| Literature DB >> 36091361 |
Jichang Zheng1, Wencong Zhang1, Zhijie Dan1, Yanwen Zhuang1, Yongtao Liu1, Kangsen Mai1,2, Qinghui Ai1,2.
Abstract
Clostridium autoethanogenum meal (CAM) is a novel single-cell protein, which is produced from bacteria using carbon monoxide (CO) as sole carbon source. To evaluate the efficiency of CAM as an alternative for dietary fish meal, a 56-days growth experiment was performed on juvenile turbot (Scophthalmus maximus L.) with initial average weight of 9.13 ± 0.02 g. Six iso-nitrogenous (crude protein, 51.0%) and iso-lipidic (crude lipid, 11.5%) diets were formulated with 0%, 15%, 30%, 45%, 60% and 80% dietary fish meal protein substituted by CAM protein, which were designated as CAM0 (the control group), CAM15, CAM30, CAM45, CAM60 and CAM80, respectively. Results showed that no significant differences were observed in survival rate (over 97.50%) among different dietary treatments (p > 0.05). The specific growth rate (SGR) was not significantly affected when replacement levels of dietary fish meal with CAM were less than 45% (p > 0.05). The feed intake (FI) was significantly linear reduced with increasing dietary CAM (p < 0.05), whereas no significant differences were observed in feed efficiency ratio (FER), protein efficiency ratio (PER) and protein retention (PR) among different dietary treatments (p > 0.05). With increasing dietary CAM, lipid retention (LR) and carcass lipid tended to be increased in both significantly linear and quadratic patterns (p < 0.05). The apparent digestibility coefficient (ADC) of crude protein and some essential amino acids, including threonine, valine, lysine, histidine and arginine, showed significantly linear increase with increasing dietary CAM (p < 0.05). Furthermore, with the increase of dietary CAM, the gene expression of intestinal peptide and amino acids transporters was first up-regulated and then down-regulated with significantly quadratic pattern (p < 0.05), peaking in fish fed with diets CAM30 or CAM45, which was similar to the expression of genes related protein degradation in muscle. For genes related to protein metabolism in liver and muscle, the expression of mammalian target of rapamycin (mtor) was not significantly affected by dietary CAM, while the general control nonderepressible 2 (gcn2) tended to be first up-regulated and then down-regulated with significantly quadratic pattern (p < 0.05). Apart from that, the lipid metabolism of turbot was also affected by high dietary CAM, evidenced by increased expression of hepatic genes related to lipogenesis as well as reduced expression of genes related to lipid oxidation and lipid transport. In conclusion, CAM can replace up to 45% fish meal protein in diet for juvenile turbot without significantly adverse effects on growth performance. But excessive dietary CAM would result in significant growth reduction, and excessive lipid deposition may also occur in fish fed diets with high levels of CAM.Entities:
Keywords: Clostridium autoethanogenum meal; Scophthalmus maximus L.; amino acids transporter; growth performance; lipid metabolism; protein metabolism
Year: 2022 PMID: 36091361 PMCID: PMC9451173 DOI: 10.3389/fphys.2022.981750
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Formulation, proximate composition and amino acids profile of experimental diets (% dry matter).
| Ingredients | Diets | |||||
|---|---|---|---|---|---|---|
| CAM0 | CAM15 | CAM30 | CAM45 | CAM60 | CAM80 | |
| Brown fish meal | 60.00 | 51.00 | 42.00 | 33.00 | 24.00 | 12.00 |
|
| 0.00 | 7.48 | 14.97 | 22.45 | 29.93 | 39.91 |
| Wheat gluten meal | 4.09 | 3.51 | 2.93 | 2.34 | 1.76 | 0.98 |
| Wheat meal | 19.87 | 21.04 | 22.19 | 23.36 | 24.50 | 26.06 |
| Fish oil | 3.89 | 4.57 | 5.25 | 5.94 | 6.63 | 7.55 |
| Soy lecithin | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 |
| Squid visceral meal | 4.00 | 4.00 | 4.00 | 4.00 | 4.00 | 4.00 |
| Vitamin premix | 1.50 | 1.50 | 1.50 | 1.50 | 1.50 | 1.50 |
| Vitamin C | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Mineral premix | 1.50 | 1.50 | 1.50 | 1.50 | 1.50 | 1.50 |
| L-histidine | 0.00 | 0.10 | 0.21 | 0.31 | 0.41 | 0.55 |
| L-arginine | 0.00 | 0.15 | 0.30 | 0.45 | 0.61 | 0.81 |
| Taurine | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Choline chloride | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 |
| Calcium propionate | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 |
| Ethoxyquinline | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
| Ca(H2PO4)2 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Yttrium oxide | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 |
| Sodium alginate | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 |
| Attractants | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| Feed price (USD/kg) | 1.63 | 1.59 | 1.55 | 1.51 | 1.47 | 1.41 |
| Proximate composition | ||||||
| Moisture (%) | 4.64 | 4.36 | 4.54 | 5.11 | 5.48 | 4.92 |
| Crude protein (%/dry matter) | 51.54 | 51.41 | 51.17 | 51.35 | 51.18 | 51.01 |
| Crude lipid (%/dry matter) | 12.11 | 11.71 | 11.49 | 11.58 | 11.74 | 11.00 |
| Ash (%/dry matter) | 11.63 | 11.32 | 10.68 | 9.25 | 8.21 | 6.51 |
| Essential Amino acids (%/dry matter)g | ||||||
| Threonine | 2.16 | 2.34 | 2.27 | 2.30 | 2.36 | 2.35 |
| Valine | 2.41 | 2.55 | 2.55 | 2.50 | 2.83 | 2.89 |
| Methionine | 1.25 | 1.31 | 1.32 | 1.28 | 1.27 | 1.40 |
| Isoleucine | 2.10 | 2.30 | 2.39 | 2.25 | 2.79 | 2.96 |
| Leucine | 3.90 | 3.98 | 3.97 | 3.97 | 3.97 | 3.92 |
| Phenylalanine | 2.39 | 2.37 | 2.32 | 2.32 | 2.37 | 2.36 |
| Lysine | 3.74 | 4.03 | 4.06 | 3.95 | 4.37 | 4.48 |
| Histidine | 1.56 | 1.54 | 1.48 | 1.51 | 1.53 | 1.48 |
| Arginine | 2.80 | 2.93 | 2.90 | 2.91 | 2.93 | 2.97 |
| Non-essential amino acids (%/dry matter) | ||||||
| Aspartic acid | 4.32 | 4.76 | 4.65 | 4.64 | 5.04 | 5.06 |
| Serine | 2.00 | 2.06 | 2.02 | 2.03 | 1.99 | 1.98 |
| Glutamic acid | 7.60 | 7.50 | 7.42 | 7.61 | 7.33 | 6.77 |
| Glycine | 3.27 | 3.24 | 3.13 | 3.19 | 3.12 | 2.93 |
| Alanine | 3.20 | 3.18 | 3.18 | 3.22 | 3.10 | 3.03 |
| Cysteine | 0.50 | 0.50 | 0.50 | 0.50 | 0.48 | 0.50 |
| Tyrosine | 1.67 | 1.73 | 1.74 | 1.71 | 1.82 | 1.84 |
| Proline | 2.39 | 2.38 | 2.37 | 2.36 | 2.23 | 2.09 |
Brown fish meal (dry matter, 91.99%, crude protein, 71.69% dry matter, crude lipid, 9.37% dry matter); Wheat gluten meal (dry matter, 93.62%, crude protein, 80.52% dry matter, crude lipid, 1.16% dry matter); Wheat meal (dry matter, 88.20%, crude protein, 18.52% dry matter, crude lipid, 1.54% dry matter); Squid visceral meal (dry matter, 90.70%, crude protein, 37.84% dry matter, crude lipid, 7.73% dry matter). These ingredients were provided by Great seven Bio-tech (Qingdao, China). Clostridium autoethanogenum meal (dry matter, 92.05%, crude protein,86.22% dry matter, crude lipid, 1.96% dry matter) was provided by Beijing Shoulang Biotechnology Co., Ltd. (Beijing, China).
