Literature DB >> 36092354

Luteolin suppresses the growth of colon cancer cells by inhibiting the IL-6/STAT3 signaling pathway.

Jingwen Jiang1, Fengting Zhu1, Hui Zhang1, Tao Sun2, Fangfang Fu1, Xuewu Chen1, Yanhong Zhang3.   

Abstract

Background: Despite the remarkable progression in colon cancer treatment in recent years, the pathological mechanism underlying this disease remains unclear. This study aimed to discuss the potential of luteolin in the treatment of colon cancer, from the perspective of traditional Chinese medicine, with a particular focus on the tumor microenvironment.
Methods: Reverse transcription quantitative polymerase chain reaction and western blot were used to analyze the effects of luteolin on interleukin (IL)-6/signal transducer and activator of transcription 3 (STAT3)/Phospho-STAT3. Enzyme-linked immunosorbent assay was used to analyze the protein secretion of IL-6. Proliferation and transwell assays were used to analyze the growth and migration of luteolin and IL-6 in colon cancer cells, respectively.
Results: Stimulation with lipopolysaccharides (LPS) promoted the M1 polarization of macrophages and increased the expression and secretion of IL-6. However, the presence of luteolin inhibited the effects of LPS. M1 polarization increased the proliferation rate, migration and invasion ability, and phosphorylation of STAT3 in colon cancer cells (SW620 and SW480). Luteolin inhibited these effects by reducing M1 polarization. To confirm that the action of luteolin is mediated by IL-6/STAT3 signaling, we treated SW620 and SW480 cells with recombinant IL-6 protein and anti-IL-6 antibody. IL-6 was observed to promote cell proliferation, enhance migration and invasion, and increase STAT3 phosphorylation. The opposite effect was observed with the anti-IL-6 antibody. In addition, IL-6 promoted LPS-induced M1 polarization, while the anti-IL-6 antibody enhanced the decrease in luteolin-induced M1 polarization. Conclusions: Luteolin suppressed the growth and migration/invasion potential of colon cancer cells by inhibiting the IL-6/STAT3 signaling pathway. 2022 Journal of Gastrointestinal Oncology. All rights reserved.

Entities:  

Keywords:  Interleukin 6 (IL-6); colon cancer; lipopolysaccharide (LPS); luteolin; signal transducer and activator of transcription 3 (STAT3)

Year:  2022        PMID: 36092354      PMCID: PMC9459197          DOI: 10.21037/jgo-22-507

Source DB:  PubMed          Journal:  J Gastrointest Oncol        ISSN: 2078-6891


Introduction

With the advancements in medical technology and research, the prognosis of patients with stage I and II colon cancer has improved significantly, but the mortality rate remains high (1,2). Determining the pathological mechanism of colon cancer remains the focus of scientific research (3). Traditional Chinese medicine (TCM) is used to treat various diseases; it exhibits less toxicity and side effects and markedly improves the quality of life of patients (4-6). Examples of TCM include the anti-inflammatory effects of Qishen Yiqi dripping pills (7) and the antioxidant effects of tanshinone (8). Among the compounds utilized in TCM, luteolin is a natural flavonoid that is widely used as an anti-inflammatory (9), antioxidant (10), uric acid lowering (11), and anti-tumor (12) drug. In addition, a study by Ambasta et al. (13) reported that luteolin can treat colon cancer by modulating multiple signaling cascades. However, the mechanism underlying the effects of luteolin in colon cancer remains unclear. The human leukemia mononuclear cell line (THP-1) has been widely employed to study the functions, signaling pathways, nutrition, and drug transport of monocytes/macrophages (14,15), and Phorbol 12-myristate 13-acetate (PMA) treatment is used to induce macrophage activation to establish an in vitro model for immunomodulatory research studies. Lipopolysaccharide (LPS) stimulation polarizes THP-1 macrophages into the M1 phenotype and releases cytokines such as tumor necrosis factor (TNF)-α and interleukin 6 (IL-6), which could be used as an inflammation model to explore the anti-inflammatory effects of various drugs (16-18). IL-6/signal transducer and activator of transcription 3 (STAT3), an important signaling pathway, regulates the progression of several cancers, including colorectal cancer (19) and hepatocellular carcinoma (20), and is a promising target for cancer immunotherapy (21). In addition, studies have shown that the inflammatory tumor microenvironment can promote the activation of IL-6/STAT3, leading to cancer cell metastasis (22-24). Whether IL-6/STAT3 activation can be inhibited by luteolin and the underlying mechanism is still unknown. In this study, we induced the growth of colon cancer cells by macrophage M1 polarization to explore the potential of luteolin in the treatment of colon cancer as well as its possible pharmacological and molecular mechanisms. The results of this study provide a theoretical basis for the treatment of colon cancer with luteolin. We present the following article in accordance with the MDAR reporting checklist (available at https://jgo.amegroups.com/article/view/10.21037/jgo-22-507/rc).

