) (Otranto 2018; Maggi and Krämer 2019; Alhassan et al. 2021). The zoonotic potential of some CVBD-causing agents represents a threat to human health, especially in the tropics and subtropics, as the climatic conditions of these areas are conducive to the growth and proliferation of arthropod vectors (Dantas-Torres 2008; Maggi and Krämer 2019). The CVBDs of major veterinary and public health concern are leishmaniasis and heartworm disease (HWD), followed by anaplasmosis, ehrlichiosis and babesiosis (Dantas-Torres et al. 2020; Borges et al. 2021). In Brazil, dogs can be infected by zoonotic Leishmania spp., including Leishmania infantum, Leishmania amazonensis and Leishmania braziliensis (Belo et al. 2013; Souza et al. 2019). Leishmania spp. infection occurs mostly through the bites of infected female phlebotomine sand flies (Alvar et al. 2012). Leishmaniases are still predominantly rural diseases, with wildlife species (e.g., foxes, opossums and rodents) acting as principal hosts of the parasites (Roque and Jansen 2014; Bezerra-Santos et al. 2021). However, dogs are considered the main reservoirs of L. infantum and source of infection to the vectors in both rural and urban areas (Dantas-Torres 2007). Another important parasite of zoonotic potential in Brazil is Dirofilaria immitis, the agent of HWD, often characterized by severe cardiopulmonary disorders which may be fatal. The distribution of D. immitis overlaps that of mosquito vectors of the genera Culex, Aedes, Ochlerotatus and Anopheles (Ahid and Lourenço-Oliveira 1999; Simón et al. 2012; Ramos et al. 2016; Maggi and Krämer 2019; Brianti et al. 2021; Mendoza-Roldan et al., 2021). For example, a previous study demonstrated the presence of competent vectors of D. immitis (e.g., Ochlerotatus scapularis and Ochlerotatus taeniorhynchus) occurring throughout the year in an endemic area of Brazil (Labarthe et al. 1998), with a correlation between the high populations of arthropod vectors and the odds of infection in dogs and humans (Bendas et al. 2019). Anaplasma platys, Ehrlichia canis and Babesia vogeli are the major causative agents of canine anaplasmosis, ehrlichiosis and babesiosis in Brazil (Dantas-Torres 2008), which are characterized by a variety of clinical signs (e.g., pyrexia, lethargy, weight loss, lymphadenopathy, bleeding tendencies, hemoglobinuria, petechiae, jaundice and even death) (Ybañez et al. 2018) and hematological alterations (e.g., anemia and thrombocytopenia) in infected animals. The main biological vector of these hemoparasites is the brown dog tick (i.e., the recently proposed Rhipicephalus linneai, also referred to as the tropical lineage of Rhipicephalus sanguineus sensu lato by Šlapeta et al. 2021), which has also been associated with the transmission of other pathogens, such as Hepatozoon canis and bacterial species belonging to the spotted fever group rickettsiae (SFGR) (Ramos et al. 2014; Santos et al. 2018; Alhassan et al. 2021). Animals coinfected by multiple CVBD-causing pathogens are at higher risk of developing severe clinical signs (de Caprariis et al. 2011). For example, a study estimated that dogs with leishmaniasis are 12 times more likely to be coinfected with E. canis compared to healthy ones, with increased severity of clinical presentation, and potential reduction in the efficacy of the treatment (Attipa et al. 2018). In Brazil, there are an estimated number of about 3,000 Quilombola communities composed by descendants of slaves of African origin, usually located in remote rural areas (Conde et al. 2020). People from these communities commonly live from agriculture and/or use of forest resources (Conde et al. 2020). In these areas wandering dogs, as well as owned restricted and semi-restricted ones are usually part of the domestic fauna. Data on canine zoonotic pathogens from these communities are scarce, with a single report recording a prevalence of 8.4% for L. infantum in skin samples from dogs (Silva et al. 2017). Nevertheless, the presence of wandering dogs, vectors and deficient sanitary conditions suggest that other pathogens of veterinary and public health concern may occur in these areas. Thus, the present study was aimed to assess the occurrence of CVBD-causing pathogens in a Quilombola community in the northeastern region of Brazil.

