Literature DB >> 36072901

Kartogenin Induced Adipose-Derived Stem Cell Exosomes Enhance the Chondrogenic Differentiation Ability of Adipose-Derived Stem Cells.

Aiguo Xie1, Jixin Xue2, Yuting Wang3, Chao Yang4, Miao Xu4, Yongkang Jiang1.   

Abstract

Objective: The objective of this study is to explore the effect of kartogenin (KGN-)-pretreated adipose-derived stem cell-derived exosomes (ADSC-EXOs) on the chondrogenic differentiation ability of ADSCs.
Methods: Adipose-derived stem cells (ADSCs) were treated with different doses of KGN, and exosomes (EXOs) were extracted. EXOs were then identified using an electron microscope (EM), nanoparticle tracking analyzer, nanoparticle tracking analysis software, and exosomal protein markers. EXOs were labeled with the fluorescent dye PKH67 and their uptake by cells was evaluated. A cell counting kit-8 (CCK-8) assay, flow cytometry, clonogenic assay, and a cell scratch assay were used to detect the abilities of proliferation, apoptosis, clone formation, and migration of ADSCs, respectively. Subsequently, Alcian blue staining and toluidine blue staining were used to detect the chondrogenic differentiation ability of ADSCs in each group. Quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot (WB) techniques were used to detect the expression of chondrogenic differentiation-related genes.
Results: In this study, ADSCs and KGN-induced ADSC-EXOs were successfully extracted and isolated. EXOs and ADSCs coculturing results showed that KGN-induced ADSC-EXOs can significantly promote proliferation, clone formation, migration, and chondrogenic differentiation of ADSCs and inhibit apoptosis. In addition, KGN-induced ADSC-EXOs can increase the expression of chondrogenic-related genes in ADSCs (Aggrecan, Collagen III, Collagen II, and SOX9), and can significantly decrease the expression of chondrolysis-related genes (MMP-3, ADAMTS4, and ADAMTS5).
Conclusion: KGN-induced ADSC-EXOs can enhance the chondrogenic differentiation ability of ADSCs by promoting cell proliferation and migration while inhibiting cell apoptosis. KGN treatment can also increase the expression of chondrogenic differentiation-related genes and decrease the expression of chondrolysis-related genes. These results provide a new approach to cartilage repair and regeneration.
Copyright © 2022 Aiguo Xie et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 36072901      PMCID: PMC9444430          DOI: 10.1155/2022/6943630

Source DB:  PubMed          Journal:  Dis Markers        ISSN: 0278-0240            Impact factor:   3.464


1. Introduction

Osteoarthritis (OA) is a common chronic degenerative disease, occurring predominantly in middle-aged and elderly people. It frequently leads to pain, limited mobility, and even disability, leading to a significant burden on the patients and society [1, 2]. Presently, there are few effective treatments for OA; although analgesic therapy can relieve the symptoms, the cartilage, the area degraded by OA, cannot be maintained or regenerated. Once the condition worsens, total joint arthroplasty can only be performed through prosthetic joints. However, these joints are associated with challenges such as poor efficacy, limited prosthesis life, and high cost [3-5]. Given the extracellular matrix loss and arthroidal cartilage damage caused by OA [6] and the limited treatments available, it is crucial to promote arthroidal cartilage repair and regeneration for preventing OA progression. Regenerative medicine is an emerging discipline that encompasses methods to promote tissue regeneration and functional reconstruction after trauma. This approach is focused on repairing, regenerating, and improving damaged tissue through stem cell therapy, and tissue engineering, thereby improving organ function [7]. Owing to their extremely high self-renewal ability and multilineage differentiation potential, mesenchymal stem cells (MSCs) have become the focus in the field of bone regeneration and bone repair. In addition, MSCs sources demonstrate a wide diversity [8]. Adipose-derived stem cells (ADSCs) are a type of MSC with self-renewal ability and multilineage differentiation potential, which are isolated from adipose tissue. ADSCs possess various advantages, such as easy access, sufficient sources, low immune rejection, high cell viability, and low ethical controversy. In recent years, they have received increasing attention in tissue and organ damage repair and regenerative medicine [9-11]. Studies have confirmed that ADSCs can differentiate into adipocytes, osteoblasts, and chondrocytes [12]. ADSCs play a key role in repairing bone defects through two main mechanisms. First, they directly differentiate into target cells to aid in osteogenic repair and replacement [13]. Second, they stimulate the adjacent immature cell receptors to produce activity through the paracrine mechanism of mature cells [14, 15]. Exosomes (EXOs) play a key role in this paracrine mechanism [16, 17]. EXOs are double-layered vesicles secreted by living cells, with a diameter ranging from 40 to 160 nm. They are formed in the endosomal compartment. Upon fusion with the plasma membrane, they are released into the extracellular environment to participate in intercellular information exchange [18, 19]. EXOs can regulate the repair and regeneration process in damaged sites by influencing biological functions, such as cell proliferation, migration, and differentiation [20]. Studies have shown that adipose-derived stem cell-derived exosomes (ADSC-EXOs) can promote the osteogenic, proliferative, migratory, and angiogenic abilities of MSCs in human bone marrow [21, 22]. ADSC-EXOs can be taken up by fibroblasts as well as promote cell migration and proliferation. Moreover, by promoting the merger of type I and type III collagen, ADSC-EXOs increased the gene expression of proliferating cell nuclear antigen and cyclin D1. The expression of metalloproteinase-related genes was also inhibited, thereby accelerating skin wound healing in mice [23]. Furthermore, Lu et al. confirmed that ADSC-EXOs can promote the proliferation and differentiation of human primitive osteoblasts, alleviate acute inflammatory response during bone injury, and promote bone repair [24]. ADSCs need appropriate external stimuli to differentiate into osteocytes [25]. Kartogenin (KGN) is a small molecule, selected from more than 22,000 heterocyclic drug-like molecules with different structures, which can promote the chondrogenic differentiation of human MSCs [26]. Studies have shown that KGN can promote cartilage regeneration and protection, formation of cartilage-like transitional zones at tendon-bone junctions, and synthesis of aggrecan and collagen required for cartilage repair and healing [27]. Some studies have also shown that KGN-pretreated MSCs-EXOs play an important role in cartilage differentiation. For example, Shao et al. found that EXOs from KGN-pretreated infrapatellar fat pad (IPFP) MSCs can enhance chondrocyte anabolism and articular cartilage regeneration [28]. Liu et al. also found that KGN can increase the cartilage repair effect of MSCs-EXOs in bone marrow [29]. However, the effect of KGN-pretreated ADSC-EXOs on the ADSCs cartilage formation potential remains unclear. Therefore, in this study, KGN-induced ADSCs were used to produce EXOs, and the EXOs produced were isolated and extracted. After coculturing the collected EXOs with ADSCs, the effect of KGN-induced ADSC-EXOs on the proliferation and chondrogenic differentiation of ADSCs was assessed and determined. These findings lay a new experimental foundation for the application of ADSCs in chondrogenic differentiation.

