Literature DB >> 36079686

Classification and Identification of S Haplotypes in Radish Based on SRK Kinase Domain Sequence Analysis.

Meng Ni1, Xiaofang Yi1, Qin Wang1, Juan Wang1, Shuang Wang1, Liwang Liu1, Liang Xu1, Yan Wang1.   

Abstract

Radish is a typical self-incompatible crop. The rapid and accurate identification of S haplotypes can circumvent the blindness of the hybrid combination process, which is critical in radish heterosis utilization and the breeding of new varieties. In this study, based on the gene sequence which encodes the S-locus receptor kinase (SRK) of radish, and the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis, the S haplotypes were identified among 79 cultivated radish genotypes. The PCR results indicated that 79 radish genotypes could be divided into 48 Class I, 13 Class II, and 17 Class I/II S haplotypes. Sequence alignment confirmed that the Class I materials contained 19 S haplotypes, of which three haplotypes ('NAU-S53', 'NAU-S54' and 'NAU-S55') were identified for the first time in radish. After digestion using the Hinf I restriction endonuclease, the SRK domain of DNA fragments of different genotypes showed high polymorphism. Homozygous materials S haplotypes could be quickly distinguished by the differences in the digested bands. Molecular identification of the S haplotype was highly consistent with the field pollination and pollen tube germination results. These results would provide an important approach for the rapid identification of radish S haplotypes and the efficient utilization of self-incompatibility in heterosis breeding.

Entities:  

Keywords:  PCR-RFLP; S haplotype; SRK gene; radish; self-incompatibility

Year:  2022        PMID: 36079686      PMCID: PMC9459979          DOI: 10.3390/plants11172304

Source DB:  PubMed          Journal:  Plants (Basel)        ISSN: 2223-7747


1. Introduction

Radish (Raphanus sativus L.) is an economically important root vegetable crop belonging to the Brassicaceae family. As a self-incompatibility (SI) plant, radish exhibits obvious heterosis in hybrid seeds production. The SI is an important mechanism that prevents self-fertilization and maintains genetic diversity in flowering plants. Based on the genetic mechanism controlling the SI phenotype of the pollen, the SI systems are generally classified into Gametophytic SI (GSI) and Sporophytic SI (SSI). The pollen phenotype of GSI systems is conferred by the S genotypes of haploid pollen, while the phenotype of pollen grains in plants with SSI is determined by the S genotype of the diploid parent that produces pollen [1,2]. The SSI is controlled by one highly polymorphic S-locus containing three tightly linked genes such as the S-locus receptor kinase (SRK), S-locus glycoprotein (SLG) and S-locus cysteine rich (SCR), which has been well described in Brassica crops such as B. rapa [3] and B. oleracea [4]. Among them, SRK localized in the stigmatic papilla cells as the female determinant, and the pollen coat protein SCR/SP11 controls the pollen determinant of SSI. On the basis of the SI phenotype and the sequence similarity of the S alleles, the S haplotypes in Brassica have been categorized into Class I and Class II. Class I haplotypes have a strong self-incompatible phenotypic effect and are generally considered dominant or co-dominant with other S haplotypes [5,6]. The SI system has been extensively used in F1 hybrid breeding of radish and other Brassica species, which has advantages including high efficiency and easy short-period breeding [7,8]. However, F1 seeds cannot be successfully produced at the anthesis stage if the parents share the same S-haplotype [6]. The rapid and accurate identification of S haplotypes can circumvent the blindness of the hybrid combination process, which is critical in radish heterosis utilization and the breeding of new varieties. In early studies, compatibility index analysis, pollen tube observation [9], fluorescence analysis [9,10] and isoelectric focusing gel examination [11] were often employed to conduct the S haplotype identification in Brassicaceae crops such as B. oleracea and R. sativus, however, it was difficult to widely apply for time consuming, labor costly and [12] complex operation. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) has been successfully implemented to identify S haplotypes in B. rapa [13], B. oleracea [14], and R. sativus [15,16], but it has some drawbacks and is limited by whether the material is homozygous in the application. With the increasing report about S locus gene sequences information, the polymorphism analysis of SRK or SLG gene sequences was developed into a new approach for accurate and rapid identification of S haplotype in many crops such as R. sativus [6] and Chinese cabbage [17]. In addition, alignment analysis of the only female determinant SRK has been reported to be reliable as a method for S haplotype identification, and has been used for the identification of S haplotypes of breeding lines in broccoli and cabbage [18,19]. Previous studies have shown that S-locus gene sequences are not conserved among different S haplotypes [20,21]. The identification of the radish S haplotype focused on the gene sequence of the S locus and was carried out by different teams around the world [7,15,22,23,24,25,26,27,28,29,30]. However, various groups use their own naming scheme for S haplotypes, which result in confusion of S haplotype names and limit the application of self-incompatibility of radish in heterosis breeding. Therefore, the unified naming of S haplotypes and the establishment of standard test lines are necessary for rapid and accurate identification of radish haplotypes. In the present study, we firstly sorted out and named all of the currently published radish S haplotypes. Following, the S haplotypes of 79 cultivated radish genotypes were identified based on the gene sequence of SRK analysis, and also the PCR-RFLP marker was developed to rapidly classify the radish Class I S haplotype. In addition, the artificial pollination and pollen tube observation experiments were utilized to verify the accuracy of molecular identification. These results would provide an important theoretical basis for efficient utilization of self-incompatibility in heterosis breeding.