Material and methods

Study area

This study was conducted in a Quilombola community in the municipality of Garanhuns (08°53′25" S, 36°29′34" W; 896 m above sea level), Pernambuco, Northeastern Brazil. Semi-restricted or unrestricted dogs are frequently present in the study area and live in contact with other domestic animals (e.g., cats, birds and domestic ruminants) and wildlife (e.g., opossums, rodents and birds). The study area has a tropical savanna climate with dry-summer characteristics, which corresponds to the Köppen climate classification category “Aw,” presenting a mean annual temperature of 20 ºC (range, 16–30 ºC), relative humidity of 76% (38–100%) and precipitation of 873 mm (751–1000 mm) (Barbosa et al. 2016), with rains concentrated from April to July (Andrade et al. 2008).

Sample collection and laboratory analysis

From July 2021 to January 2022, blood samples (1.5–5 ml) were collected from cephalic vein of 201 dogs. Samples were divided into two aliquots: one stored in tubes containing EDTA, and the other in tubes without anticoagulant, for molecular and serological analysis, respectively. Data on sex, dog categories (i.e., restricted and semi-restricted according to Otranto et al. 2017), overnight stay and the presence of ectoparasites were recorded for each dog. The serum samples were tested by an immunochromatographic assay (DPP® CVL, BioManguinhos) for anti-Leishmania spp. antibodies and by an ELISA rapid test (SNAP® 4Dx Plus, Idexx), which detects antibodies to Anaplasma spp. (A. platys/A. phagocytophilum), Ehrlichia spp. (E. canis/E. ewingii), B. burgdorferi s.l. and antigens of D. immitis. All tests were performed according to the manufacturer’s instructions. Genomic DNA was extracted from 200 μl aliquots of EDTA-treated blood samples using GenUP DNA Kit (Biotechrabbit, Berlin, Germany) following the manufacturer’s instructions. All samples were tested for the presence of Anaplasmataceae, Borrelia spp., Rickettsia spp., Babesia spp. and Hepatozoon spp. by conventional PCR, using the primers reported in Table 1.
Table 1

Primers for the detection of vector-borne pathogens in Brazil

PathogenGeneAmpliconsize (bp)Primer sequencesReference
Rickettsia spp.glta401

5’GCAAGTATCGGTGAGGATGTAAT3’

5’GCTTCCTTAAAATTCAATAAATCAGGAT3’

Labruna et al. (2004)
Rickettsia spp.ompA532

5’ATGGCGAATATTTCTCCAAAA3’

5’AGTGCAGCATTCGCTCCCCCT3’

Regnery et al. (1991)
Anaplasmataceae16S345

5’GGTACCYACAGAAGAAGTCC3’

5’TAGCACTCATCGTTTACAGC3’

Parola et al. (2000)
Borrelia spp.fla482

5’AGAGCAACTTACAGACGAAATTAAT3’

5’CAAGTCTATTTTGGAAAGCACCTAA3’

Skotarczak et al. (2002)

Babesia spp.

/Hepatozoon spp.

18S

rRNA

350–400

5’CCAGCAGCCGCGGTAAATTC3’

5’CTTTCGCAGTAGTTYGTCTTTAACAAATCT3’