Methods

Cell culture, THP-1 polarization, and transwell assay

Human colon cancer cell lines (SW480 and SW620) were purchased from American Type Culture Collection (Virginia, USA) and cultured in Leibovitz’s L-15 medium (Gibco, Thermo Fisher Scientific, Inc., Massachusetts, USA). Human monocytic leukemia (THP-1) was purchased from Procell (Wuhan, China) and cultured in Roswell Park Memorial Institute-1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco) at 37 ℃ and 5% carbon dioxide. To induce M1 polarization of the macrophages, 320 nmol/L PMA was added to the lower chamber of the transwell and incubated for 12 h (25), and then 1 µg/mL LPS was added to polarize the macrophages (26). SW480 and SW620 cells (1×105) were inoculated in the upper chamber of the transwell and incubated with IL-6 (50 ng/mL, ab9627, Abcam, Cambridge, UK) or anti-IL-6 antibody (20 ng/mL, ab233706, Abcam) for 24 h (27). For the migration experiment, the cells were incubated for 24 h following the addition of 10% FBS to the lower chamber culture medium. Next, the cells were washed twice with phosphate buffer solution and fixed with absolute ethanol for 30 min, and finally stained with 0.1% crystal violet. SW480 and SW620 cells were counted using a light microscope (Olympus Corporation, Tokyo, Japan; magnification, ×200). In contrast to the migration assay, Matrigel® (BD Biosciences, New Jersey, USA) was used in the invasion experiment to coat the insert at 37 ℃ for 6 hours.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay

Total ribonucleic acid (RNA) was extracted from the SW480 and SW620 cells using TRIzol reagent (Gibco). After centrifugation at 13,000 × g (4 ℃, 10 min), 10 µL diethyl pyrocarbonate-treated water (Invitrogen, Thermo Fisher Scientific, Inc.) was added to the precipitate and RNA was reverse-transcribed into complementary DNA using the PrimeScript RT kit (Takara Bio, Japan). The SYBR® Premix Ex TaqTM II kit (Takara) was used to perform RT-qPCR analysis on the Applied Biosystems®7500 Real-Time PCR system (California, USA). PCR experiments were carried out according to the following steps: 95 ℃ for 10 min, 55 ℃ for 2 min, 72 ℃ for 2 min, followed by 40 cycles of 95 ℃ for 15 s and 60 ℃ for 32 s. The sequences of the primer pairs used are listed in . The IL-6 level was normalized to that of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and calculated using the 2−ΔΔCt method (28).
Table 1

Sequences of the primer pairs used in this study

Gene symbolForward primer 5'-3'Reverse primer 5'-3'
IL-6GGCGTCCGAAGTATGAGTCCTGCAACTTCCAAGCTTCGTC
GAPDH GCTCATTTGCAGGGGGGAGGTTGGTGGTGCAGGAGGCA

GAPDH was used to normalize IL-6 expression. IL-6, interleukin 6; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

GAPDH was used to normalize IL-6 expression. IL-6, interleukin 6; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Enzyme-linked immunosorbent assay (ELISA)

The SW480 and SW620 cell supernatants were collected to analyze the levels of IL-6. The IL-6 Quantikine ELISA kit (R6000B; R&D Systems, Minneapolis, MN, USA) was used according to the manufacturer’s instructions.