2. Results

2.1. Comparison and Unified Nomenclature of Published S haplotype in Radish (Raphanus sativus L.)

In previous reports, a total of 35 S haplotypes were found by Nishio [29] and Haseyama [30] in radish, but the results were incomplete. Therefore, comprehensive published information on radish S haplotypes [7,15,22,23,24,25,26,27,28,29,30] were collected, and their nucleotide and amino acid sequences were futher compared in this study (Table S1). It was found that the S haplotypes identified by the teams intersected with each other (Figure S1). After removing the redundant members based on BLAST analysis of the reported S gene nucleotide and amino acid sequence, 52 S haplotypes have been identified in radish, which were numbered as ‘NAU-S1’-‘NAU-S52’ (Table 1).
Table 1

Summary of S haplotypes in radish.

S Haplotyes(Renumbered in This Study)S Haplotypes(Okamoto) [23]S Haplotypes(Lim) [16]S Haplotypes(Kim D) [26,27,28] S Haplotypes(Other Group) SimilarityOkamoto vs. LimSimilarityLim vs. Kim D (or Other Group)
NAU-S1S1S6S31 99.8%100%
NAU-S2S2S2S2 100%100%
NAU-S3S3S12 99.9%
NAU-S4S4S7S6 100%100%
NAU-S5S5
NAU-S6S6S18S15 100%100%
NAU-S7S8
NAU-S8S9S21 S4/S5 (SP11-4/5) (Kim H, 2003) 99.3%98.7%
NAU-S9S11
NAU-S10S14
NAU-S11S15 S2 (SP11-2) (Kim H, 2003) 100%
NAU-S12S17S9S5 99.7%100%
NAU-S13S18
NAU-S14S19S8S7 (S30) 100%100%
NAU-S15S21
NAU-S16S22 (S7) S16S13 100%99.1%
NAU-S17S23S20S16 99.9%100%
NAU-S18S25S17 99.9%
NAU-S19S26S4 S1 (SP11-1) (Kim H, 2003) 100%100%
NAU-S20S28
NAU-S21S29S26 S3 (SP11-3) (Kim H, 2003) 99.4%100%
NAU-S22S30S1S1 100%100%
NAU-S23S31
NAU-S24 S5
NAU-S25 S10S14 99.73%
NAU-S26 S11S9 (S27) S38 [6] DQ984139 [7] 100%
NAU-S27 S15S12 100%
NAU-S28 S22
NAU-S29 S23S19 100%
NAU-S30 S24
NAU-S31 S27S24 99.8%
NAU-S32 S29
NAU-S33 S30
NAU-S34 S31S29 100%
NAU-S35 S4
NAU-S36 S8
NAU-S37 S10
NAU-S38 S11
NAU-S39 S17
NAU-S40 S18
NAU-S41 S20
NAU-S42 S21
NAU-S43 S22
NAU-S44 S23
NAU-S45 S25S39 [6] 100%
NAU-S46 S28
NAU-S47 S201 (Niikura, 1997)
NAU-S48 EF056499 [7]
NAU-S49 GQ121139 [22]
NAU-S50 S40 [6]
NAU-S51 S48 (Kim S, 2021)
NAU-S52 S6 [25]

2.2. SRK Kinase Domain-Based Classification and Identification of S haplotypes

Class Ⅰ and Class Ⅱ primers were designed based on the sequence of the SRK kinase region, which can be applied to classify the compatibility of different genotypes. Class Ⅰ exhibits strong self-incompatibility, while Class Ⅱ exhibits weak self-incompatibility. Incompatibility Classes I and II show a dominant relationship [31,32]. The primers KD (I)-F/R and KD4/KD7 can respectively generate 1200 (Figure 1A) and 1000 bp (Figure 1B) bands among the radish materials. PCR results shown that the 79 radish genotypes could be divided into Class I (48), Class II (13) and Class I/II (17) groups. Homozygous Class I and II S haplotype materials are found in 60.76% and 16.46% of radish, respectively. Strong self-incompatibility occurs more frequently (Table 2).
Figure 1

PCR amplification of SRK kinase domain in radish. (A) PCR amplification results of KD(I)-F/R in NAU-R1-NAU-R79; (B) PCR amplification results of KD4/KD7 in NAU-R49-NAU-R79.

Table 2

The classification of S haplotypes in radish.

