| Literature DB >> 36091399 |
Zuoxiang Wang1,2, Zhisong He1, Qinkao Xuan1, Yue Zhang1, Jialiang Xu1, Jia Lin1, Hongxia Li1, Weixiang Chen1, Tingbo Jiang1.
Abstract
Acute myocardial infraction is the most severe type of coronary artery disease and remains a substantial burden to the health care system globally. Although myocardial reperfusion is critical for ischemic cardiac tissue survival, the reperfusion itself could cause paradoxical injury. This paradoxical phenomenon is known as ischemia-reperfusion injury (IRI), and the exact molecular mechanism of IRI is still far from being elucidated and is a topic of controversy. Meanwhile, ferroptosis is a nonapoptotic form of cell death that has been reported to be associated with various cardiovascular diseases. Thus, we explored the potential ferroptosis mechanism and target in cardiac IRI via bioinformatics analysis and experiment. GSE4105 data were obtained from the GEO database and consist of a rat IRI model and control. After identifying differentially expressed ferroptosis-related genes (DEFRGs) and hub genes of cardiac IRI, we performed enrichment analysis, coexpression analysis, drug-gene interaction prediction, and mRNA-miRNA regulatory network construction. Moreover, we validated and explored the multitemporal expression of hub genes in a hypoxia/reoxygenation (H/R)-induced H9C2 cell injury model under different conditions via RT-qPCR. A total of 43 DEFRGs and 7 hub genes (tumor protein p53 [Tp53], tumor necrosis factor [Tnf], hypoxia-inducible factor 1 subunit alpha [Hif1a], interleukin 6 [Il6], heme oxygenase 1 [Hmox1], X-box binding protein 1 [Xbp1], and caspase 8 [Casp8]) were screened based on bioinformatics analysis. The functional annotation of these genes revealed apoptosis, and the related signaling pathways could have association with the pathogenesis of ferroptosis in cardiac IRI. In addition, the expression of the seven hub genes in IRI models were found higher than that of control under different H/R conditions and time points. In conclusion, the analysis of 43 DEFRGs and 7 hub genes could reveal the potential biological pathway and mechanism of ferroptosis in cardiac IRI. In addition, the multitemporal expression change of hub genes in H9C2 cells under different H/R conditions could provide clues for further ferroptosis mechanism exploring, and the seven hub genes could be potential biomarkers or therapeutic targets in cardiac IRI.Entities:
Keywords: acute myocardial infraction; ferroptosis; hub genes; hypoxia/reoxygenation; ischemia–reperfusion injury
Year: 2022 PMID: 36091399 PMCID: PMC9461145 DOI: 10.3389/fphys.2022.934901
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Details of seven hub genes.
| Gene symbols | Degree | Full names |
|---|---|---|
|
| 16 | tumor protein p53 |
|
| 14 | tumor necrosis factor |
|
| 14 | interleukin 6 |
|
| 13 | hypoxia inducible factor 1 subunit alpha |
|
| 11 | heme oxygenase 1 |
|
| 10 | X-box binding protein 1 |
|
| 10 | caspase 8 |
FIGURE 1Study design flowchart.
FIGURE 2(A) volcano plot of GSE4105 microarray data. (B) Venn diagram of the 38 upregulated differentially expressed ferroptosis-related genes (DEFRGs) in cardiac ischemia–reperfusion injury (IRI). (C) Venn diagram of the five downregulated DEFRGs in cardiac IRI.
FIGURE 3GO and pathway enrichment analysis of differentially expressed ferroptosis-related genes (DEFRGs). (A) GO enrichment analyses of DEFRGs with gene count and (B) p-value. (C) pathway enrichment analysis of DEFRGs.
FIGURE 4Based on the Search Tool for the Retrieval of Interacting Genes database, protein–protein interaction networks of the differentially expressed ferroptosis-related genes were constructed via the Cytoscape software. The red round rectangle indicates upregulated genes, and the blue round rectangle indicates downregulated genes.
FIGURE 5Function analysis of hub genes. (A) functional annotation analysis of hub genes using Metascape. (B) pathway analysis of hub genes based on the KOBAS database. (C) network of hub genes and their coexpression genes were constructed and analyzed based on GeneMANIA.
FIGURE 6Based on the Drug–Gene Interaction database, the network of predicted drug–gene pairs was constructed via Cytoscape and consist of 6 hub genes and 191 drugs.
FIGURE 7Based on the miRWalk database, mRNA–miRNA regulation network of hub genes was constructed using Metascape.
FIGURE 8Expression levels of hub genes in hypoxia/reoxygenation models of H9C2 cells. H9C2 cells were hypoxic for 2 or 4 h and reoxygenated for 2–24 h, and the expression changes of hub genes were verified using RT-PCR. Data are mean ± standard derivation. One-way analysis of variance. *Compared with the control group, #Compared with the hypoxia group; */#, p < 0.05; **/##, p < 0.01.
Primers for real-time polymerase chain reaction.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Tp53 | GTTCGTGTTTGTGCCTGTCC | TCCGGGCAATGCTCTTCTTT |
| Tnf | TTCTCATTCCTGCTCGTGGC | AACTGATGAGAGGGAGCCCA |
| Il6 | AGAGACTTCCAGCCAGTTGC | AGTCTCCTCTCCGGACTTGT |
| Hif-1α | TTTCTCTGCGCGTGAGGAC | CGACGTTCGGAACTCATCCT |
| Hmox1 | GCCTGGTTCAAGATACTACCTCT | CTGAGTGTGAGGACCCATCG |
| Xbp1 | ACCAGGAGTTAAGGACACGC | ACGTAGTCTGAGTGCTGCG |
| Casp8 | GACCACATCCCGCAGAAGAA | GATCCCGCCGACTGATATGG |
| Atf3 | GCTGCCAAGTGTCGAAACAA | GATCTGGGCCTTCAGTTCGG |
| Gapdh | GACATGCCGCCTGGAGAAAC | AGCCCAGGATGCCCTTTAGT |