Vitamin premix (mg/kg diet): retinol acetate, 32; cholecalciferol, five; alpha-tocopherol, 240; thiamin, 25; riboflavin, 45; pyridoxine HCl, 20; vitamin B12, 10; pantothenic acid, 60; folic acid, 20; niacin, 200; biotin, 60; inositol, 800; microcrystalline cellulose, 13473. Vitamin C was supplied in the form of vitamin c polyphosphate.
Mineral premix (mg/kg diet): MgSO4·7H2O, 1200; CuSO4·5H2O, 10; FeSO4·H2O, 80; ZnSO4·H2O, 50; MnSO4·H2O, 45; CoCl2.6H2O, 50; Na2SeO3, 20; H2CaIO4, 60; zeolite powder, 13485.
Attractants: glycine betaine: DMPT: glycine: alanine: inosine-5-diphosphate trisodium salt = 4: 2: 2: 1: 1.
CAM0 was the control group, CAM15, CAM30, CAM45, CAM60 and CAM80 were replacement groups formulated by replacing 15%, 30%, 45%, 60% and 80% of fish meal in the control group.
Feed price was converted from CHY to USD with the exchange rate of 1: 6.5.
No tryptophan was detected because of acid hrdrolysis.
Fatty acids profile of experimental diets (% total fatty acids).
| Fatty acids profile/(% total fatty acids) | Diets | |||||
|---|---|---|---|---|---|---|
| FM | CAM15 | CAM30 | CAM45 | CAM60 | CAM80 | |
| C14:0 | 5.07 | 5.07 | 5.18 | 5.27 | 5.56 | 5.74 |
| C15:0 | 0.54 | 0.55 | 0.57 | 0.59 | 0.61 | 0.64 |
| C16:0 | 23.99 | 24.14 | 24.63 | 25.10 | 25.24 | 25.83 |
| C18:0 | 5.80 | 5.63 | 5.50 | 5.36 | 4.98 | 4.77 |
| C23:0 | 0.49 | 0.47 | 0.45 | 0.43 | 0.40 | 0.36 |
| C24:0 | 1.69 | 1.62 | 1.56 | 1.47 | 1.37 | 1.24 |
| ∑ SFA | 37.58 | 37.49 | 37.88 | 38.23 | 38.16 | 38.57 |
| C16:1 | 4.98 | 4.91 | 4.82 | 4.71 | 4.71 | 4.51 |
| C17:1 | 0.70 | 0.85 | 0.99 | 1.15 | 1.34 | 1.52 |
| C18:1,cis | 0.21 | 0.21 | 0.22 | 0.22 | 0.22 | 0.23 |
| C18:1,trans | 13.51 | 13.71 | 13.89 | 14.06 | 13.93 | 14.12 |
| C20:1 | 3.96 | 4.44 | 4.90 | 5.40 | 5.65 | 6.36 |
| ∑ MUFA | 23.36 | 24.12 | 24.82 | 25.54 | 25.85 | 26.73 |
| C18:2 n-6 | 10.41 | 10.56 | 10.69 | 10.76 | 10.99 | 11.11 |
| C20:2 n-6 | 0.23 | 0.24 | 0.24 | 0.24 | 0.25 | 0.25 |
| C20:4 n-6 | 0.84 | 0.81 | 0.78 | 0.76 | 0.75 | 0.69 |
| ∑ n-6 PUFA | 11.48 | 11.60 | 11.71 | 11.77 | 11.99 | 12.05 |
| C18:3 n-3 | 1.44 | 1.49 | 1.53 | 1.54 | 1.65 | 1.71 |
| C20:5 n-3 | 8.53 | 8.08 | 7.68 | 7.20 | 7.08 | 6.34 |
| C22:6 n-3 | 13.89 | 13.12 | 12.50 | 11.80 | 11.33 | 10.43 |
| ∑ n-3 PUFA | 23.86 | 22.69 | 21.71 | 20.54 | 20.06 | 18.48 |
| ∑ SFA/∑ PUFA | 1.06 | 1.09 | 1.13 | 1.18 | 1.19 | 1.26 |
| ∑ n-3 PUFA/∑ n-6 PUFA | 2.08 | 1.96 | 1.85 | 1.75 | 1.67 | 1.53 |
CAM0 was the control group, CAM15, CAM30, CAM45, CAM60 and CAM80 were replacement groups formulated by replacing 15%, 30%, 45%, 60% and 80% fish meal in the control group.
SFA, saturated fatty acids; MUFA, monounsaturated fatty acids; n-6 PUFA, n-6 polyunsaturated fatty acids; n-3 PUFA, n-3 polyunsaturated fatty acids. Some fatty acids with extremely low content are not listed.