Class of S Haplotypes GenotypeFrequency (%)
Class INAU-Rs1, NAU-Rs2, NAU-Rs3, NAU-Rs4, NAU-Rs5, NAU-Rs6, NAU-Rs7, NAU-Rs8, NAU-Rs9, NAU-Rs10, NAU-Rs11, NAU-Rs12, NAU-Rs13, NAU-Rs14, NAU-Rs15, NAU-Rs16, NAU-Rs17, NAU-Rs18, NAU-Rs19, NAU-Rs20, NAU-Rs21, NAU-Rs22, NAU-Rs23, NAU-Rs24, NAU-Rs25, NAU-Rs26, NAU-Rs27, NAU-Rs28, NAU-Rs29, NAU-Rs30, NAU-Rs31, NAU-Rs32, NAU-Rs33, NAU-Rs34, NAU-Rs35, NAU-Rs36, NAU-Rs37, NAU-Rs38, NAU-Rs39, NAU-Rs40, NAU-Rs41, NAU-Rs42, NAU-Rs43, NAU-Rs44, NAU-Rs45, NAU-Rs46, NAU-Rs47, NAU-Rs4860. 76
Class IINAU-Rs53, NAU-Rs54, NAU-Rs55, NAU-Rs58, NAU-Rs60, NAU-Rs62, NAU-Rs65, NAU-Rs68, NAU-Rs69, NAU-Rs70, NAU-Rs71, NAU-Rs72, NAU-Rs7516. 46
Class I/Class IINAU-Rs49, NAU-Rs50, NAU-Rs51, NAU-Rs56, NAU-Rs57, NAU-Rs59, NAU-Rs61, NAU-Rs63, NAU-Rs64, NAU-Rs66, NAU-Rs67, NAU-Rs73, NAU-Rs74, NAU-Rs76, NAU-Rs77, NAU-Rs78, NAU-Rs7921. 52
The types and frequencies of S haplotypes in the tested radish materials were analyzed according to the S haplotype system established in this study. The 48 Class I materials contained 19 sequence types, of which 16 indicated high similarities to known S haplotypes. Among them, the nucleotide sequences of eight lines were highly similar to Okamoto (S22, S7), Lim (S16), and Kim D (S13) and were identified as ‘NAU-S16’, with a frequency of up to 16.67%. Likewise, seven lines were ‘NAU-S25’, with a frequency of 14.58% as well as five lines were ‘NAU-S17’, with a frequency of 10.41%. There were four materials of ‘NAU-S51’ type, with a frequency of 8.33%. The ‘NAU-S04’ and ‘NAU-S44’ types comprised three materials, and the frequency was 6.25%. The ‘NAU-S02’ and ‘NAU-S14’ types appeared twice, and the other S haplotypes appeared only once in the tested materials (Table 3). The predicted amino acid sequence was used in a protein BLAST search. The SRK sequence information of NAU-Rs46, NAU-Rs47, and NAU-Rs48, has not been found in the NCBI database. It was thus preliminarily inferred that there were three new S haplotypes, which were respectively named as ‘NAU-S53’, ‘NAU-S54’, and ‘NAU-S55’ (The nucleotide sequences of new S haplotypes are listed in Table S2).
Table 3

S haplotypes frequencies among 48 Class I radish materials.

S HaplotypeNumber of OccurrencesFrequency (%)
NAU-S16816. 67
NAU-S25714. 58
NAU-S17510. 41
NAU-S15/NAU-S5148. 33
NAU-S04/NAU-S4436. 25
NAU-S02/NAU-S1424. 17
NAU-S05/NAU-S06/NAU-S22/NAU-S26/NAU-S29/NAU-S37/NAU-S40NAU-S53/NAU-S54/NAU-S5512. 08
The S haplotypes of the 13 Class II radish genotypes identified were focused on four types including ‘NAU-S38’, ‘NAU-S39’, ‘NAU-S43’, and ‘NAU-S52’ (Table 4). In addition, the ClassI/II SRK gene could be simultaneously amplified by the primer of KD (D)-F/R and KD4/KD7 among 17 materials which maybe heterozygous at the S locus (Table 5).
Table 4

S haplotypes frequencies among 13 Class II radish materials.

S HaplotypeGenotypeNumber of OccurrencesFrequency (%)
NAU-S39NAU-Rs53, NAU-Rs55, NAU-Rs58, NAU-Rs70, NAU-Rs72538.46
NAU-S52NAU-Rs60, NAU-Rs65, NAU-Rs69, NAU-Rs75430.77
NAU-S43NAU-Rs54, NAU-Rs68, NAU-Rs71323.08
NAU-S38NAU-Rs6217.69
Table 5

Distribution of S haplotype in 17 Class I/II radish materials.

GenotypeS Haplotype (Class I) S Haplotype (Class II)
NAU-Rs49NAU-S17NAU-S39
NAU-Rs50NAU-S17NAU-S43
NAU-Rs51NAU-S17NAU-S43
NAU-Rs56NAU-S26NAU-S43
NAU-Rs57NAU-S14NAU-S43
NAU-Rs59NAU-S17NAU-S52
NAU-Rs61NAU-S17NAU-S52
NAU-Rs63NAU-S26NAU-S39
NAU-Rs64NAU-S17NAU-S39
NAU-Rs66NAU-S26NAU-S38
NAU-Rs67NAU-S25NAU-S52
NAU-Rs73NAU-S26NAU-S38
NAU-Rs74NAU-S26NAU-S52
NAU-Rs76NAU-S17NAU-S52
NAU-Rs77NAU-S55NAU-S39
NAU-Rs78NAU-S26NAU-S39
NAU-Rs79NAU-S17NAU-S52

2.3. PCR-RFLP Analysis of SRK Alleles

Compared with the sequence alignment analysis, the utilization of PCR-RFLP technology to identify the S haplotype of radish materials does not require sequencing and has the advantages of a faster and higher identification efficiency and lower cost. To identify and classify the S haplotypes from genotypes with SI phenotypes, the PCR reaction was performed with the Class I SRK specific primer, and then digestion of the PCR products with Hinf I restriction endonucleases and subsequent polyacrylamide gel electrophoresis revealed polymorphism of the amplified DNA fragments. There were 19 types of electrophoretic profiles found in 48 genotypes (Figure 2). The size of the electronic restriction fragments of the PCR product is attached in Table S3. The PCR-RFLP result was the same as the nucleotide sequence analysis. All the different S genotypes showed different electrophoretic profiles, while lines with the same S genotype had the same electrophoretic profiles. These results showed that the self-incompatibility and S haplotype of radish homozygous genotypes could be quickly discovered through employing PCR-RFLP markers to analyze SRK gene polymorphisms.
Figure 2

Polyacrylamide gel electrophoresis of PCR products after cleavage with Hinf I. L: 2000-bp ladders.