Western blotting

The SW480 and SW620 cells were lysed using Radio Immunoprecipitation Assay lysis buffer (Solarbio, Beijing, China). Protein concentrations were estimated using a bicinchoninic acid protein assay kit (Solarbio). Denatured proteins were resolved using 10% Sodium Dodecyl Sulfate-polyacrylamide gel electrophoresis (Beyotime, Shanghai, China) and transferred to a polyvinylidene fluoride membrane. 5% bovine serum albumin (Beyotime) was used to block the membrane, which was incubated (overnight; 4 ℃) with the anti-STAT3 (1:1,000; ab68153; Abcam, Cambridge, UK) and anti-phospho (p)-STAT3 (1:2,000; ab76315; Abcam) primary antibodies. The membranes were washed twice with Tris Buffered Saline (containing 0.1% Tween-20) buffer (Solarbio), for 10 min each time, and incubated (2 h; 25 ℃) with goat anti-rabbit antibody (1:20,000, ab205718; Abcam). Anti-GAPDH antibody (1:5,000, ab181602; Abcam) was used as a loading control.

Proliferation assay

Cell Counting Kit-8 (CCK8) reagent (Solarbio; 10 µL) was added to 96-well plates (containing SW480 and SW620; 4×103 cells/well) at 0 h and 72 h, respectively. The absorbance was measured at 490 nm using an enzyme-labeled instrument (Thermo Fisher Scientific) after 60 min incubation in the dark at 20 ℃.

Statistical analysis

Data are presented as mean ± standard deviation (SD) from triplicate experiments. Statistical analysis was performed using one-way Analysis of Variance and Bonferroni post hoc tests. The Student’s t-test was used for independent two-group analyses. Differences were considered significant at P<0.05.

Results

Effect of luteolin on M1 polarization

The RT-qPCR and ELISA results showed that IL-6 expression and secretion increased in macrophages after M1 polarization compared to control macrophages that were not treated with LPS. When treated with different concentrations of luteolin (0, 10, 30, and 60 µM), the expression of IL-6 gradually decreased at the messenger RNA (mRNA) and protein levels (). It is worth noting that no notable differences were observed in IL-6 expression or secretion in response to treatment with 30 or 60 µM of luteolin. Therefore, we chose 30 µM of luteolin as the treatment dose for subsequent experiments.
Figure 1

Luteolin inhibits the effects of M1 polarization on SW620 and SW480 cells. (A) RT-qPCR analysis of the impact of luteolin and M1 polarization on the expression of IL-6. (B) ELISA showed the impact of luteolin and M1 polarization on IL-6 protein secretion. (C) ELISA demonstrated the impact of luteolin and M1 polarization on IL-6 protein secretion in SW480 and SW620 cells. (D) CCK-8 assay assessed the impact of luteolin and M1 polarization on the proliferation rate of SW480 and SW620 cells. (E) Transwell assay showed the impact of luteolin and M1 polarization on the migration and invasion capabilities of SW480 and SW620 cells. Cells were stained with crystal violet. (F) Western blot analysis showing the impact of luteolin and M1 polarization on the phosphorylation level of STAT3. *, LPS group vs. Macrophages group, P<0.05; #, luteolin (10, 30, and 60 µM) group vs. LPS group, P<0.05. LPS, lipopolysaccharide; IL-6, interleukin 6; STAT3, signal transducer and activator of transcription 3; RT-qPCR, reverse transcription quantitative polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; CCK-8, Cell Counting Kit-8.

Luteolin inhibits the effects of M1 polarization on SW620 and SW480 cells. (A) RT-qPCR analysis of the impact of luteolin and M1 polarization on the expression of IL-6. (B) ELISA showed the impact of luteolin and M1 polarization on IL-6 protein secretion. (C) ELISA demonstrated the impact of luteolin and M1 polarization on IL-6 protein secretion in SW480 and SW620 cells. (D) CCK-8 assay assessed the impact of luteolin and M1 polarization on the proliferation rate of SW480 and SW620 cells. (E) Transwell assay showed the impact of luteolin and M1 polarization on the migration and invasion capabilities of SW480 and SW620 cells. Cells were stained with crystal violet. (F) Western blot analysis showing the impact of luteolin and M1 polarization on the phosphorylation level of STAT3. *, LPS group vs. Macrophages group, P<0.05; #, luteolin (10, 30, and 60 µM) group vs. LPS group, P<0.05. LPS, lipopolysaccharide; IL-6, interleukin 6; STAT3, signal transducer and activator of transcription 3; RT-qPCR, reverse transcription quantitative polymerase chain reaction; ELISA, enzyme-linked immunosorbent assay; CCK-8, Cell Counting Kit-8.