Tabar et al. (2008)
Primers for the detection of vector-borne pathogens in Brazil 5’GCAAGTATCGGTGAGGATGTAAT3’ 5’GCTTCCTTAAAATTCAATAAATCAGGAT3’ 5’ATGGCGAATATTTCTCCAAAA3’ 5’AGTGCAGCATTCGCTCCCCCT3’ 5’GGTACCYACAGAAGAAGTCC3’ 5’TAGCACTCATCGTTTACAGC3’ 5’AGAGCAACTTACAGACGAAATTAAT3’ 5’CAAGTCTATTTTGGAAAGCACCTAA3’ Babesia spp. /Hepatozoon spp. 18S rRNA 5’CCAGCAGCCGCGGTAAATTC3’ 5’CTTTCGCAGTAGTTYGTCTTTAACAAATCT3’ PCR products were purified (Thermo Scientific™ FastAP™ Thermosensitive Alkaline Phosphatase) and sequenced using the same forward and reverse primer sets reported in Table 1 for each pathogen, employing the Big DyeTerminator v.3.1 chemistry in a 3130 Genetic analyzer (Applied Biosystems, California, USA) in an automated sequencer (ABI-PRISM 377). Nucleotide sequences were edited, aligned and analyzed using Mega 7.0 software and compared with reference sequences available on GenBank database using Basic Local Alignment Search Tool (BLAST; http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Data analysis

Descriptive statistics were used to calculate relative and absolute frequencies. Exact binominal 95% confidence intervals (CIs) were established for proportions. The chi-square with Yates correction was used to compare proportions with a p value < 0.05 regarded as statistically significant. Analyses were performed using Epitools-Epidemiological Calculators (https://epitools.ausvet.com.au/).

Results

Out of 201 examined dogs, 134 (66.7%; 95% CI = 59.9–72.8%) tested serologically or molecularly positive to at least one vector-borne pathogen. Particularly, Ehrlichia spp. was the most frequently detected by serology in 115 (57.2%; 95% CI = 50.3–63.9%), followed by Anaplasma spp. 17 (8.5%; 95% CI = 5.3–13.1%), Leishmania spp. 17 (8.5; 95% CI = 5.3–13.1%) and D. immitis 11 (5.5%; 95% CI = 3.1–9.5%). In addition, simultaneous positivity was observed in 16.9% (n = 34) of dogs, mostly by Ehrlichia spp. with other pathogens (Table 2). Only one female dog was seropositive for B. burgdorferi s.l. with co-positivity to Ehrlichia spp. Data on sex, dog category, overnight stay and the presence of ectoparasites are reported in Table 3, along with the percentage of dogs positive for each pathogen.
Table 2

Simultaneous positivity by canine vector-borne pathogens in Brazil

PathogenPrevalence % (n)95% CI
Ehrlichia spp. + Anaplasma spp.6.5% (13)3.8–10.7
Ehrlichia spp. + Leishmania spp.5.0% (10)2.7–8.9
Ehrlichia spp. + D. immitis3.0% (6)1.4–6.4
Ehrlichia spp. + D. immitis + Anaplasma spp.1.0% (2)0.3–3.6
Ehrlichia spp. + Borrelia burgdorferi0.5% (1)0.1–2.8
Ehrlichia spp. + Anaplasma spp. + Leishmania spp.0.5% (1)0.1–2.8
D. immitis + Leishmania spp.0.5% (1)0.1–2.8
Table 3

Number and percentage of dogs seropositive to Leishmania spp., Ehrlichia spp., Anaplasma spp. and Dirofilaria immitis, according to their sex, mobility, overnight stay and presence of ectoparasites

VariablesLeishmania spp.n/N (%; 95% CI)χ2;p valueEhrlichia spp.n/N (%; 95% CI)χ2;p valueAnaplasma spp.n/N (%; 95% CI)χ2;p valueDirofilaria immitisn/N (%; 95% CI)χ2;p value
Sex
Male8/96 (8.3%; 4.3–15.6)

0.0373;

p = 0.85

48/96 (50.0%; 40.2–259.8)

3.363;

p = 0.66

6/96 (6.2%; 2.9–13.0)

0.6754

p = 4.11

4/96 (4.2%; 1.6–10.2)

0.219;

p = 6.39

Female9/105 (8.6% 4.6–15.5)67/105 (63.8%; 54.3–72.4)11/105 (10.5%; 6.0–17.8)7/105 (6.7%; 3.3–13.1)
Mobility
Semi-restricted17/169 (10.1%; 6.4–15.5)NP101/169 (59.8%; 52.2–66.9)