Primer sequences used for real-time quantitative PCR.
| Genes | Forward primer (5′–3′) | Reverse primer (5′–3′) | References (GeneBank no.) |
|---|---|---|---|
|
| |||
|
| GCATCCACACCCAGCAGAAG | GTCCTCAGCCCAGTCCATCC |
|
|
| TGCTGCTGTTCGTGACCATCTC | AGGTTCCAGAAATGCCATAAGGG |
|
|
| AGACTCTCAACACCTCCGAAGC | AGCCTTTCCTGTGGTCTCAATCC |
|
|
| GGGCTTTGGGCTTATGATGGATG | TGGAGACAACAGCAGTTCAGTGG |
|
|
| TCAGTGACAACATCAAGCAGGTG | GAAGGCGGGCAGGAAGAAGAG |
|
|
| ACCTTGATCGCCTCGTCCATC | CATCTGTGCCGTTCCTTGTAACC |
|
|
| TGCTGCTGGTGACGCTCTTC | TGCTGCTGGTGACGCTCTTC |
|
|
| TCTCCCATCGTCAGCGTCTTC | CTGCCAGCCGTCACAATGC |
|
|
| TGTGACGTTTGCGGACCAG | GACGGGAGTGTAGCGGAAGAC |
|
|
| |||
|
| GCAGGAAGTACATGCGGTCT | GCTGGTTGGGGTCATAAGTG |
|
|
| CCGCAAGTTCCTACTGGAC | AGGCTTGCCATCGTGGTTGT |
|
|
| ACAGACGGCGATCAACCTC | CCTAAACAGCCTCCATAACC |
|
|
| AGGAGAACTTGCTGCTGTCG | AGATCCAAGCGGTTGAAGG |
|
|
| CATGAAGAGACCGGACCAGG | TATTTTGGTCCCGTTGCCGT | XM_035622025.1 |
|
| TCAGTGTGGATGCCCTGAAC | GAGACGGAGAATCCCTTGCC | XM_035648518.1 |
|
| CTCGGAACTACTAGCCGCTG | GAGTGTCTCCCACTGCCTTC | XM_035643075.1 |
|
| GAGGAAGGAAGCGACGACAT | GTCCGAGGTTTGAGGCGAA | XM_035642079.1 |
|
| ACGACAGAGTTGGCTTTGCT | GTCAACTCTCCAATCTGCTGGA | XM_035627591.1 |
|
| CTAAACCCGAGCCCAGCACA | CTAAACCCGAGCCCAGCACA | XP_035486615.1 |
|
| |||
|
| GGCAACAACACGGATGGATAC | CTCGCTTTGATTGACAGAACAC |
|
|
| GCCTTTCAGTTCACCATCACA | ATCTGATTTGCTCCTCCGAG |
|
|
| AAGTGACGGAGTTCGCCAAGA | GTTCATCAGAGGTGCCATCA |
|
|
| CGATCCGCACTCCAAGT | CCGCACTGCCCTGAAT |
|
|
| AGGACGCTGGTGGTTCTCG | CTGTCCGCTGAGGTCATAGTG |
|
|
| CTCCCACGAACGCTCTAT | GCGGACCTTGTTGATGTT |
|
|
| TGGAGCAGTGGGGTCATTC | ATGGGGTCCACCTGAAGCA |
|
|
| GCCTTTCAGTTCACCATCACA | ATGCGGCTGACTCGTTTCTT |
|
|
| CCAGCAAAGTCTTACGCCA | TACGCAGATGATGACCCAAC |
|
|
| TCTCACCCTCGGTCTCGG | TTCAGGTTTCTCCTCACAACGA |
|
|
| AGTGCGTGGTGGACAAAGAC | GAGTCGTACTGGCGGTCGTTG |
|
|
| |||
|
| CTGCTGTTCCCTAAAGAGTTCG | GAGCCGTGTAGTTCAGGGTCT | DQ848899.1 |
pept1, peptide transporter 1; cat2, cationic amino acid transporter 2; b, B0-type amino acid transporter 1; b, b0,+-type amino acid transporter; pat1, proton-coupled amino acid transporter 1; asct2, system ASC amino acid transporter-2; snat2, sodium-coupled neutral amino acid transporter 2; tat1, T-type amino acid transporter 1; y, system y+L amino acid transporter 1; gcn2, general control nonderepressible 2; mtor, mammalian target of rapamycin; 4e-bp1, eukaryotic initiation factor 4E-binding protein 1; capns1-like, calpain small subunit 1-like; lc3b, microtubule associated protein 1 light chain 3 beta; atg4b, autophagy related 4B cysteine peptidase; atg12, autophagy related 12 homolog; fas, fatty acid synthase; lxr, liver X receptor; pparγ, peroxisome proliferator-activated receptor γ; srebp-1, sterol-regulatory element binding protein-1; lpl, lipoprotein lipase; ampk1α, adenosine monophosphate activated protein kinase1α; cpt1, carnitine palmitoyl transferase 1; mtp, mitochondrial trifunctional protein; apob-100, apolipoprotein B-100; hnf4α, hepatocyte nuclear factor 4α; rpsd, RNA polymerase II subunit D.
The nutritional composition and price of fish meal and Clostridium autoethanogenum meal (CAM) .
| Fish meal | CAM | |
|---|---|---|
| Price (USD/t) | 1846.15 | 1538.46 |
| Moisture (%) | 8.01 | 7.95 |
| Crude lipid(%/dry matter) | 9.05 | 2.11 |
| Crude protein (%/dry matter) | 71.69 | 86.22 |
| TCA-soluble protein | 15.84 | 5.43 |
| Essential amino acids (%/protein) | ||
| Threonine | 4.32 | 4.60 |
| Valine | 5.27 | 6.40 |
| Methionine | 2.94 | 3.36 |
| Isoleucine | 4.52 | 6.67 |
| Leucine | 7.60 | 7.47 |
| Phenylalanine | 4.23 | 4.21 |
| Lysine | 7.98 | 9.59 |
| Histidine | 3.31 | 1.52 |
| Arginine | 6.00 | 4.07 |
| Non-essential amino acids | ||
| Aspartic acid | 8.90 | 10.19 |
| Serine | 3.98 | 3.75 |
| Glutamic acid | 14.52 | 11.98 |
| Glycine | 5.98 | 4.69 |
| Alanine | 6.60 | 5.74 |
| Cysteine | 0.78 | 0.89 |
| Tyrosine | 3.26 | 3.86 |
| Proline | 3.70 | 2.93 |
Data are means of triplicate. No tryptophan was detected because of acid hrdrolysis.
CAM was provided by Beijing Shoulang Biotechnology Co., Ltd.
Price was converted from CHY to USD with the exchange rate of 1: 6.5.
The percentage of protein extracted by 15% trichloroacetic acid (TCA), representing the relative content of small peptides and free amino acids in total crude protein.
Fatty acids profile of fish meal and Clostridium autoethanogenum meal (CAM) .
| Fatty acids profile (% total fatty acids) | Fish meal | CAM |
|---|---|---|
| C12:0 | 0.15 | 0.85 |
| C14:0 | 10.06 | 16.39 |
| C15:0 | 0.80 | 0.00 |
| C16:0 | 37.63 | 79.61 |
| C17:0 | 0.82 | 0.20 |
| C18:0 | 8.17 | 0.06 |
| ∑SFA | 57.63 | 97.11 |
| C16:1 | 5.08 | 0.69 |
| C17:1 | 0.14 | 0.15 |
| C18:1 | 0.02 | 0.12 |
| C20:1 | 0.58 | 0.01 |
| ∑MUFA | 5.82 | 0.99 |
| C18:2 n-6 | 0.98 | 0.04 |
| C18:3 n-6 | 0.15 | 0.00 |
| C20:2 n-6 | 1.13 | 0.00 |
| C20:4 n-6 | 1.05 | 0.00 |
| ∑n-6 PUFA | 3.31 | 0.04 |
| C18:3 n-3 | 0.60 | 0.00 |
| C20:5 n-3 | 11.51 | 0.00 |
| C22:6 n-3 | 19.44 | 0.02 |
| ∑n-3 PUFA | 31.55 | 0.03 |
Data are means of triplicate.