2.4. Pollen Germination and Tube Growth

The germination and growth of pollen tube would be inhibited on the stigma of those self-incompatible lines belonging to same S haplotypes. Consequently, fertilization does not occur and no seeds are produced. To verify the molecular identification results of the S haplotype, different S haplotype materials were prepared for pollination, and pollen tube germination after hybridization/self-pollination at the flowering stage was analyzed. The strong self-incompatibility radish line ‘NAU-Rs4’ was employed as an example to explore the behavior of pollen tube in the stigma, and the germination of self-pollinated pollen tubes at the bud stage was normal (Figure 3A,E). When the same material was self-pollinated during flowering, it was obvious that pollen grains germinated less at the stigma and failed to produce pollen tubes that extended to the style (Figure 3B,F). This was similar to the result after cross-pollination of the same S haplotype material NAU-Rs4 × NAU-Rs40 (‘NAU-S25’), which induced the callose response (Figure 3C,G). In contrast, different S haplotype materials ‘NAU-Rs4’ × ’NAU-Rs32’ (‘NAU-S25’ × ‘NAU-S14’) were cross-pollinated at the flowering stage, which resulted in a large number of pollen grains germinating, and pollen tube elongation was observed (Figure 3D,H). These results of the fluorescence microscope observation of pollen tube germination verified the accuracy of S haplotypes identification.
Figure 3

The germination of pollen tubes of different pollination combinations. (A). NAU-Rs4 (‘NAU-S25’) Bud pollination⊗ (4×); (B). NAU-Rs4 (‘NAU-S25’) Flower pollination⊗ (4×); (C). NAU-Rs4 × NAU-Rs40 (‘NAU-S25’) (4×); (D). NAU-Rs4 × NAU-Rs32 (‘NAU-S25’ × ‘NAU-S14’) (4×); (E). NAU-Rs4 (‘NAU-S25’) Bud pollination⊗ (10×); (F). NAU-Rs4 (‘NAU-S25’) Flower pollination⊗ (10×); (G). NAU-Rs4 × NAU-Rs40 (‘NAU-S25’) (10×); (H). NAU-Rs4 × NAU-Rs32 (‘NAU-S25’ × ‘NAU-S14’) (10×).

2.5. Compatibility Index Analysis

To verify the molecular identification results of the S haplotype, different cross combinations were conducted, and the compatibility was analyzed after pollination. Cross combinations included the same S haplotype material: NAU-Rs5 × NAU-Rs38 (‘NAU-S17’), NAU-Rs44 × NAU-Rs24 (‘NAU-S44’), NAU-Rs7 × NAU-Rs9 (‘NAU-S16’), NAU-Rs7 × NAU-Rs16 (‘NAU-S16’), NAU-Rs4 × NAU-Rs40 (‘NAU-S25’, orthogonal), NAU-Rs40 × NAU-Rs4 (‘NAU-S25’, reverse cross); and different S haplotype material: NAU-Rs1 × NAU-Rs40, NAU-Rs44 × NAU-Rs30, NAU-Rs34 × NAU-Rs40, NAU-Rs7 × NAU-Rs18, and NAU-Rs7 × NAU-Rs1. At the same time, four materials of NAU-Rs1 (‘NAU-S51’), NAU-Rs45 (‘NAU-S05’), NAU-Rs33 (‘NAU-S15’), and NAU-Rs30 (‘NAU-S51’) were used as controls during the flowering stage. The seed production of the F1 generation depends on whether the parents have the same S haplotype. After 40–50 days of pollination, the hybridization of the same S haplotype was almost sterile. The compatibility index was less than 1, and the reciprocal cross results were consistent, which was similar to the self-pollinating result of SI material in the flowering period. In contrast, the compatibility indexes of different S haplotypes materials are all larger than two, showing compatibility (Table 6, Figure 4). The results of self- and cross-pollination tests were consistent with the prediction of S haplotypes by PCR analysis.
Table 6

Compatibility index and podding rate of different pollination combinations.

