| Literature DB >> 36092886 |
Chenyu Zhao1,2, Xiaoliu Shi2, Yonghong Zhang3, Hui Huang2.
Abstract
Background: Dubin-Johnson syndrome (DJS) is a rare autosomal recessive genetic disease which is caused by mutations in the ABCC2 gene; it is characterized by chronic hyperbilirubinemia. Here, we report two pedigrees affected with DJS which were caused by three novel pathogenic ABCC2 mutations. Case summary: The two patients exhibited intermittent low-grade, predominantly conjugated hyperbilirubinemia and showed no other abnormalities. They were diagnosed clinically with DJS. Three novel pathogenic ABCC2 mutations-c.2980delA, c.1834C>T, and c.4465_4473delinsGGCCCACAG-were identified by whole-exome sequencing. These mutations could be responsible for DJS in the two pedigrees. The genetic test confirmed the diagnosis of DJS.Entities:
Keywords: ABCC2; Dubin–Johnson syndrome; hyperbilirubinemia; multidrug resistance-associated protein 2; mutation
Year: 2022 PMID: 36092886 PMCID: PMC9452728 DOI: 10.3389/fgene.2022.895247
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
FIGURE 1Family tree and genetic analysis of Family 1. (A) Proband III-3 was diagnosed with DJS. (B) Sanger sequencing revealed a compound heterozygous (c.2980delA and c.1834 C>T) ABCC2 mutation in III-3. IV-1 shared the heterozygous c.1834 C>T variant.
Clinical laboratory tests and imaging examinations in the patients with Dubin–Johnson syndrome.
| Patients number | WBC (109/L) | Hb (g/L) | PLT (109/L) | ALT/AST (u/l) | Alb (g/L) | TBIL/DBIL (umol/l) | TBA (umol/l) | GGT (u/l) | ALP (u/l) | Abdominal imaging examination |
|---|---|---|---|---|---|---|---|---|---|---|
| Patient 1 | 6.92 | 126 | 257 | 35.4/12.3 | 36.5 | 82.8/65.1 | 8.7 | 17.9 | NA | Splenomegaly and hepatic hemangioma |
| Patient 2 | 3.71 | 155 | 263 | 17.8/18.9 | 46.1 | 110.6/70.4 | 3.5 | NA | NA | Hepatomegaly |
WBC, white blood cells (normal range: 3.5–9.5*109/L); Hb, hemoglobin (normal range: 130–170 g/L); PLT, platelet (125–350*109/L); ALT, alanine aminotransferase (normal range: 9–50 u/l); AST, aspartate aminotransferase (normal range:15–40 u/l); Alb, albumin (normal range: 40–50 g/L); TBIL, total bilirubin (normal range: 3.4–17.1 umol/l); DBIL, direct bilirubin (normal range: normal range: 0–6 umol/l); TBA: total bile acid (normal range: 0–10 umol/l); GGT, gamma-glutamyl transpeptidase (normal range: 35–100 u/l); NA: not available.
Variants of ABCC2 in the patients with Dubin–Johnson syndrome.
| Homozygous/heterozygous | Mutation | Type | Exon | Location in MRP2 protein | Origin | ACMG classification | |
|---|---|---|---|---|---|---|---|
| Patient 1 | Compound heterozygous | c.2980delA/p. I994Lfs*29 | Deletion | Exon22 | MSD3 | NA | Pathogenic |
| c.1834C>T/p. R612W | Missense | Exon14 | Peptide chain linking MSD2 and NBD1 | NA | Likely pathogenic | ||
| Patient 2 | Compound heterozygous | c.2980delA/p. I994Lfs*29 | Deletion | Exon22 | MSD3 | Mother | Pathogenic |
| c.4465_4473delinsGGCCCACAG/p. I1489_I1491delinsGPQ | Deletion-insertion | Exon31 | NBD2 | Father | Likely pathogenic |
ACMG, American college of medical genetics and genomics; MSD, membrane spanning domain; NBD, nucleotide binding domains1.
FIGURE 2The family tree and genetic analysis of Family 2. (A) Proband II-2 suffered from DJS. (B) Direct sequencing showed a compound heterozygous (c.2980delA and c.4465_4473 delinsGGCCCACAG) ABCC2 mutation in II-2. I-1 was affected with the heterozygous c.4465_4473delinsGGCCCACAG mutation. II-2 harbored the heterozygous c.2980delA variant. (C) Locations of the mutations in MRP2. The schematic diagram of MRP2 was generated using Protter software (http://wlab.ethz.ch/protter/start/). MSD: membrane spanning domains, NBD: nucleotide binding domains.
Primer sequences used for mutation sequencing of ABCC2 gene.
| Mutations in | Primer sequences 5'→3' |
|---|---|
| Exon 14 | F: GGCAGGAGGTAGTTTCTGGA |
| R: TGCAGGATTCCCTGCTTATC | |
| Exon 22 | F: GCATTGTTCTATTATCCTTCCTG |
| R: ATGCATGGACGAAACCAAAG | |
| Exon 31 | F: ATTCCAGGGGAATTTTGGAG |
| R: CTCACGGCTTGAGCTTCC |
F, forward; R, revers.
Other bilirubin-metabolism related mutation in the patients
| Patient | Gene | Mutation | Exon | Related diseases |
|---|---|---|---|---|
| Patient 1 |
| c.211G>A, p.G71R, g.234669144G>A (heterozygous) | Exon 1 | GS, CNS-I, CNS-II |
GS, Gilbert syndrome; CNS-I, Criggler–Najjar syndrome I; CNS-II, Criggler–Najjar syndrome