CAM was provided by Beijing Shoulang Biotechnology Co., Ltd.
∑ SFA, saturated fatty acids sum; ∑ MUFA, monounsaturated fatty acids sum; ∑ n-6 PUFA, n-6 polyunsaturated fatty acids sum; ∑ n-3 PUFA, n-3 polyunsaturated fatty acids sum. Including some minor components not shown.
Growth parameters, feed utilization and feed cost of juvenile turbot fed the experimental diets (Means ± S.E.M) .
| Diets | Polynomial contrasts | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CAM0 | CAM15 | CAM30 | CAM45 | CAM60 | CAM80 |
| Linear | Quadratic | |
| FBW | 52.63 ± 2.09 | 49.32 ± 2.26 | 48.21 ± 0.85 | 43.61 ± 1.38 | 42.72 ± 3.22 | 41.32 ± 1.63 | 0.014 | 0.001 | 0.096 |
| Survival rate (%) | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 | 97.78 ± 2.22 | 10.00 ± 0.00 | 0.458 | 0.500 | 0.652 |
| SGR (%/day) | 2.87 ± 0.07 | 2.76 ± 0.08 | 2.73 ± 0.03 | 2.56 ± 0.05 | 2.52 ± 0.13 | 2.47 ± 0.06 | 0.017 | 0.001 | 0.084 |
| WG | 476.49 ± 22.89 | 440.22 ± 24.77 | 428.07 ± 9.24 | 377.68 ± 15.15 | 367.93 ± 35.31 | 352.57 ± 17.86 | 0.014 | 0.001 | 0.096 |
| FI | 1.52 ± 0.04 | 1.42 ± 0.03 | 1.47 ± 0.02 | 1.42 ± 0.05 | 1.44 ± 0.03 | 1.37 ± 0.03 | 0.017 | 0.015 | 0.662 |
| FER | 1.52 ± 0.04 | 1.59 ± 0.03 | 1.52 ± 0.03 | 1.51 ± 0.04 | 1.47 ± 0.04 | 1.53 ± 0.04 | 0.374 | 0.635 | 0.296 |
| PER | 2.98 ± 0.08 | 3.09 ± 0.05 | 2.97 ± 0.05 | 2.93 ± 0.07 | 2.87 ± 0.08 | 2.94 ± 0.08 | 0.415 | 0.387 | 0.201 |
| PR | 0.48 ± 0.01 | 0.48 ± 0.01 | 0.49 ± 0.01 | 0.49 ± 0.01 | 0.48 ± 0.01 | 0.49 ± 0.01 | 0.980 | 0.632 | 0.966 |
| LR | 0.35 ± 0.01
| 0.43 ± 0.01 | 0.49 ± 0.01 | 0.60 ± 0.02 | 0.67 ± 0.01 | 0.61 ± 0.01 | 0.000 | 0.000 | 0.000 |
| FY | 69.16 ± 0.50 | 67.28 ± 0.54 | 66.49 ± 0.60 | 66.36 ± 0.84 | 66.80 ± 0.90 | 65.61 ± 0.60 | 0.009 | 0.000 | 0.960 |
| Feed cost | 1.28 ± 0.03 | 1.21 ± 0.02 | 1.24 ± 0.02 | 1.19 ± 0.03 | 1.17 ± 0.02 | 1.10 ± 0.02 | 0.005 | 0.001 | 0.027 |
| CF | 3.42 ± 0.07 | 3.44 ± 0.05 | 3.34 ± 0.06 | 3.44 ± 0.05 | 3.44 ± 0.05 | 3.61 ± 0.11 | 0.722 | 0.955 | 0.625 |
| HSI | 1.21 ± 0.05 | 1.04 ± 0.04 | 1.25 ± 0.06 | 1.44 ± 0.11 | 1.44 ± 0.08 | 1.48 ± 0.11 | 0.000 | 0.025 | 0.176 |
| VSI | 5.38 ± 0.11 | 5.22 ± 0.09 | 5.39 ± 0.13 | 5.45 ± 0.10 | 5.55 ± 0.11 | 5.56 ± 0.18 | 0.316 | 0.488 | 0.052 |
Data are means of triplicate. Means in the same row sharing the same superscript letter are not significantly different determined by Tukey’s test (p > 0.05).
CAM0 was the control group, CAM15, CAM30, CAM45, CAM60 and CAM80 were replacement groups formulated by replacing 15%, 30%, 45%, 60% and 80% of fish meal in the control group.
IBW, initial body weight; FBW, final body weight; SGR, specific growth rate; WGR, weight gain rate; FI, feed intake; FER, feed efficiency ratio; PER, protein efficiency ratio; PR, protein retention; LR, lipid retention; FY, flesh yield; CF, condition factor; HSI, hepatosomatic index; VSI, viscerosomatic index; Feed cost, converted from CHY to USD with the exchange rate of 1: 6.5.
Body composition and dorsal muscle amino acids profile (Means ± S.E.M) .
