| Literature DB >> 36091374 |
J Stremming1, A White1, A Donthi2, D G Batt2, B Hetrick3, E I Chang1, S R Wesolowski1, M B Seefeldt2, C E McCurdy3, P J Rozance1, L D Brown1.
Abstract
IGF-1 is a critical fetal growth-promoting hormone. Experimental infusion of an IGF-1 analog, human recombinant LR3 IGF-1, into late gestation fetal sheep increased fetal organ growth and skeletal muscle myoblast proliferation. However, LR3 IGF-1 has a low affinity for IGF binding proteins (IGFBP), thus reducing physiologic regulation of IGF-1 bioavailability. The peptide sequences for LR3 IGF-1 and sheep IGF-1 also differ. To overcome these limitations with LR3 IGF-1, we developed an ovine (sheep) specific recombinant IGF-1 (oIGF-1) and tested its effect on growth in fetal sheep. First, we measured in vitro myoblast proliferation in response to oIGF-1. Second, we examined anabolic signaling pathways from serial skeletal muscle biopsies in fetal sheep that received oIGF-1 or saline infusion for 2 hours. Finally, we measured the effect of fetal oIGF-1 infusion versus saline infusion (SAL) for 1 week on fetal body and organ growth, in vivo myoblast proliferation, skeletal muscle fractional protein synthetic rate, IGFBP expression in skeletal muscle and liver, and IGF-1 signaling pathways in skeletal muscle. Using this approach, we showed that oIGF-1 stimulated myoblast proliferation in vitro. When infused for 1 week, oIGF-1 increased organ growth of the heart, kidney, spleen, and adrenal glands and stimulated skeletal myoblast proliferation compared to SAL without increasing muscle fractional synthetic rate or hindlimb muscle mass. Hepatic and muscular gene expression of IGFBPs one to three was similar between oIGF-1 and SAL. We conclude that oIGF-1 promotes tissue and organ-specific growth in the normal sheep fetus.Entities:
Keywords: IGF binding protein; IGF-1 signaling; fetal growth; myoblast; skeletal muscle
Year: 2022 PMID: 36091374 PMCID: PMC9452821 DOI: 10.3389/fphys.2022.954948
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
FIGURE 1Recombinant ovine IGF-1 (oIGF-1) production. (A) Process flow of expression and purification. (B) Preparative reversed-phase HPLC chromatography and elution profiles of misfolded oxidation 1 (OX1) and biologically active oxidation 2 (OX2) forms.
Real-time qPCR primers.
| Gene | Forward | Reverse | Accession number |
|---|---|---|---|
| Insulin-like growth factor 1 ( | GAGACCCTCTGCGGGGCTGA | CTGCTCGAGCCGTACCCCGT | NM_001009774.3 |
| Insulin-like growth factor 2 ( | TGTGGGGACCGCGGCTTCTA | CAGGGCCAGGTCGCAGCTTC | XM_027959253.1 |
| Insulin-like growth factor 1 receptor ( | TGTCCTGACATGCTGTTTGAGCTG | CCAGGAACGAGGGCCGCATC | AF025303 |
| Insulin-like growth factor 2 receptor ( | ACCAGTTACGCCTGCCCGGA | TCGGGACCGCCCTCGGATTT | AF353513 |
| IGF binding protein 1 ( | GCCAGGGAGCAGCAGAAGGC | GAGCCCAGGCTCTCCGTCCA | NM_001145177.1 |
| IGF binding protein 2 ( | ACCTTGGCCTGGAGGAGCCC | TCCAGGGGACCCCGCTCATC | NM_001009436.1 |
| IGF binding protein 3 ( | TCATGCCAAGGACAGCCAGCG | CCTCCATTTCCCGGCGGCAG | NM_001159276.1 |
| Insulin receptor A ( | CCCGAAGACCGACTCTCA | AGGCCTGGGGATGAAAAC | Y16093.1 |
| Insulin receptor B ( | CCGAAGACCGACTCTCAGAT | CAACAGGGCCTGAAGATGAT | Y16092.1 |
| Beta-2-microglobulin | CTTGGTCCTTCTCGGGCTG | ATCTTCTGGCGGGTGTCTTG | NM_001009284.2 |
| Hydroxymethylbilan synthase | AGCCCAGCTGCAGAGAAAG | CAGCCGTGTGTTGAGGTTTC | XM_042232961.1 |
| Ribosomal protein L37a | ACCAAGAAGGTCGGAATCGT | GGCACCACCAGCTACTGTTT | XM_027965159 |
| Ribosomal protein S15 | ATCATTCTGCCCGAGATGGTG | CGGGCCGGCCATGCTTTACG | NM_001018.2 |
FIGURE 2Myoblast proliferation in vitro. Myoblasts harvested from biceps femoris muscle from normally growing late gestation fetal sheep (n = 6) were exposed to serum free DMEM or 1 or 10 ng·mL−1 of recombinant ovine IGF-1 (oIGF-1) in DMEM for 72 h. Myoblasts were also exposed to DMEM with 10% FBS as a positive control. Myoblast proliferation was measured using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. Significant effect by one-way ANOVA is indicated. *Indicates significantly different (p ≤ 0.05) from serum free DMEM by Bonferroni’s post hoc test.