Luteolin inhibited the effect of M1 macrophages on the SW620 and SW480 cells

To explore the effect of M1 macrophages on colon cancer cells, they were co-cultured with SW620 and SW480 cells for 24 h. The results of ELISA using the supernatant showed that compared with normal cells, M1 macrophages promoted IL-6 secretion from colon cancer cells, and the presence of luteolin inhibited M1 polarization (). The CCK-8 and transwell assay results showed that compared with normal cells, cell proliferation, migration, and invasion induced by M1 macrophages were inhibited by luteolin (). Western blot analysis showed that M1 polarization promoted the phosphorylation of STAT3, while luteolin inhibited M1 polarization (). Therefore, luteolin effectively inhibited the expression of IL-6 mediated by M1 polarization, activation of the STAT3 pathway, and growth of the SW620 and SW480 cells.

Effect of the anti-IL-6 antibody and IL-6 on SW620 and SW480 cells

To confirm the role of the IL-6/STAT3 signaling pathway in M1 polarization, we incubated SW620 and SW480 cells with IL-6 and anti-IL-6 antibodies, respectively. The results revealed although the addition of IL-6 promoted cell proliferation, migration, and invasion, and activated the STAT3 signaling pathway; treatment with the anti-IL-6 antibody had no significant effect on cell function or the STAT3 signaling pathway ().
Figure 2

The anti-IL-6 antibody reversed the effect of IL-6 on SW620 and SW480 cells. (A) CCK-8 assay showed the impact of IL-6 and anti-IL-6 antibodies on the proliferation rate of SW480 and SW620 cells. (B) Transwell assay showed the impact of IL-6 and anti-IL-6 antibodies on the migration and invasion capabilities of SW480 and SW620 cells. Cells were stained with crystal violet. (C) Western blot analysis showing the impact of IL-6 and anti-IL-6 antibodies on the phosphorylation level of STAT3. *P<0.05. IL-6, interleukin 6; STAT3, signal transducer and activator of transcription 3; CCK-8, Cell Counting Kit-8.

The anti-IL-6 antibody reversed the effect of IL-6 on SW620 and SW480 cells. (A) CCK-8 assay showed the impact of IL-6 and anti-IL-6 antibodies on the proliferation rate of SW480 and SW620 cells. (B) Transwell assay showed the impact of IL-6 and anti-IL-6 antibodies on the migration and invasion capabilities of SW480 and SW620 cells. Cells were stained with crystal violet. (C) Western blot analysis showing the impact of IL-6 and anti-IL-6 antibodies on the phosphorylation level of STAT3. *P<0.05. IL-6, interleukin 6; STAT3, signal transducer and activator of transcription 3; CCK-8, Cell Counting Kit-8.

Anti-IL-6 antibody reversed the effect of IL-6 on M1 polarization

IL-6 and anti-IL-6 antibodies were added to SW620 and SW480 cells (co-cultured with M1 macrophages). The results showed that while IL-6 promoted cell proliferation, migration, and invasion induced by M1 polarization, and activated the STAT3 signaling pathway, the anti-IL-6 antibodies partially inhibited the effect of M1 polarization on cells ().
Figure 3

The anti-IL-6 antibody reversed the effect of IL-6 on M1 polarization. (A) CCK-8 assay showed the impact of IL-6/anti-IL-6 antibody on the proliferation rate of SW480 and SW620 cells induced by M1 polarization. (B) Transwell assay showed the impact of IL-6/anti-IL-6 antibody on the migration and invasion of SW480 and SW620 cells induced by M1 polarization. Cells were stained with crystal violet. (C) Western blot analysis showing the impact of IL-6/anti-IL-6 antibody on the level of STAT3 phosphorylation induced by M1 polarization. *, anti-IL-6 group vs. M1 polarization group, P<0.05; #, anti-IL-6 group vs. IL-6 group, P<0.05. IL-6, interleukin 6; STAT3, signal transducer and activator of transcription 3; CCK-8, Cell Counting Kit-8.