| Diets | Polynomial contrasts | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CAM0 | CAM15 | CAM30 | CAM45 | CAM60 | CAM80 |
| Linear | Quadratic | |
| Body composition | |||||||||
| Moisture (%) | 76.66 ± 0.12 | 77.24 ± 0.54 | 76.69 ± 0.46 | 76.04 ± 0.02 | 75.71 ± 0.19 | 76.37 ± 0.10 | 0.070 | 0.134 | 0.086 |
| Crude protein (% w.w | 15.64 ± 0.07 | 15.34 ± 0.06 | 15.87 ± 0.09 | 15.98 ± 0.10 | 15.99 ± 0.07 | 15.82 ± 0.07 | 0.000 | 0.005 | 0.018 |
| Crude lipid (% w.w | 2.55 ± 0.11 | 2.88 ± 0.02 | 3.27 ± 0.04 | 3.86 ± 0.07 | 4.17 ± 0.15 | 3.64 ± 0.06 | 0.000 | 0.000 | 0.003 |
| Ash (% w.w | 3.39 ± 0.05 | 3.34 ± 0.04 | 3.26 ± 0.07 | 3.06 ± 0.02 | 3.10 ± 0.06 | 3.15 ± 0.05 | 0.001 | 0.000 | 0.192 |
| Essential amino acids (%/dry matter) | |||||||||
| Threonine | 4.15 ± 0.06 | 4.19 ± 0.04 | 4.19 ± 0.02 | 4.03 ± 0.01 | 4.08 ± 0.02 | 4.20 ± 0.02 | 0.010 | 0.497 | 0.804 |
| Valine | 4.38 ± 0.08a,
| 4.43 ± 0.04 | 4.48 ± 0.03 | 4.30 ± 0.02 | 4.23 ± 0.01 | 4.46 ± 0.04 | 0.005 | 0.650 | 0.365 |
| Methionine | 2.80 ± 0.05 | 2.86 ± 0.02 | 2.85 ± 0.02 | 2.70 ± 0.02 | 2.74 ± 0.01 | 2.86 ± 0.02 | 0.003 | 0.632 | 0.594 |
| Isoleucine | 4.27 ± 0.09 | 4.33 ± 0.05 | 4.37 ± 0.02 | 4.18 ± 0.03 | 4.07 ± 0.01 | 4.31 ± 0.04 | 0.009 | 0.259 | 0.171 |
| Leucine | 7.41 ± 0.13 | 7.51 ± 0.07 | 7.52 ± 0.05 | 7.18 ± 0.03 | 7.19 ± 0.02 | 7.45 ± 0.05 | 0.010 | 0.245 | 0.231 |
| Phenylalanine | 3.62 ± 0.05 | 3.62 ± 0.06 | 3.62 ± 0.01 | 3.54 ± 0.03 | 3.57 ± 0.03 | 3.66 ± 0.03 | 0.312 | 0.734 | 0.505 |
| Lysine | 7.99 ± 0.13 | 8.13 ± 0.08 | 8.14 ± 0.02 | 7.79 ± 0.04 | 7.76 ± 0.05 | 8.05 ± 0.05 | 0.008 | 0.307 | 0.142 |
| Histidine | 1.91 ± 0.02 | 1.92 ± 0.02 | 1.93 ± 0.02 | 1.85 ± 0.01 | 1.84 ± 0.01 | 1.90 ± 0.01 | 0.005 | 0.038 | 0.147 |
| Arginine | 5.46 ± 0.07 | 5.52 ± 0.06 | 5.52 ± 0.03 | 5.31 ± 0.04 | 5.34 ± 0.02 | 5.50 ± 0.03 | 0.015 | 0.376 | 0.406 |
| Non-essential amino acids (%/dry matter) | |||||||||
| Aspartic acid | 9.40 ± 0.14 | 9.53 ± 0.06 | 9.48 ± 0.06 | 9.17 ± 0.05 | 9.17 ± 0.02 | 9.46 ± 0.06 | 0.012 | 0.289 | 0.282 |
| Serine | 3.65 ± 0.04 | 3.67 ± 0.03 | 3.65 ± 0.02 | 3.56 ± 0.02 | 3.63 ± 0.02 | 3.72 ± 0.03 | 0.026 | 0.967 | 0.232 |
| Glutamic acid | 12.84 ± 0.25 | 13.06 ± 0.09 | 13.04 ± 0.05 | 12.51 ± 0.05 | 12.57 ± 0.04 | 12.97 ± 0.05 | 0.180 | 0.485 | 0.279 |
| Glycine | 4.24 ± 0.11 | 4.27 ± 0.02 | 4.26 ± 0.02 | 4.28 ± 0.07 | 4.42 ± 0.03 | 4.57 ± 0.01 | 0.007 | 0.005 | 0.004 |
| Alanine | 5.39 ± 0.07 | 5.49 ± 0.03 | 5.50 ± 0.04 | 5.34 ± 0.04 | 5.42 ± 0.03 | 5.64 ± 0.09 | 0.021 | 0.083 | 0.283 |
| Cysteine | 1.15 ± 0.14 | 1.29 ± 0.05 | 1.21 ± 0.07 | 1.15 ± 0.07 | 1.46 ± 0.08 | 1.35 ± 0.3 | 0.628 | 0.279 | 0.634 |
| Tyrosine | 3.24 ± 0.06 | 3.28 ± 0.05 | 3.28 ± 0.01 | 3.13 ± 0.01 | 3.15 ± 0.02 | 3.26 ± 0.03 | 0.034 | 0.295 | 0.522 |
| Proline | 2.47 ± 0.10 | 2.41 ± 0.06 | 2.42 ± 0.06 | 2.31 ± 0.04 | 2.52 ± 0.02 | 2.40 ± 0.04 | 0.281 | 0.478 | 0.490 |
Data are means of triplicate. Means in the same row sharing the same superscript letter are not significantly different determined by Tukey’s test (p > 0.05).
CAM0 was the control group, CAM15, CAM30, CAM45, CAM60 and CAM80 were replacement groups formulated by substituting 15%, 30%, 45%, 60% and 80% of fish meal in the control group.
w.w, wet weight.
This indicate that there is a significant difference in values between groups.
Fatty acids profile in dorsal muscle of juvenile turbot (Means ± S.E.M) .