FIGURE 3Fetal concentrations of recombinant ovine IGF-1 (oIGF-1) and insulin. (A) Dose response curve showing fetal plasma IGF-1 concentrations after infusion of oIGF-1 into a singleton fetus (open squares, n = 1) at 22, 220, and 440 μg·h−1. Fetal plasma IGF-1 concentrations are also shown after fetal infusion of saline (closed circles, n = 3) for reference. (B) Fetal plasma IGF-1 and (C) insulin concentrations after fetal infusion of either oIGF-1 at 220 μg·h−1 (open squares, n = 2) or saline (closed circles n = 2) into twin pairs.
FIGURE 4Protein expression of anabolic targets in biceps femoris muscle after acute infusion of recombinant ovine IGF-1 (oIGF-1). Blots of phosphorylated (Ser473) and total Akt in (A) 1 pair of twin animals that received oIGF-1 at 22 μg·h−1 or saline and (B) 2 pairs of twin animals that received oIGF-1 at 220 μg·h−1 or saline. (C) Graph represents the percent change in phosphorylation of Akt from 0 to 15 min of infusion. Open circles represent the twin pair that received oIGF-1 at 22 μg h−1 or saline and closed circles represent the twin pairs that received oIGF-1 at 220 μg·h−1 or saline. Blots of phosphorylated (Thr202/Tyr204) and total Erk 1/2 in (D) 1 pair of twin animals that received oIGF-1 at 22 μg·h−1 or saline and (E) 2 pairs of twin animals that received oIGF-1 at 220 μg·h−1 or saline. (F) Graph represents the percent change in phosphorylation of Erk 1/2 from 0 to 15 min of infusion. Open circles represent the twin pair that received oIGF-1 at 22 μg·h−1 or saline and closed circles represent the twin pairs that received oIGF-1 at 220 μg·h−1 or saline.
Fetal body and organ weights after 1-week infusion of oIGF-1 or saline (SAL).
| SAL (n = 6) | oIGF-1 (n = 6) |
| |
|---|---|---|---|
| % Male | 50% | 33% | |
| Fetal weight (kg) | 3.021 ± 0.198 | 3.032 ± 0.138 | 0.9090 |
| Crown rump length (cm) | 49.2 ± 1.3 | 48.3 ± 1.3 | 0.2543 |
| Hindlimb length (cm) | 38.2 ± 1.0 | 37.4 ± 1.6 | 0.6404 |
| Brain (g) | 52.0 ± 1.5 | 52.0 ± 1.1 | 0.9728 |
| Heart (g) | 21.9 ± 1.7 | 27.6 ± 1.9 | 0.0202 |
| Liver (g) | 63.4 ± 4.3 | 68.7 ± 6.8 | 0.4391 |
| Lungs (g) | 116.3 ± 9.2 | 119.4 ± 5.9 | 0.6612 |
| Kidneys (g) | 19.3 ± 1.5 | 23.9 ± 1.4 | 0.0072 |
| Adrenal glands (g) | 0.38 ± 0.03 | 0.57 ± 0.03 | 0.0011 |
| Spleen (g) | 5.8 ± 0.9 | 8.2 ± 0.7 | 0.0146 |
| Gastrocnemius (g) | 7.1 ± 0.4 | 7.4 ± 0.3 | 0.5093 |
| Flexor digitorum superficialis (g) | 2.5 ± 0.3 | 2.0 ± 0.4 | 0.8438 |
| Tibialis anterior (g) | 3.1 ± 0.2 | 2.5 ± 0.3 | 0.1128 |
Values represent mean ± SEM. p-values determined by paired t-test or wilcoxon matched pairs signed rank test.