Pollination CombinationsCompatibility IndexPodding Rate (%)CompatibilityS Haplotype
NAU-Rs5 × NAU-Rs380.8827.57Weak IncompatibilityNAU-S17
NAU-Rs44 × NAU-Rs240.5224.09Weak IncompatibilityNAU-S44
NAU-Rs7 × NAU-Rs90.2012.07IncompatibilityNAU-S16
NAU-Rs7 × NAU-Rs160.1712.09IncompatibilityNAU-S16
NAU-Rs4 × NAU-Rs400.4719.75IncompatibilityNAU-S25
NAU-Rs40 × NAU-Rs40.3721.79IncompatibilityNAU-S25
NAU-Rs1 × NAU-Rs403.7678.93CompatibilityNAU-S51, NAU-S25
NAU-Rs44 × NAU-Rs303.0874.64CompatibilityNAU-S44, NAU-S05
NAU-Rs34 × NAU-Rs402.8367.90CompatibilityNAU-S15, NAU-S25
NAU-Rs7 × NAU-Rs181.8572.98Weak IncompatibilityNAU-S16, NAU-S15
NAU-Rs7 × NAU-Rs12.0571.75CompatibilityNAU-S16, NAU-S51
NAU-Rs1⊗0.0912.40Self-incompatibilityNAU-S51
NAU-Rs30⊗0.4620.69Self-incompatibilityNAU-S05
NAU-Rs33⊗0.1713.22Self-incompatibilityNAU-S15
NAU-Rs45⊗0.1114.59Self-incompatibilityNAU-S51
Figure 4

The pod setting and seed setting of different pollination combinations. (A). (a). NAU-Rs1 × NAU-Rs40 (‘NAU-S51’ × ‘NAU-S25’); (b). NAU-Rs34 × NAU-Rs40 (‘NAU-S15’ × ‘NAU-S25’); (c). NAU-Rs7 × NAU-Rs18 (‘NAU-S16’ × ‘NAU-S15’); (d). NAU-Rs44 × NAU-Rs30 (‘NAU-S44’ × ‘NAU-S05’); (e). NAU-Rs7 × NAU-Rs1 (‘NAU-S16’ × ‘NAU-S51’); (f). NAU-Rs5 × NAU-Rs38 (‘NAU-S17’); (g). NAU-Rs40 × NAU-Rs4 (‘NAU-S25’); (h). NAU-Rs7 × NAU-Rs9 (‘NAU-S16’); (i). NAU-Rs7 × NAU-Rs16 (‘NAU-S16’); (j). NAU-Rs44 × NAU-Rs24 (‘NAU-S44’); (k). NAU-Rs4 × NAU-Rs40 (‘NAU-S25’); (l). NAU-Rs1⊗ (‘NAU-S51’); (m). NAU-Rs30⊗ (‘NAU-S05’); (n). NAU-Rs3⊗ (‘NAU-S15’); (o). NAU-Rs45⊗ (‘NAU-S51’). (B). (a,b). NAU-Rs7 × NAU-Rs18 (‘NAU-S16’ × ‘NAU-S15’); (c,d). NAU-Rs7 × NAU-Rs1 (‘NAU-S16’ × ‘NAU-S51’); (e,f). NAU-Rs4 × NAU-Rs40 (‘NAU-S25’); (g,h). NAU-Rs7 × NAU-Rs16 (‘NAU-S16’).

3. Discussion

As a self-incompatibility (SI) plant, radish exhibits high heterosis in hybrid seed production. However, F1 seeds cannot be produced at the anthesis stage because the parents share the same S haplotype [6]. To ensure rational hybridization and guarantee the purity and yield of the hybrid, it is necessary to rapidly and accurately identify the S haplotype of the radish hybrid parent. The unified naming of S haplotypes and the establishment of standard test lines are necessary for rapid and accurate identification of radish haplotypes. Haseyama [30] determined the reported SRK, SLG, and SCR/SP11 gene sequences and found that there were 35 S haplotypes in radish, of which there were 26 ones in South Korea radish and 24 ones in Japanese radish. A BLAST analysis revealed that 15 S haplotypes are widespread in Japanese and South Korean radish. However, the results failed to cover all current radish haplotype information. Therefore, in this study, all published S gene nucleotide sequences were collected for BLAST alignment. On the basis research of Haseyama [30], the S haplotype reported by Kim [28], Wang [6] and other teams was added. It was concluded that a total of 52 S haplotypes were reported in radish and they were uniformly named ‘NAU-S1’-‘NAU-S52’ (Table 1). Exchanges of plant materials between researchers and breeders and the establishment of a unified nomenclature of S haplotypes are necessary to avoid confusion regarding the identity of S haplotypes in radish. The S haplotype is an important agronomic trait of cruciferous crops that varies greatly among different species. Thus far, more than 50 S haplotypes have been found in B. oleracea crops [5], which is comparable to the number of radish S haplotypes determined in the present study. And more than 100 S haplotypes have been identified in Brassica [32,33,34]. There are many SRK and SP11/SCR alleles having highly similar sequences between B. oleracea and B. rapa. Similar interspecific pairs of S haplotypes also exist in radish. Due to the large number of S haplotypes, traditional pollination methods are complicated to distinguish S haplotypes [27]. Establishing an efficient and simple S haplotype identification system is important for the breeding work. To establish a reliable S haplotyping system in radish, we designed specific primers to analyze the SRK kinase domain sequence. The PCR results indicated that 79 radish genotypes could be divided into 48 Class I, 13 Class II, and 17 Class I/II S genotypes. Sequence alignment confirmed that the Class I materials contained 19 S haplotypes. Among them, the S sequences of the three materials were not registered in NCBI, and hence, there were new members identified for the first time in radish, named ‘NAU-S53’, ‘NAU-S54’, and ‘NAU-S55’. In general, Class I S haplotypes predominate over Class II S haplotypes. In the study, the S haplotypes of Class II materials were only concentrated in four types, such as ‘NAU-S38’ and the types and numbers are significantly less than those of Class I S haplotypes. It is convincing that strong self-incompatibility lines are more common. In previous reports, this phenomenon was also found in B. campestris [35] and B. pekinensis Rupr [36,37,38]. Directional selection, either natural or through breeding, increases the frequency of favorable S alleles resulting in the differences of S haplotype frequencies. The publication of S locus gene sequence details has enabled the identification of S haplotypes based on gene sequences and BLAST analyses. However, in breeding practice, when conducting large-scale screening of parents to prepare hybrid combinations, all parent materials need to be sequenced. This entails low throughput and high cost, which are unsuitable for batch identification of S haplotypes. In contrast, PCR-RFLP markers have the characteristics of high polymorphism, good reproducibility and codominance, which are easily used to develop efficient, simple and practical molecular markers [39], and successfully detect S haplotypes in crops such as B. campestris and Chinese cabbage, as well as fruit plants such as apple and pear [14,40,41,42]. The S haplotype of 48 Class I materials was identified using the PCR-RFLP technique here, and their PCR products showed a polymorphism depending on their genotypes. Therefore, the PCR-RFLP analysis of S-locus allele is adequate for the S haplotypes identification. The PCR-RFLP method has proven useful for the identification of S alleles in genotypes and listing S haplotypes in radish [16]. Of course, the limitation of this method is that some S haplotypes have a significant degree of sequence similarity or the same restriction site, making the PCR-RFLP approach ineffective. Furthermore, it is difficult to identify individual haplotypes for heterozygotes or new S haplotypes [36,37]. Thus, for materials with complex bands are difficult to distinguish accurately. PCR-RFLP analysis, combined with the cloning analysis of the S locus gene, permits rapid and efficient identification of the radish S haplotype. In addition, the compatibility relationships in pollen between same S haplotypes of radish by pollination tests and aniline blue tests were analyzed. The results of molecular identification of the S haplotype were highly consistent with the field pollination and pollen tube germination. It will become an essential tool based on the combination of radish SRK gene sequence analysis and the PCR-RFLP in radish breeding, which would provide an important theoretical basis for efficient utilization of self-incompatibility in heterosis breeding.