| Fatty acids profile/(% total fatty acids) | Diets | Polynomial contrasts | |||||||
|---|---|---|---|---|---|---|---|---|---|
| CAM0 | CAM15 | CAM30 | CAM45 | CAM60 | CAM80 |
| Linear | Quadratic | |
| C14:0 | 2.45 ± 0.11 | 3.10 ± 0.29 | 3.11 ± 0.40 | 3.07 ± 0.15 | 3.22 ± 0.16 | 4.11 ± 0.04 | 0.007 | 0.001 | 0.094 |
| C16:0 | 23.46 ± 0.12 | 22.51 ± 0.10 | 22.58 ± 0.22 | 22.42 ± 0.06 | 23.72 ± 0.35 | 22.65 ± 0.15 | 0.001 | 0.049 | 0.008 |
| C18:0 | 7.38 ± 0.01 | 6.35 ± 0.26 | 6.32 ± 0.45 | 6.36 ± 0.18 | 6.59 ± 0.07 | 5.09 ± 0.02 | 0.000 | 0.000 | 0.136 |
| C24:0 | 2.08 ± 0.04 | 2.22 ± 0.05 | 2.15 ± 0.04 | 1.98 ± 0.03 | 1.76 ± 0.08 | 1.98 ± 0.06 | 0.001 | 0.013 | 0.001 |
| ∑ SFA | 35.37 ± 0.21 | 34.18 ± 0.13 | 34.16 ± 0.32 | 33.83 ± 0.07 | 35.28 ± 0.50 | 33.82 ± 0.19 | 0.004 | 0.007 | 0.135 |
| C16:1 | 2.69 ± 0.12 | 3.39 ± 0.30 | 3.21 ± 0.41 | 3.14 ± 0.12 | 3.13 ± 0.11 | 3.86 ± 0.05 | 0.045 | 0.012 | 0.637 |
| C17:1 | 0.43 ± 0.01e | 0.66 ± 0.05 | 0.79 ± 0.06 | 0.90 ± 0.02 | 1.09 ± 0.07 | 1.46 ± 0.04 | 0.000 | 0.000 | 0.000 |
| C18:1,cis | 13.01 ± 0.36 | 13.64 ± 0.43 | 13.79 ± 0.27 | 14.29 ± 0.16 | 14.74 ± 0.35 | 15.17 ± 0.36 | 0.007 | 0.000 | 0.040 |
| C18:1,trans | 3.13 ± 0.03 | 3.08 ± 0.08 | 3.04 ± 0.10 | 2.95 ± 0.01 | 2.99 ± 0.06 | 2.99 ± 0.04 | 0.412 | 0.064 | 0.792 |
| C20:1 | 2.12 ± 0.07 | 2.51 ± 0.16 | 2.63 ± 0.27 | 2.78 ± 0.07 | 2.85 ± 0.10 | 3.77 ± 0.11 | 0.000 | 0.000 | 0.001 |
| ∑ MUFA | 21.39 ± 0.58 | 23.28 ± 1.00 | 23.46 ± 1.08 | 24.07 ± 0.12 | 24.81 ± 0.69 | 27.25 ± 0.58 | 0.003 | 0.000 | 0.029 |
| C18:2 n-6 | 7.42 ± 0.04 | 8.42 ± 0.26 | 8.39 ± 0.44 | 8.71 ± 0.09 | 8.78 ± 0.15 | 10.07 ± 0.04 | 0.000 | 0.000 | 0.009 |
| C20:2 n-6 | 0.51 ± 0.01 | 0.58 ± 0.01 | 0.60 ± 0.02 | 0.57 ± 0.02 | 0.57 ± 0.01 | 0.65 ± 0.01 | 0.000 | 0.000 | 0.460 |
| C20:4 n-6 | 1.36 ± 0.04 | 1.21 ± 0.05 | 1.20 ± 0.10 | 1.18 ± 0.04 | 1.13 ± 0.04 | 1.01 ± 0.02 | 0.015 | 0.001 | 0.158 |
| ∑ n-6 PUFA | 9.29 ± 0.08 | 10.22 ± 0.23 | 10.19 ± 0.34 | 10.46 ± 0.08 | 10.48 ± 0.20 | 11.72 ± 0.04 | 0.000 | 0.000 | 0.007 |
| C18:3 n-3 | 0.68 ± 0.01 | 0.89 ± 0.07 | 0.88 ± 0.10 | 0.88 ± 0.03 | 0.85 ± 0.01 | 1.22 ± 0.02 | 0.000 | 0.000 | 0.032 |
| C20:5 n-3 | 7.11 ± 0.13 | 7.55 ± 0.10 | 7.01 ± 0.15 | 6.77 ± 0.06 | 6.03 ± 0.27 | 6.42 ± 0.10 | 0.000 | 0.001 | 0.012 |
| C22:6 n-3 | 19.83 ± 0.59 | 18.65 ± 0.54 | 17.83 ± 0.83 | 16.56 ± 0.21 | 15.33 ± 0.81 | 14.75 ± 0.52 | 0.001 | 0.000 | 0.008 |
| ∑ n-3 PUFA | 27.62 ± 0.71 | 27.09 ± 0.36 | 25.72 ± 0.84 | 24.22 ± 0.25 | 22.21 ± 1.09 | 22.39 ± 0.61c,
| 0.000 | 0.000 | 0.003 |
| ∑ SFA/∑ PUFA | 0.96 ± 0.03 | 0.92 ± 0.01 | 0.95 ± 0.01 | 0.98 ± 0.01 | 1.08 ± 0.06 | 0.99 ± 0.02 | 0.016 | 0.072 | 0.024 |
| ∑ n-3 PUFA/∑ n-6 PUFA | 2.97 ± 0.05 | 2.65 ± 0.10 | 2.53 ± 0.16 | 2.32 ± 0.03 | 2.12 ± 0.06 | 1.91 ± 0.05 | 0.000 | 0.000 | 0.985 |
Data are means of triplicate. Means in the same row sharing the same superscript letter are not significantly different determined by Tukey’s test (p > 0.05).
CAM0 was the control group, CAM15, CAM30, CAM45, CAM60 and CAM80 were replacement groups formulated by replacing 15%, 30%, 45%, 60% and 80% fish meal in the control group.
SFA, saturated fatty acids; MUFA, monounsaturated fatty acids; n-6 PUFA, n-6 polyunsaturated fatty acids; n-3 PUFA, n-3 polyunsaturated fatty acids. Some fatty acids with extremely low content are not listed.
This indicate that there is a significant difference in values between groups.
Apparent digestibility coefficient of dry matter, protein, lipid and amino acids of the experimental diets (Means ± S.E.M) .