2.2022;

p = 1.37

13/169 (7.7%; 4.6–12.7)

0.3023;

p = 5.82

11/169 (6.6%; 3.7–11.4)NP
Unrestricted0/32 (0)14/32 (43.8%; 28.2–60.7)4/32 (12.5%; 5.0–28.1)0/32 (0)
Overnight stay
Peridomicile17/167 (10.2%; 6.0–15.7)NP101/167 (60.5%; 52.9–67.6)

3.5372;

p = 0.59

13/167 (7.8%; 4.6–12.9)

0.1782;

p = 6.72

11/167 (6.6%; 3.7–11.4)NP
Intradomicile0/34 (0)14/34 (41.2%; 26.4–57.8)4/34 (11.8%; 4.7–26.6)0/34 (0)
Ectoparasites
Yes7/60 (11.7%; 5.8–22.2)

0.6235;

p = 4.29

41/60 (68.3%; 55.8–78.7)

3.6968;

p = 0.54

6/60 (10.0%; 4.7–20.1)

0.0555;

p = 8.13

8/60 (13.3%; 6.9–24.2)

8.165;

p = 0.04

Not10/141 (7.1%; 3.9–12-6)74/141 (52.5%; 44.3–60.5)11/141 (7.8% 4.4–13.4)3/141 (2.1%; 0.7–6.1)

CI, confidence interval; n, number of dogs positive; N, number total of dogs. χ2 = chi-square. Significant at p < 0.05. NP indicates

data not possible to calculate

Simultaneous positivity by canine vector-borne pathogens in Brazil Number and percentage of dogs seropositive to Leishmania spp., Ehrlichia spp., Anaplasma spp. and Dirofilaria immitis, according to their sex, mobility, overnight stay and presence of ectoparasites 0.0373; p = 0.85 3.363; p = 0.66 0.6754 p = 4.11 0.219; p = 6.39 2.2022; p = 1.37 0.3023; p = 5.82 3.5372; p = 0.59 0.1782; p = 6.72 0.6235; p = 4.29 3.6968; p = 0.54 0.0555; p = 8.13 8.165; p = 0.04 CI, confidence interval; n, number of dogs positive; N, number total of dogs. χ2 = chi-square. Significant at p < 0.05. NP indicates data not possible to calculate At the molecular analysis, the dog blood samples showed PCR-positive results for Babesia spp./Hepatozoon spp. in 21 (10.4%; 95% CI = 6.9–15.4%), Anaplasmataceae in 10 (5.0%; 95% CI 2.7–8.9%) and Rickettsia spp. in 6 (3.0%; 95% CI 1.4–6.4%). All samples were PCR-negative for the presence B. burgdorferi s.l., and for the rickettsial ompA gene. According to BLAST analysis, two samples positive for the 18S rRNA gene revealed 100% nucleotide identity with B. vogeli (accession number: MN700646), and 19 samples presented 97.2–100% nucleotide identity with H. canis (accession numbers: MK673842; MK645969; MN791089; MK673839). For the 16S rRNA gene sequences, two samples revealed 100% nucleotide identity with A. platys (accession numbers: MN922611; MN994338; MN922609; MN922608) and eight samples revealed 99.1–100% nucleotide identity with E. canis (accession numbers: MN922610; MN227484; MN227484; MK507008). A single A. platys positive sample was also reagent at serological examination, whereas five E. canis positive samples were detected at both molecular and serological tests. Finally, four samples positive for the gltA gene had 100% nucleotide identity with R. felis sequences (accession numbers: MN817141; MN817140; MT499363). Sequences herein obtained were submitted to GenBank under the accession numbers: OP084684 for Babesia vogeli; OP084681 to OP084683 for Hepatozoon canis; OP082323 for Anaplasma spp.; OP082324 to OP082328 for Ehrlichia spp.; and OP099835 for Rickettsia felis.