4. Materials and Methods

4.1. Plant Materials

The 79 cultivated radish genotypes were provided by the Radish Genetics and Breeding Laboratory, School of Horticulture, Nanjing Agricultural University (Table 7). Pollination experiments were conducted in 2019–2021 at Jiangpu Horticultural Experimental Station and Baima Experimental Base of Nanjing Agricultural University.
Table 7

Materials of radish used in this study.

Material CodeColor of Root SkinColor of Fleshy RootFleshy Root ShapeLeaf MorphologySource
NAU-Rs1GreenGreenCylindricalEntireHenan China
NAU-Rs2RedWhiteSphericalEntireJiangsu China
NAU-Rs3GreenGreenCylindricalEntireHenan China
NAU-Rs4GreenGreenCylindricalLyrateJiangsu China
NAU-Rs5RedWhiteSphericalEntireSichuan China
NAU-Rs6WhiteWhiteLong and Tapered EntireJiangsu China
NAU-Rs7WhiteWhiteLong and Tapered EntireBeijing China
NAU-Rs8WhiteWhiteLong and Tapered EntireJiangsu China
NAU-Rs9WhiteWhiteLong and Tapered LyrateJiangsu China
NAU-Rs10RedWhiteCylindricalEntireSichuan China
NAU-Rs11WhiteWhiteCylindricalLyrateSouth Korea
NAU-Rs12RedWhiteApically BulbousLyrateAmerica
NAU-Rs13WhiteWhiteCylindricalLyrateJiangsu China
NAU-Rs14RedWhiteEllipticLyrateJiangsu China
NAU-Rs15RedWhiteEllipticLyrateJiangsu China
NAU-Rs16WhiteWhiteLong and Tapered LyrateSouth Korea
NAU-Rs17WhiteWhiteLong and Tapered LyrateSouth Korea
NAU-Rs18WhiteWhiteLong and Tapered LyrateGuangdong China
NAU-Rs19PurpleWhiteApically BulbousLyrateWuhan China
NAU-Rs20WhiteWhiteLong and Tapered LyrateJiangsu China
NAU-Rs21RedWhiteLong and Tapered EntireJiangsu China
NAU-Rs22WhiteWhiteLong and Tapered LyrateSouth Korea
NAU-Rs23GreenWhiteApically BulbousLyrateHenan China
NAU-Rs24RedWhiteEllipticEntireJiangsu China
NAU-Rs25WhiteWhiteLong and Tapered EntireSouth Korea
NAU-Rs26WhiteWhiteLong and Tapered SinuateWuhan China
NAU-Rs27PurpleWhiteApically BulbousLyrateXizang China
NAU-Rs28WhiteWhiteSphericalLyrateJiangsu China
NAU-Rs29RedWhiteEllipticEntireJiangsu China
NAU-Rs30WhiteWhiteLong and Tapered LyrateAnhui China
NAU-Rs31WhiteWhiteApically BulbousLyrateJiangsu China
NAU-Rs32RedWhiteEllipticEntireJiangsu China
NAU-Rs33GreenRedSphericalEntireJiangsu China
NAU-Rs34WhiteWhiteCylindricalLyrateSouth Korea
NAU-Rs35WhiteWhiteLong and Tapered LyrateJiangsu China
NAU-Rs36YellowWhiteSphericalLyrateJiangsu China
NAU-Rs37RedWhiteCylindricalEntireSichuan China
NAU-Rs38WhiteWhiteApically BulbousEntireJiangsu China
NAU-Rs39RedWhiteCylindricalEntireShandong China
NAU-Rs40GreenGreenLong and Tapered LyrateShandong China
NAU-Rs41GreenGreenCylindricalLyrateJiangsu China
NAU-Rs42WhiteWhiteCylindricalLyrateJiangsu China
NAU-Rs43GreenGreenApically BulbousLyrateHenan China
NAU-Rs44RedWhiteApically BulbousEntireJiangsu China
NAU-Rs45WhiteWhiteEllipticLyrateJiangsu China
NAU-Rs46WhiteWhiteSphericalLyrateJiangsu China
NAU-Rs47RedWhiteLong and Tapered EntireSichuan China
NAU-Rs48RedWhiteCylindricalSinuateJiangsu China
NAU-Rs49WhiteWhiteLong and TaperedEntireYunnan China
NAU-Rs50RedWhiteCylindricalSinuateJiangsu China
NAU-Rs51GreenGreenCylindricalEntireShandong China
NAU-Rs52GreenRedCylindricalEntireBeijing China
NAU-Rs53WhiteWhiteLong and TaperedLyrateJapan
NAU-Rs54RedWhiteCylindricalSinuateSichuan China