The anti-IL-6 antibody reversed the effect of IL-6 on M1 polarization. (A) CCK-8 assay showed the impact of IL-6/anti-IL-6 antibody on the proliferation rate of SW480 and SW620 cells induced by M1 polarization. (B) Transwell assay showed the impact of IL-6/anti-IL-6 antibody on the migration and invasion of SW480 and SW620 cells induced by M1 polarization. Cells were stained with crystal violet. (C) Western blot analysis showing the impact of IL-6/anti-IL-6 antibody on the level of STAT3 phosphorylation induced by M1 polarization. *, anti-IL-6 group vs. M1 polarization group, P<0.05; #, anti-IL-6 group vs. IL-6 group, P<0.05. IL-6, interleukin 6; STAT3, signal transducer and activator of transcription 3; CCK-8, Cell Counting Kit-8.

Similar to luteolin, the anti-IL-6 antibody reversed the effects of IL-6 on M1 polarization

IL-6 and anti-IL-6 antibodies were added to SW620 and SW480 cells (co-cultured with M1 macrophages treated with luteolin). The results showed that luteolin inhibited the M1 polarization and inhibited the proliferation, migration, and invasion of cancer cells by inhibiting STAT3 phosphorylation. The addition of IL-6 reversed the effect of luteolin, while anti-IL-6 antibodies partially inhibited M1 polarization and promoted the therapeutic effect of luteolin ().
Figure 4

Similar to luteolin, the anti-IL-6 antibody reversed the effects of IL-6 on M1 polarization. (A) CCK-8 assay showed the impact of IL-6/anti-IL-6 antibody on the proliferation rate of SW480 and SW620 cells treated with luteolin. (B) Transwell assay showed the impact of IL-6/anti-IL-6 antibody on the migration and invasion of SW480 and SW620 cells treated with luteolin. Cells were stained with crystal violet. (C) Western blot analysis showing the impact of IL-6/anti-IL-6 antibody on the phosphorylation level of STAT3 treated with luteolin. *, anti-IL-6 group vs. LPS + luteolin group, P<0.05; #, anti-IL-6 group vs. IL-6 group, P<0.05. IL-6, interleukin 6; STAT3, signal transducer and activator of transcription 3; CCK-8, Cell Counting Kit-8.

Similar to luteolin, the anti-IL-6 antibody reversed the effects of IL-6 on M1 polarization. (A) CCK-8 assay showed the impact of IL-6/anti-IL-6 antibody on the proliferation rate of SW480 and SW620 cells treated with luteolin. (B) Transwell assay showed the impact of IL-6/anti-IL-6 antibody on the migration and invasion of SW480 and SW620 cells treated with luteolin. Cells were stained with crystal violet. (C) Western blot analysis showing the impact of IL-6/anti-IL-6 antibody on the phosphorylation level of STAT3 treated with luteolin. *, anti-IL-6 group vs. LPS + luteolin group, P<0.05; #, anti-IL-6 group vs. IL-6 group, P<0.05. IL-6, interleukin 6; STAT3, signal transducer and activator of transcription 3; CCK-8, Cell Counting Kit-8.

Discussion

Evidence-based research on TCM is important for identifying treatment strategies for diseases such as hyperglycemia (29) and atherosclerosis (30-32). Newly generated evidence shows that luteolin exerts anti-cancer effects in colon cancer cells by inducing apoptosis (33,34). However, the correlation between M1 macrophage polarization and luteolin effects remains unknown. In this study, we established an M1 polarization model via PMA-induction of THP-1 cells to explore the effect and mechanism of luteolin on colon cancer cells in terms of immunotherapy. Our results showed that LPS promoted the polarization of macrophages into the M1 phenotype and created an inflammatory environment by inducing the expression and secretion of IL-6 in SW620 and SW480 cells. The anti-inflammatory properties of luteolin prevented the effect of M1 macrophages, suggesting that luteolin inhibits IL-6 production by inhibiting M1 polarization. This result was consistent with those reported by Chen et al. (35). Cellular immune metabolism may be an important factor in the regulation of macrophage polarization (36). It has also been reported that M1 polarized macrophages promote inflammation by producing the pro-inflammatory factor, IL-6 (37,38). Immune cells present in the inflammatory tumor microenvironment may be key to promoting cancer development (39,40). Therefore, inhibiting macrophage polarization into the M1 phenotype may be the key to preventing the development of colon cancer. In our study, 30 µM of luteolin inhibited M1 polarization, reduced IL-6 expression and secretion, and inhibited SW620 and SW480 cell proliferation, migration, and invasion. In addition, luteolin inhibited the activation of the STAT3 signaling pathway induced by M1 polarization. These results confirmed that luteolin could inhibit the growth and migration of colon cancer cells by mitigating the inflammatory environment. We also observed that the anti-IL-6 antibody inhibited IL-6 production and secretion as well as M1 polarization under all experimental conditions. Therefore, the effect of luteolin on the inflammatory environment was likely achieved via the IL-6/STAT3 pathway and luteolin may be a promising drug for the prevention and treatment of IL-6-mediated inflammation. This study has several limitations that should be noted. Firstly, we did not confirm the effects of luteolin in animal models. Secondly, several networks interlinked with the long non-coding RNA-microRNA-mRNA signaling pathway may exert significant effects on the treatment of colon cancer, which were not investigated here. Future studies should focus on these research directions. In summary, luteolin inhibited the growth, migration, and invasion potential of colon cancer cells caused by M1 polarization by acting on the IL-6/STAT3 signaling pathway. These results provide new insights into the treatment of colon cancer. The article’s supplementary files as
  39 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 2.  [Traditional Chinese medicine: theoretical background and its use in China].