Discussion

Data presented herein indicated a high overall level of exposure to vector-borne pathogens in dogs from the Quilombola community in northeastern Brazil. In particular, over 50% of the dogs were seropositive to Ehrlichia spp., which is in line with previous studies conducted in the same region (Figueredo et al. 2017; Dantas-Torres et al. 2020). This may be partly explained by the high prevalence of the brown dog tick on dogs in the study area (Santos et al. 2017; 2018). The seropositivity to other pathogens (i.e., Anaplasma spp., Leishmania spp. and D. immitis) was lower as compared with a recent study conducted in an urban area of Pernambuco (Dantas-Torres et al. 2020). Differences may be related to many eco-epidemiological factors, including the level of exposure to the vectors and climatic factors. For example, in the same area a low occurrence and diversity in sand fly species throughout a one-year sampling period has been demonstrated, with Lutzomyia evandroi being the only species identified (Ubirajara Filho et al. 2020). Among the vector-borne protozoa, H. canis was the most frequently detected molecularly (i.e., n = 19 dogs were infected by H. canis, while only two dogs by B. vogeli). This may be due to the shorter time of circulation of B. vogeli in the blood of infected animals. Epidemiological data from previous studies demonstrated that B. vogeli is highly prevalent in Brazil, with up to 8.2% molecularly positive dogs in Pernambuco (Ramos et al. 2010; Dantas-Torres et al. 2021), 8.0% in São Paulo (O’Dwyer et al. 2009), 10.0% in Paraíba (Rotondano et al. 2015), 15.0% in Ceará (Fonsêca et al. 2022), 30.6% in Minas Gerais (Barbosa et al. 2020) and 14.1% in Rio de Janeiro (Paulino et al. 2018; Camilo et al. 2021). Conversely, H. canis has been reported with lower prevalence (i.e., 0.4% to 5.4%) in Northeastern Brazil (Ramos et al. 2010; Dantas-Torres et al. 2021), differently from the Southeastern region, in which higher prevalence values (i.e., 58.7–79.2%) were reported (Miranda et al. 2014; Spolidorio et al. 2009). The simultaneous detection of Ehrlichia spp. and Anaplasma spp. (6.5%) at PCR and serological tests agrees with previous reports in Pernambuco state in which both pathogens were the most frequently diagnosed molecularly (Ramos et al. 2010). The above picture is probably due to the high abundance of brown dog ticks, which may transmit multiple pathogens simultaneously (Shaw et al. 2001). Similarly, the positivity to both Ehrlichia spp. and Leishmania spp. is of importance due to the implications those pathogens may have in the pathogenesis of CVBD, mainly their clinical presentation, and response to therapy (de Caprariis et al. 2011; Attipa et al. 2018). For example, a study on the experimental infection of E. canis and A. platys in dogs demonstrated that these pathogens cause various changes in pathophysiological parameters (i.e., more pronounced anemia and thrombocytopenia). Therefore, raising awareness of the risks of simultaneous positivity when animals are exposed to multiple tick-borne pathogens (Gaunt et al. 2010). Rickettsia felis, a zoonotic rickettsia belonging to the SFG, previously described infecting human patients from Kenya (Richards et al. 2010) and Serbia (Banović et al. 2021), was molecularly detected for the first time in the dogs herein assessed. This pathogen was also detected in fleas (Ctenocephalides felis) and ticks (Dermacentor nitens) collected from dogs and horses from the same study area (Oliveira et al. 2020). Rickettsia felis is widespread in Brazil, and its distribution overlaps that of C. felis, its main biological vector (Horta et al. 2014). This finding is particularly important from a One Health perspective, considering that the local circulation of zoonotic pathogens may represent an eminent risk for the Quilombola community.