FIGURE 5Fetal concentrations of IGF-1 and insulin during chronic recombinant ovine IGF-1 (oIGF-1) infusion. Fetal plasma concentrations of (A) IGF-1 and (B) insulin in fetal sheep that received either oIGF-1 (n = 6, open squares) or saline (SAL, n = 6, closed circles) infusion for 1 week. Significant effects by mixed model ANOVA [time, group (oIGF-1, SAL), and interaction] are indicated. *Indicates significantly different (p ≤ 0.05) between oIGF-1 and SAL by Bonferroni’s post hoc test.
Fetal glucose, lactate, blood gas, and hormone concentrations after 1-week infusion of oIGF-1 or saline (SAL).
| SAL (n = 6) | oIGF-1 (n = 6) |
| |||||
|---|---|---|---|---|---|---|---|
| Baseline | Final | Baseline | Final | Time | Group | Interaction | |
| Glucose (mg·dL−1) | 15.63 ± 0.53 | 14.36 ± 0.71 | 16.53 ± 1.11 | 13.34 ± 1.82 |
| 0.9648 | 0.3365 |
| Lactate (mmol·L−1) | 1.54 ± 0.06 | 1.42 ± 0.12 | 1.58 ± 0.03 | 1.68 ± 0.26 | 0.9303 | 0.3062 | 0.4887 |
| pH | 7.34 ± 0.01 | 7.32 ± 0.02 | 7.34 ± 0.01 | 7.33 ± 0.02 | 0.2247 | 0.9158 | 0.5541 |
| PaCO2 (mmHg) | 48.78 ± 1.11 | 51.40 ± 1.68 | 49.40 ± 0.70 | 51.85 ± 1.11 |
| 0.6899 | 0.9407 |
| PaO2 (mmHg) | 21.18 ± 0.85 | 20.15 ± 1.27 | 21.02 ± 1.41 | 19.85 ± 1.19 | 0.3310 | 0.8616 | 0.9518 |
| Hematocrit (%) | 34.3 ± 1.19 | 33.25 ± 0.90 | 34.25 ± 0.73 | 32.55 ± 0.90 |
| 0.7842 | 0.4807 |
| O2 saturation (%) | 52.32 ± 2.69 | 48.57 ± 5.26 | 49.53 ± 5.19 | 47.47 ± 5.65 | 0.4683 | 0.7386 | 0.8317 |
| O2 content (mmol·L−1) | 3.57 ± 0.21 | 3.22 ± 0.37 | 3.35 ± 0.35 | 2.93 ± 0.32 | 0.1385 | 0.5293 | 0.8914 |
| Cortisol (ng·mL−1)Δ | 24.8 ± 7.2 | 19.7 ± 4.2 | 22.5 ± 6.1 | 25.6 ± 5.9 | 0.8731 | 0.7704 | 0.5184 |
| Norepinephrine (pg·mL−1) | 1,022.5 ± 353.1 | 897.2 ± 394.6 | 1,144.2 ± 400.0 | 1,455.0 ± 301.9 | 0.4295 | 0.5148 | 0.0816 |
Values represent mean ± SEM. p-values determined by two-way repeated measures ANOVA for the effects of time, group (SAL, oIGF-1), and interaction. Δ indicates n = 4 per group.
Bolded values indicates significant p values.
Fetal concentrations of amino acids after 1-week infusion of oIGF-1 or saline (SAL).