| Diets | Polynomial contrasts | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CAM0 | CAM15 | CAM30 | CAM45 | CAM60 | CAM80 |
| Linear | Quadratic | |
| Dry matter (%) | 69.25 ± 0.37 | 70.35 ± 0.29 | 69.74 ± 0.27 | 68.68 ± 0.16 | 69.78 ± 0.33 | 69.16 ± 0.43 | 0.040 | 0.961 | 0.051 |
| Protein (%) | 91.03 ± 0.14 | 92.02 ± 0.08 | 92.73 ± 0.13 | 91.71 ± 0.08 | 92.89 ± 0.22 | 92.93 ± 0.05 | 0.000 | 0.000 | 0.267 |
| Lipid (%) | 76.08 ± 1.06 | 80.24 ± 0.61 | 78.91 ± 1.12 | 76.32 ± 0.70 | 78.29 ± 0.66 | 76.92 ± 1.66 | 0.352 | 0.190 | 0.783 |
| Essential amino acids (%) | |||||||||
| Threonine | 92.33 ± 0.29 | 93.68 ± 0.14 | 93.28 ± 0.07 | 93.12 ± 0.13 | 93.84 ± 0.20 | 93.44 ± 0.21 | 0.000 | 0.000 | 0.113 |
| Valine | 92.76 ± 0.28 | 93.89 ± 0.05 | 93.59 ± 0.09 | 93.11 ± 0.16 | 94.13 ± 0.11 | 94.21 ± 0.11 | 0.000 | 0.000 | 0.530 |
| Methionine | 94.39 ± 0.68 | 96.18 ± 0.51 | 95.65 ± 0.58 | 95.01 ± 0.62 | 94.67 ± 0.67 | 95.5 ± 0.60 | 0.358 | 0.343 | 0.162 |
| Isoleucine | 93.61 ± 0.21 | 94.67 ± 0.29 | 93.87 ± 0.23 | 93.31 ± 0.59 | 94.46 ± 0.25 | 94.78 ± 0.51 | 0.061 | 0.121 | 0.626 |
| Leucine | 94.93 ± 0.13 | 95.35 ± 0.08 | 95.11 ± 0.13 | 94.93 ± 0.19 | 95.23 ± 0.09 | 95.34 ± 0.08 | 0.082 | 0.079 | 0.922 |
| Phenylalanine | 93.60 ± 0.18 | 93.38 ± 0.35 | 93.24 ± 0.32 | 93.26 ± 0.22 | 93.81 ± 0.20 | 94.28 ± 0.3 | 0.095 | 0.337 | 0.011 |
| Lysine | 96.72 ± 0.15 | 97.21 ± 0.06 | 97.02 ± 0.12 | 96.82 ± 0.14 | 97.19 ± 0.11 | 97.33 ± 0.13 | 0.014 | 0.006 | 0.741 |
| Histidine | 94.68 ± 0.10 | 95.25 ± 0.04 | 95.12 ± 0.02 | 95.10 ± 0.05 | 95.66 ± 0.17 | 95.95 ± 0.35 | 0.001 | 0.000 | 0.033 |
| Arginine | 94.26 ± 0.24 | 95.34 ± 0.03 | 95.17 ± 0.06 | 95.14 ± 0.04 | 95.52 ± 0.11 | 95.72 ± 0.16 | 0.000 | 0.000 | 0.982 |
| Non-essential amino acids (%) | |||||||||
| Aspartic acid | 92.57 ± 0.37 | 93.90 ± 0.24 | 93.66 ± 0.23 | 93.75 ± 0.16 | 94.75 ± 0.17 | 94.76 ± 0.2 | 0.000 | 0.000 | 0.147 |
| Serine | 92.70 ± 0.34 | 93.53 ± 0.13 | 93.13 ± 0.13 | 93.01 ± 0.11 | 93.34 ± 0.09 | 93.31 ± 0.13 | 0.051 | 0.020 | 0.260 |
| Glutamic acid | 94.55 ± 0.16 | 95.20 ± 0.08 | 95.00 ± 0.03 | 94.99 ± 0.05 | 95.06 ± 0.10 | 94.46 ± 0.11 | 0.000 | 0.107 | 0.000 |
| Glycine | 93.74 ± 0.24 | 94.38 ± 0.07 | 94.08 ± 0.10 | 93.82 ± 0.11 | 93.78 ± 0.46 | 94.18 ± 0.21 | 0.365 | 0.446 | 0.324 |
| Alanine | 94.26 ± 0.16 | 94.85 ± 0.09 | 94.74 ± 0.05 | 94.37 ± 0.08 | 94.50 ± 0.09 | 94.39 ± 0.06 | 0.002 | 0.183 | 0.000 |
| Cysteine | 83.98 ± 1.51 | 84.56 ± 0.57 | 84.12 ± 0.98 | 83.97 ± 0.94 | 84.72 ± 1.24 | 86.75 ± 0.54 | 0.413 | 0.227 | 0.187 |
| Tyrosine | 95.54 ± 0.22 | 95.41 ± 0.33 | 95.48 ± 0.28 | 95.62 ± 0.23 | 96.23 ± 0.11 | 96.70 ± 0.15 | 0.005 | 0.009 | 0.001 |
| Proline | 88.18 ± 0.12 | 89.09 ± 0.21 | 88.93 ± 0.26 | 88.38 ± 0.41 | 88.43 ± 0.29 | 87.31 ± 0.32 | 0.005 | 0.394 | 0.000 |
Data are means of triplicate. Means in the same row sharing the same superscript letter are not significantly different determined by Tukey’s test (p > 0.05).
CAM0 was the control group, CAM15, CAM30, CAM45, CAM60 and CAM80 were replacement groups formulated by replacing 15%, 30%, 45%, 60% and 80% of fish meal in the control group.
Serum and hepatic biochemical index (Means ± S.E.M) .
| Diets | Polynomial contrasts | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CAM0 | CAM15 | CAM30 | CAM45 | CAM60 | CAM80 |
| Linear | Quadratic | |
| Serum | |||||||||
| GPT | 10.89 ± 0.10 | 10.93 ± 0.03 | 10.42 ± 0.17 | 10.07 ± 0.27 | 9.42 ± 0.27 | 8.97 ± 0.23 | 0.000 | 0.000 | 0.880 |
| GOT | 3.75 ± 0.13 | 2.34 ± 0.31 | 2.28 ± 0.11 | 2.07 ± 0.05 | 3.13 ± 0.19 | 2.61 ± 0.26 | 0.000 | 0.101 | 0.001 |
| HDL-C | 0.87 ± 0.03 | 1.12 ± 0.02 | 1.08 ± 0.02 | 0.99 ± 0.02 | 1.06 ± 0.08 | 1.00 ± 0.07 | 0.016 | 0.055 | 0.009 |
| LDL-C | 0.72 ± 0.06 | 0.62 ± 0.02 | 0.56 ± 0.02 | 0.77 ± 0.05 | 0.50 ± 0.02 | 0.57 ± 0.06 | 0.003 | 0.017 | 0.725 |
| T-CHO | 2.59 ± 0.18 | 1.72 ± 0.09 | 1.71 ± 0.03 | 2.09 ± 0.12 | 1.89 ± 0.04 | 1.77 ± 0.08 | 0.000 | 0.108 | 0.330 |
| TG | 1.49 ± 0.04 | 0.55 ± 0.02 | 0.71 ± 0.03 | 1.14 ± 0.08 | 1.05 ± 0.08 | 0.72 ± 0.03 | 0.000 | 0.082 | 0.043 |
| Glucose (mmol/L) | 1.67 ± 0.15 | 0.20 ± 0.01 | 0.23 ± 0.04 | 0.26 ± 0.21 | 0.39 ± 0.01 | 0.45 ± 0.07 | 0.000 | 0.034 | 0.000 |
| Liver | |||||||||
| TG (umol/L) | 13.62 ± 0.16 | 10.67 ± 0.18 | 12.99 ± 0.37 | 10.94 ± 0.28 | 14.95 ± 0.22 | 16.57 ± 0.45 | 0.001 | 0.005 | 0.001 |
| T-CHO (umol/g liver) | 5.62 ± 0.20 | 5.05 ± 0.18 | 4.54 ± 0.11 | 4.68 ± 0.25 | 4.42 ± 0.06 | 5.16 ± 0.18 | 0.001 | 0.015 | 0.039 |
| Glucose (umol/g liver) | 2.50 ± 0.06 | 2.95 ± 0.25 | 3.18 ± 0.10 | 3.16 ± 0.14 | 3.18 ± 0.16 | 3.19 ± 0.10 | 0.022 | 0.001 | 0.546 |
Data are means of triplicate. Means in the same row sharing the same superscript letter are not significantly different determined by Tukey’s test (p > 0.05).