Authors:  Márk Oravecz; Judit Mészáros
Journal:  Orv Hetil       Date:  2012-05-13       Impact factor: 0.540

3.  Extract of Ilex rotunda Thunb alleviates experimental colitis-associated cancer via suppressing inflammation-induced miR-31-5p/YAP overexpression.

Authors:  Gang Chen; Yueqing Han; Yuan Feng; Aiping Wang; Xuezheng Li; Song Deng; Lin Zhang; Jiao Xiao; Yanwu Li; Ning Li
Journal:  Phytomedicine       Date:  2019-04-30       Impact factor: 5.340

Review 4.  What has traditional Chinese medicine delivered for modern medicine?

Authors:  Jigang Wang; Yin-Kwan Wong; Fulong Liao
Journal:  Expert Rev Mol Med       Date:  2018-05-11       Impact factor: 5.600

Review 5.  Can luteolin be a therapeutic molecule for both colon cancer and diabetes?

Authors:  Rashmi K Ambasta; Rohan Gupta; Dhiraj Kumar; Saurabh Bhattacharya; Aditi Sarkar; Pravir Kumar
Journal:  Brief Funct Genomics       Date:  2018-07-22       Impact factor: 4.241

6.  Antitumor activity of luteolin in human colon cancer SW620 cells is mediated by the ERK/FOXO3a signaling pathway.

Authors:  Iva Potočnjak; Lidija Šimić; Ivana Gobin; Iva Vukelić; Robert Domitrović
Journal:  Toxicol In Vitro       Date:  2020-04-05       Impact factor: 3.500

Review 7.  Progress in Understanding the IL-6/STAT3 Pathway in Colorectal Cancer.

Authors:  Yan Lin; Ziqin He; Jiazhou Ye; Ziyu Liu; Xiaomin She; Xing Gao; Rong Liang
Journal:  Onco Targets Ther       Date:  2020-12-21       Impact factor: 4.147

8.  Tumor-Derived Small Extracellular Vesicles Induce Pro-Inflammatory Cytokine Expression and PD-L1 Regulation in M0 Macrophages via IL-6/STAT3 and TLR4 Signaling Pathways.

Authors:  Marzia Pucci; Stefania Raimondo; Ornella Urzì; Marta Moschetti; Maria Antonietta Di Bella; Alice Conigliaro; Nadia Caccamo; Marco Pio La Manna; Simona Fontana; Riccardo Alessandro
Journal:  Int J Mol Sci       Date:  2021-11-09       Impact factor: 5.923

9.  Macrophage activation and polarization modify P2X7 receptor secretome influencing the inflammatory process.

Authors:  Carlos de Torre-Minguela; Maria Barberà-Cremades; Ana I Gómez; Fátima Martín-Sánchez; Pablo Pelegrín
Journal:  Sci Rep       Date:  2016-03-03       Impact factor: 4.379

10.  Protective effects of luteolin on nephrotoxicity induced by long-term hyperglycaemia in rats.

Authors:  Cui Xiong; Qilong Wu; Mingling Fang; Hui Li; Bin Chen; Tingting Chi
Journal:  J Int Med Res       Date:  2020-04       Impact factor: 1.671

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.