| SAL (n = 6) | oIGF-1 (n = 6) |
| |||||
|---|---|---|---|---|---|---|---|
| Baseline | Final | Baseline | Final | Time | Group | Interaction | |
| Alanine | 211 ± 13 | 246 ± 22 | 192 ± 15 | 196 ± 46 | 0.4039 | 0.2963 | 0.4935 |
| Arginine | 90 ± 12 | 122 ± 5 | 87 ± 14 |
| 0.3360 | 0.0563 |
|
| Asparagine | 33 ± 3 | 43 ± 6 | 32 ± 2 | 36 ± 5 | 0.0559 | 0.4549 | 0.3572 |
| Aspartate | 28 ± 7 | 27 ± 5 | 25 ± 6 | 21 ± 2 | 0.3827 | 0.5244 | 0.5745 |
| Cysteine | 18 ± 2 | 20 ± 2 | 16 ± 2 | 15 ± 2 | 0.7171 | 0.1941 | 0.4644 |
| Glutamate | 28 ± 3 | 29 ± 4 | 24 ± 2 | 24 ± 3 | 0.9467 | 0.2966 | 0.7835 |
| Glutamine | 390 ± 19 | 416 ± 43 | 361 ± 14 | 304 ± 36 | 0.4627 | 0.0967 | 0.0664 |
| Glycine | 318 ± 54 | 378 ± 57 | 325 ± 43 | 460 ± 60 | 0.0521 | 0.4920 | 0.4207 |
| Histidine | 37 ± 5 | 51 ± 7 | 32 ± 4 |
|
| 0.1122 |
|
| Isoleucine | 84 ± 6 | 88 ± 5 | 82 ± 8 | 76 ± 6 | 0.8406 | 0.4007 | 0.2311 |
| Leucine | 110 ± 8 | 124 ± 8 | 105 ± 9 | 101 ± 9 | 0.4103 | 0.1852 | 0.1767 |
| Lysine | 60 ± 10 | 85 ± 12 | 55 ± 6 |
| 0.1691 | 0.0938 |
|
| Methionine | 93 ± 9 | 86 ± 13 | 89 ± 10 | 68 ± 9 |
| 0.4270 | 0.2791 |
| Ornithine | 53 ± 6 | 65 ± 7 | 54 ± 8 |
| 0.6517 | 0.1014 |
|
| Phenylalanine | 97 ± 5 | 110 ± 7 | 97 ± 4 | 109 ± 9 |
| 0.9547 | 0.9979 |
| Proline | 116 ± 7 | 151 ± 17 | 119 ± 8 | 110 ± 12 | 0.2826 | 0.1313 | 0.0873 |
| Serine | 531 ± 41 | 530 ± 38 | 521 ± 43 | 433 ± 41 | 0.2314 | 0.2656 | 0.2435 |
| Taurine | 78 ± 19 | 97 ± 42 | 72 ± 14 | 77 ± 10 | 0.3791 | 0.6822 | 0.5940 |
| Threonine | 274 ± 43 | 293 ± 40 | 234 ± 27 | 217 ± 26 | 0.9546 | 0.2471 | 0.2152 |
| Tryptophan | 46 ± 2 | 49 ± 2 | 40 ± 4 | 43 ± 2 | 0.2085 | 0.1196 | 0.8083 |
| Tyrosine | 120 ± 8 | 120 ± 12 | 126 ± 5 | 117 ± 9 | 0.4822 | 0.8971 | 0.4885 |
| Valine | 329 ± 18 | 365 ± 24 | 320 ± 24 | 313 ± 21 | 0.5671 | 0.1516 | 0.3846 |
| Summed | 3,147 ± 148 | 3,495 ± 223 | 3,009 ± 115 | 2,903 ± 195 | 0.3657 | 0.1164 | 0.0626 |
Amino acid concentrations are reported as µmol·L−1. Values represent mean ± SEM. p-values determined by two-way repeated measures ANOVA for the effects of time, group (SAL, oIGF-1), and interaction. *Indicates significantly lower (p ≤ 0.05) compared to final SAL by Bonferroni’s post hoc test.
Bolded values indicates significant p values.
FIGURE 6Myoblast proliferation and fractional synthetic rate (FSR) after chronic infusion of recombinant ovine IGF-1 (oIGF-1). (A) Percent of myoblasts in biceps femoris (BF) muscle that were positive for EdU by flow cytometry in fetal sheep treated with oIGF-1 (n = 6) or saline (SAL, n = 6). Twin pairs are connected. p-value indicated was determined by paired t-test. (B) FSR in BF from fetal sheep treated with oIGF-1 (n = 4) or SAL (n = 4). Twin pairs are connected.
FIGURE 7mRNA expression of IGF related targets in biceps femoris muscle and liver after chronic recombinant ovine IGF-1 (oIGF-1) infusion. mRNA expression of IGF related targets in (A) muscle and (B) liver from fetal sheep that received a 1-week infusion of either oIGF-1 (n = 6, open squares) or saline (SAL, n = 6, closed circles). Individual data points and means ± SEM are shown. *Indicates significantly different (p ≤ 0.05) between SAL and oIGF-1 as determined by paired t-test.