CAM0 was the control group, CAM15, CAM30, CAM45, CAM60 and CAM80 were replacement groups formulated by replacing 15%, 30%, 45%, 60% and 80% of fish meal in the control group.
GOT, glutamic oxalacetic transaminase; GPT, glutamic-pyruvic transaminase; HDL-C, high-density lipoprotein cholesterol; LDL-C, high-density lipoprotein cholesterol; T-CHO, total cholesterol; TG, triglycerides.
This indicate that there is a significant difference in values between groups.
FIGURE 1Representative liver sections (stained by haematoxylin and eosin) of juvenile turbot fed with different diets (Scale bars, 50 μm). CAM0 (A) was the control group, CAM15 (B), CAM30 (C), CAM45 (D), CAM60 (E) and CAM80 (F) were replacement groups formulated by replacing 15%, 30%, 45%, 60% and 80% fish meal in the control group.
FIGURE 2Relative mRNA expression of peptide and amino acids transporters in intestine of turbot fed different diets. Data are presented as means ± S.E.M (n = 3). Columns sharing the same superscript letter or absence of superscripts are not significantly different determined by Tukey’s test (p > 0.05). Transcriptional levels were normalized by the reference gene of RNA polymerase II subunit D (rpsd). pept1, peptide transporter 1; cat2, cationic amino acid transporter 2; b at1, B0-type amino acid transporter 1; b at, b0,+-type amino acid transporter; pat1, proton-coupled amino acid transporter 1; asct2, system ASC amino acid transporter-2; snat2, sodium-coupled neutral amino acid transporter 2; tat1, T-type amino acid transporter 1; y lat1, system y+L amino acid transporter 1. Polynomial contrasts analysis: pept1: P value = 0.000, P Linear = 0.354, P Quadratic = 0.000; cat2: P value = 0.000, P Linear = 0.001, P Quadratic = 0.023; b at1: P value = 0.000, P Linear = 0.166, P Quadratic = 0.000; b at: P value = 0.000, P Linear = 0.000, P Quadratic = 0.337; pat1: P value = 0.000; P Linear = 0.073, P Quadratic = 0.001; asct2: P value = 0.000, P Linear = 0.000, P Quadratic = 0.000; snat2: P value = 0.001, P Linear = 0.004, P Quadratic = 0.927; tat1: P value = 0.000, P Linear = 0.381, P Quadratic = 0.007; y lat1: P value = 0.000, P Linear = 0.008, P Quadratic = 0.445.
FIGURE 3Relative mRNA expression related to protein metabolism in liver (A) and muscle (B) of juvenile turbot fed different diets. Data are presented as means ± S.E.M (n = 3). Columns sharing the same superscript letter or absence of superscripts are not significantly different determined by Tukey’s test (p > 0.05). Transcriptional levels were normalized by the reference gene of RNA polymerase II subunit D (rpsd). gcn2, general control nonderepressible 2; mtor, mammalian target of rapamycin; 4e-bp1, eukaryotic initiation factor 4E-binding protein 1. Polynomial analysis in (A): gcn2: P value = 0.003, P Linear = 0.454, P Quadratic = 0.002; 4e-bp1: P value = 0.000, P Linear = 0.000, P Quadratic = 0.001; mtor: P value = 0.038, P Linear = 0.123, P Quadratic = 0.898. Polynomial analysis in (B): gcn2: P value = 0.000, P Linear = 0.154, P Quadratic = 0.016; 4e-bp1: P value = 0.000, P Linear = 0.054, P Quadratic = 0.599; mtor: P value = 0.001, P Linear = 0.114, P Quadratic = 0.254.
FIGURE 4Relative mRNA expression related to protein degradation in muscle of juvenile turbot fed different diets. Data are presented as means ± S.E.M (n = 3). Columns sharing the same superscript letter or absence of superscripts are not significantly different determined by Tukey’s test (p > 0.05). Transcriptional levels were normalized by the reference gene of RNA polymerase II subunit D (rpsd). capns1-like, calpain small subunit 1-like; atg4b, autophagy related 4B cysteine peptidase. atg12, autophagy related 12 homolog. Polynomial analysis: atrogin-1: P value = 0.000, P Linear = 0.127, P Quadratic = 0.000; capns1-like: P value = 0.004, P Linear = 0.003, P Quadratic = 0.029; atg4b: P value = 0.000, P Linear = 0.936, P Quadratic = 0.013; atg12: P value = 0.008, P Linear = 0.140, P Quadratic = 0.749; lc3b: P value = 0.000, P Linear = 0.004, P Quadratic = 0.000; cathepsin-d: P value = 0.001, P Linear = 0.000, P Quadratic = 0.623; calpastatin: P value = 0.001, P Linear = 0.000, P Quadratic = 0.004.
FIGURE 5Relative mRNA expression related to lipid metabolism in liver of juvenile turbot fed different diets. lipogenesis related genes (A); lipid oxidation related genes (B); lipid transport related genes (C). Data are presented as means ± S.E.M (n = 3). Columns sharing the same superscript letter or absence of superscripts are not significantly different determined by Tukey’s test (p > 0.05). Transcriptional levels were normalized by the reference gene of RNA polymerase II subunit D (rpsd). as, fatty acid synthase; lxr, liver X receptor; pparγ, peroxisome proliferator-activated receptor γ; srebp-1, sterol-regulatory element binding protein-1; lpl, lipoprotein lipase; ampk1α, adenosine monophosphate activated protein kinase1α;cpt1, carnitine palmitoyl transferase 1; mtp, mitochondrial trifunctional protein; apob-100, apolipoprotein B-100; hnf4α, hepatocyte nuclear factor 4α. Polynomial analysis: fas: P value = 0.003, P Linear = 0.009, P Quadratic = 0.338; lxr: P value = 0.003, P Linear = 0.002, P Quadratic = 0.012; pparγ: P value = 0.000, P Linear = 0.000, P Quadratic = 0.085; srebp-1: P value = 0.000, P Linear = 0.000, P Quadratic = 0.026; lipin1: P value = 0.000, P Linear = 0.004, P Quadratic = 0.100; lpl: P value = 0.000, P Linear = 0.001, P Quadratic = 0.018; ampk1α: P value = 0.000, P Linear = 0.060, P Quadratic = 0.021; cpt1: P value = 0.001, P Linear = 0.001, P Quadratic = 0.003; mtp: P value = 0.000, P Linear = 0.002, P Quadratic = 0.022; apob-100: P value = 0.000, P Linear = 0.000, P Quadratic = 0.602; hnf4α: P value = 0.628, P Linear = 0.413, P Quadratic = 0.352.