Conclusion

Data herein presented demonstrated that different pathogens (i.e., B. vogeli, A. platys, E. canis, H. canis and R. felis) are prevalent in dogs from the studied Quilombola community in northeastern, Brazil. Considering the occurrence of zoonotic pathogens in dogs and their close relationship with humans living in these communities, increased awareness and effective control strategies are advocated for minimizing the risk of infection in animals and humans from Quilombola communities, where the access to veterinary services is generally limited.
  51 in total

1.  Humans infested with Ixodes ricinus are exposed to a diverse array of tick-borne pathogens in Serbia.

Authors:  Pavle Banović; Adrian Alberto Díaz-Sánchez; Clemence Galon; Verica Simin; Dragana Mijatović; Dasiel Obregón; Sara Moutailler; Alejandro Cabezas-Cruz
Journal:  Ticks Tick Borne Dis       Date:  2020-11-23       Impact factor: 3.744

2.  Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes.

Authors:  R L Regnery; C L Spruill; B D Plikaytis
Journal:  J Bacteriol       Date:  1991-03       Impact factor: 3.490

3.  The "tropical lineage" of the brown dog tick Rhipicephalus sanguineus sensu lato identified as Rhipicephalus linnaei ().

Authors:  Jan Šlapeta; Shona Chandra; Bruce Halliday
Journal:  Int J Parasitol       Date:  2021-03-11       Impact factor: 3.981

4.  Detection of mixed Leishmania infections in dogs from an endemic area in southeastern Brazil.

Authors:  Natália Alves Souza; Rodrigo Souza Leite; Soraia de Oliveira Silva; Michele Groenner Penna; Liza Figueiredo Felicori Vilela; Maria Norma Melo; Antero Silva Ribeiro de Andrade
Journal:  Acta Trop       Date:  2019-02-14       Impact factor: 3.112

5.  Detection of Rickettsia felis in ectoparasites collected from domestic animals.

Authors:  Jéssica Cardoso Pessoa de Oliveira; Guilherme Henrique Reckziegel; Carlos Alberto do Nascimento Ramos; Alessio Giannelli; Leucio Câmara Alves; Gílcia Aparecida de Carvalho; Rafael Antonio Nascimento Ramos
Journal:  Exp Appl Acarol       Date:  2020-05-29       Impact factor: 2.132

6.  Molecular epidemiology and prevalence of babesial infections in dogs in two hyperendemic foci in Brazil.

Authors:  Filipe Dantas-Torres; Joanna Alexandre; Débora Elienai de Oliveira Miranda; Luciana Aguiar Figueredo; Kamila Gaudêncio da Silva Sales; Lucas Christian de Sousa-Paula; Lidiane Gomes da Silva; Guilherme Ribeiro Valle; Vitor Márcio Ribeiro; Domenico Otranto; Katrin Deuster; Matthias Pollmeier; Gertraut Altreuther
Journal:  Parasitol Res       Date:  2021-06-10       Impact factor: 2.289

7.  Zoonotic Dirofilaria immitis and Dirofilaria repens infection in humans and an integrative approach to the diagnosis.

Authors:  Jairo Alfonso Mendoza-Roldan; Simona Gabrielli; Antonio Cascio; Ranju R S Manoj; Marcos Antonio Bezerra-Santos; Giovanni Benelli; Emanuele Brianti; Maria Stefania Latrofa; Domenico Otranto
Journal:  Acta Trop       Date:  2021-08-05       Impact factor: 3.112

8.  Filarioids infecting dogs in northeastern Brazil.

Authors:  Rafael Antonio Nascimento Ramos; Ana Gabriela de Oliveira do Rêgo; Everton Diogo de Farias Firmino; Carlos Alberto do Nascimento Ramos; Gílcia Aparecida de Carvalho; Filipe Dantas-Torres; Domenico Otranto; Leucio Câmara Alves
Journal:  Vet Parasitol       Date:  2016-06-18       Impact factor: 2.738

9.  Canine vector-borne diseases in Brazil.

Authors:  Filipe Dantas-Torres
Journal:  Parasit Vectors       Date:  2008-08-08       Impact factor: 3.876

Review 10.  A review on the occurrence of companion vector-borne diseases in pet animals in Latin America.

Authors:  Ricardo G Maggi; Friederike Krämer
Journal:  Parasit Vectors       Date:  2019-03-28       Impact factor: 3.876

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.