NAU-Rs55WhiteWhiteCylindricalSinuateJiangsu China
NAU-Rs56RedWhiteCylindricalSinuateJiangsu China
NAU-Rs57WhiteWhiteCylindricalSinuateSouth Korea
NAU-Rs58WhiteWhiteLong and Tapered SinuateJiangsu China
NAU-Rs59WhiteWhiteCylindricalEntireJapan
NAU-Rs60WhiteWhiteCylindricalEntireSouth Korea
NAU-Rs61WhiteWhiteCylindricalEntireJiangsu China
NAU-Rs62WhiteWhiteLong and Tapered EntireSouth Korea
NAU-Rs63WhiteWhiteCylindricalEntireJiangsu China
NAU-Rs64WhiteWhiteCylindricalEntireJiangsu China
NAU-Rs65WhiteWhiteLong and Tapered EntireSouth Korea
NAU-Rs66RedWhiteCylindricalEntireJiangsu China
NAU-Rs67WhiteWhiteLong and Tapered EntireJiangsu China
NAU-Rs68WhiteWhiteLong and Tapered EntireJiangsu China
NAU-Rs69RedWhiteCylindricalEntireJiangsu China
NAU-Rs70GreenGreenCylindricalEntireTianjin China
NAU-Rs71GreenWhiteCylindricalEntireHenan China
NAU-Rs72GreenWhiteCylindricalEntireShandong China
NAU-Rs73WhiteWhiteLong and Tapered EntireJiangsu China
NAU-Rs74RedWhiteCylindricalEntireJiangsu China
NAU-Rs75WhiteWhiteLong and Tapered EntireShandong China
NAU-Rs76RedWhiteLong and Tapered EntireJiangsu China
NAU-Rs77WhiteWhiteLong and TaperedLyrateJiangsu China
NAU-Rs78WhiteWhiteLong and Tapered EntireBeijing China
NAU-Rs79WhiteWhiteLong and Tapered EntireJiangsu China

4.2. Amplification and Sequencing of the PCR Products

4.2.1. Extraction of Genomic DNA and Amplification of the SRK Gene

Total genomic DNA was extracted from the seedling leaves of each genotype using the modified CTAB (Cetyltrimethylammonium Bromide) method. Degenerate primers were designed based on the nucleotide sequence (exons 4–7) of the radish SRK gene (kinase domain) published by Lim [16], Okamoto [23] et al. The sequences encoding the kinase domains of Class I and Class II S haplotype SRK were amplified with KD (I)-F/R and KD4/KD7. The primer sequences were shown in Table 8.
Table 8

Specific primers of SRK gene.

Primer NameClassGene RegionsPrimer Sequence (5′ to 3′) Tm/°C
KD (I)-FClass ISRK(exons 4–7) GAACTTCCATTGATAGAGTTRG58.5
KD (I)-RTTRGGCTKAGGAATCKCT
KD4 [42]Class IIGAGGGCGAGAAAGATCTTAATT59.5
KD7 [42] AAGACGATCATATTACCGAGC
PCR amplification was performed in a 20 μL reaction mixture containing 0.1 μg template, 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), and 10 μL polymerase mix (2 × Taq Master Mix, Vazyme Biotech Co., Ltd., Nanjing, China). PCR amplification consisted of an initial denaturation step at 94 °C for 5 min, 35 cycles of 95 °C for 30 s, 59 °C for 30 s, and 72 °C for 1 min 40 s, and a final 10 min extension at 72 °C.

4.2.2. Determination of Nucleotide Sequences

The PCR products were visualized on 1.2% agarose gel. The FastPure Plant DNA Isolation Mini Kit® (Vazyme Biotech Co., Ltd., Nanjing, China) was used for product purification. Then, it was ligated with the cloning vector pMD19-T and transformed into E. coli (Escherichia coli) competent DH5α. Sequencing reactions were performed by Spokane Biotech Co., Ltd. (Nanjing, China). The obtained nucleotide sequences of the SRK gene of the respective cross lines were compared in the NCBI (National Center for Biotechnology Information) database to determine the corresponding haplotype.

4.3. PCR-RFLP Analysis

DNA fragments corresponding to the SRK kinase domain were amplified by PCR with a Class I specific primer pair, KD (I)-F and KD (I)-R. The reaction conditions and system were identical to those described in Section 4.2. The PCR products were subjected to restriction digestion using Hinf I restriction enzyme at 37 °C for 1 h, and 65 °C for 20 min. The digested product was electrophoresed on a 6% non-denaturing polyacrylamide gel at a constant voltage 120 V for 2 h, and DNA bands were detected by silver staining.

4.4. Pollination Tests

The traditional compatibility index method was used to verify the molecular identification results of the S haplotype. Based on the results of the SRK gene sequence comparison, artificial cross-pollination was carried out within the same haplotype and among different haplotypes at the flowering stage to determine whether the materials belonged to the same S haplotype according to the compatibility index and pod setting rate among different hybrid combinations. Pod setting rate = number of pods/number of pollinated flowers × 100%. Compatibility index = number of seeds/number of pollinated flowers. In the field pollination statistics of radish, the compatibility index less than 0.5 indicates strong self-incompatibility, a value greater than 2.0 indicates compatibility, and compatibility index from 0.5 to 2.0 indicates weak self-incompatibility [7].

4.5. Aniline Blue Assays

Aniline blue assays were performed as previously described. Based on the molecular identification results of the S haplotype, the pistils after hybridization with the same or different S haplotypes were fixed in FAA (Formalin-Aceto-Alcohol) fixative (50% Ethanol:Glacial Acetic Acid:Ormaldehyde = V18:V1:V1) at least 4 h and then transferred to 10 M NaOH at 42 °C for 0.5 h. The pistils were washed with distilled water and stained with 0.1% basic aniline blue (1% K3PO3, PH = 11) [43,44]. The stained samples were mounted in 70% glycerol and the growth of pollen tubes in the styles was observed under a BX53® Olympus fluorescence microscope (Olympus, Tokyo, Japan).
  14 in total

1.  Evolution of the Brassica self-incompatibility locus: a look into S-locus gene polymorphisms.

Authors:  J B Nasrallah
Journal:  Proc Natl Acad Sci U S A       Date:  1997-09-02       Impact factor: 11.205

2.  Pollen[mdash]Stigma Signaling in the Sporophytic Self-Incompatibility Response.

Authors:  J. B. Nasrallah; M. E. Nasrallah
Journal:  Plant Cell       Date:  1993-10       Impact factor: 11.277

3.  Reactive oxygen species mediate pollen tube rupture to release sperm for fertilization in Arabidopsis.

Authors:  Qiaohong Duan; Daniel Kita; Eric A Johnson; Mini Aggarwal; Laura Gates; Hen-Ming Wu; Alice Y Cheung
Journal:  Nat Commun       Date:  2014       Impact factor: 14.919

4.  Genomic organization of the S core region and the S flanking regions of a class-II S haplotype in Brassica rapa.

Authors:  E Fukai; R Fujimoto; T Nishio
Journal:  Mol Genet Genomics       Date:  2003-04-09       Impact factor: 3.291

5.  Structural and transcriptional comparative analysis of the S locus regions in two self-incompatible Brassica napus lines.

Authors:  Y Cui; N Brugière; L Jackman; Y M Bi; S J Rothstein
Journal:  Plant Cell       Date:  1999-11       Impact factor: 11.277

6.  Dissecting Pistil Responses to Incompatible and Compatible Pollen in Self-Incompatibility Brassica oleracea Using Comparative Proteomics.

Authors:  Jing Zeng; Qiguo Gao; Songmei Shi; Xiaoping Lian; Richard Converse; Hecui Zhang; Xiaohong Yang; Xuesong Ren; Song Chen; Liquan Zhu
Journal:  Protein J       Date:  2017-04       Impact factor: 2.371

7.  Polymorphism of the S-locus glycoprotein gene (SLG) and the S-locus related gene (SLR1) in Raphanus sativus L. and self-incompatible ornamental plants in the Brassicaceae.

Authors:  K Sakamoto; M Kusaba; T Nishio
Journal:  Mol Gen Genet       Date:  1998-05

8.  Ethylene negatively mediates self-incompatibility response in Brassica rapa.

Authors:  Shiqi Su; Huamin Dai; Xiaoyun Wang; Chao Wang; Weiqing Zeng; Jiabao Huang; Qiaohong Duan
Journal:  Biochem Biophys Res Commun       Date:  2020-02-27       Impact factor: 3.575

9.  Registration of S alleles in Brassica campestris L by the restriction fragment sizes of SLGs.

Authors:  T Nishio; M Kusaba; M Watanabe; K Hinata
Journal:  Theor Appl Genet       Date:  1996-03       Impact factor: 5.699

10.  Genetic characterization of inbred lines of Chinese cabbage by DNA markers; towards the application of DNA markers to breeding of F1 hybrid cultivars.

Authors:  Kazutaka Kawamura; Takahiro Kawanabe; Motoki Shimizu; Keiichi Okazaki; Makoto Kaji; Elizabeth S Dennis; Kenji Osabe; Ryo Fujimoto
Journal:  Data Brief       Date:  2015-12-11
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.