2. Materials and Methods

2.1. Cell and Grouping

Liposuction was used to obtain human subcutaneous adipose tissue. All the experimental protocols involving human tissues were approved by the Ethics Committee of Naval Medical Center of PLA (AF-HEC-037). Informed consent was obtained from patients giving adipose tissue samples. Following the method published by Kurdi et al., ADSCs were isolated from adipose tissue [30] and cultured in Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, USA), containing 10% fetal bovine serum (Gibco, USA), 1% penicillin-streptomycin, and 20 mM L-glutamine (Euroclone, Italy). Then, the medium was put into an incubator in an atmosphere of 5% CO2 and 37°C for growth. KGN (MCE, USA) was used to induce cartilage formation and EXO secretion by ADSCs. ADSCs were treated with 100 nM, 500 nM, 1 μM, 5 μM, or 10 μM KGN, and the treatment groups were named accordingly. Then, ADSCs and EXOs from the 5 μM group were extracted. The extracted ADSCs were divided into three groups, namely, the control group, Exo group, and Exo/KGN group, according to the treatment received. The control group received no experimental treatment. In the Exo group, ADSCs were cocultured with EXOs extracted from ADSCs. In the Exo/KGN group, ADSCs were cocultured with EXOs extracted from ADSCs from the 5 μM group.

2.2. Real-Time Quantitative Polymerase Chain Reaction (qRT-PCR)

Trizol (Sigma, USA) was used to extract total cell RNA, and a Nanodrop was used to determine the concentration of RNA. The extracted RNA was then stored at −80°C. Afterward, cDNA was reverse transcribed following the instructions of the reverse transcription PCR kit (Takara, Japan). The primer sequences used are shown in Table 1. The 2− method was used for data analysis [28].
Table 1

qRT-PCR primer sequences.

Gene namePrimer sequences(5′ to 3′)
AggrecanF TCGAGGACAGCGAGGCC
R TCGAGGGTGTAGCGTGTAGAGA
Collagen IIIF TCTTGGTCAGTCCTATGCGGATA
R CATCGCAGAGAACGGATCCT
Collagen IIF ATA AGG ATG TGT GGA AGC CG
R TTT CTG TCC CTT TGG TCC TG
SOX9F GACTTCCGCGACGTGGAC
R GTTGGGCGGCAGGTACTG
MMP-3F ACGCCAGCCAACTGTGATCCT
R ATATGCGGCATCCACGCCTGAA
ADAMTS4F ACTGGTGGTGGCAGATGACA
R TCACTGTTAGCAGGTAGCGCTTT
ADAMTS5F GGACCTACCACGAAAGCAGATC
R GCCGGGACACACGGAGTAC
GAPDHF GGGAGCCAAAAGGGTCATCATCTC
R GAGGGGCCATCCACAGTCTTC

2.3. Flow Cytometry

To identify surface antigens on ADSCs, the third-passage ADSCs were taken, digested with trypsin, and made into single-cell suspensions. Then, phosphate-buffered saline (PBS) solution was used to wash the cells, and the cell concentration was adjusted to 1 × 106/mL. Specific phycoerythrin-conjugated monoclonal antibodies against CD73 (ab202122), CD90 (ab3105), CD45 (ab10558), and Abcam (USA) were added and incubated at 4°C for 30 minutes in the dark. IgG1-PE (ab91357, Abcam, USA) was used as a negative control to exclude the interference of fluorescein. Finally, the positive rate (%) of the cell surface antigen was detected and analyzed with a FACSCalibur flow cytometer. To detect apoptosis rates of ADSCs, an Annexin V-FITC/propidium iodide (PI) apoptosis detection kit (Solebo, China) was used. After trypsinization, the cells were collected into the corresponding EP tubes and washed with cold PBS buffer. Cells were washed twice and then made into a suspension of 1 × 106cells/mL with 1× binding buffer. Then, 5 μL of Annexin V-FITC was added to the EP tube, and the cells were mixed gently for 10 minutes at room temperature in the dark. Next, 5 μL of propidium iodide (PI) was added, and the samples were incubated for 5 minutes at room temperature in the dark. The apoptosis rate within 1 hour was detected using flow cytometry.

2.4. Determination of Chondrogenic Differentiation Ability

The third-passage ADSCs were taken and subjected to different treatments with KGN and EXO. The treated ADSCs were stained according to the instructions for the standard Alcian blue (pH = 2.5) kit (Solebo, China) and toluidine blue staining (Solebo, China) solutions to evaluate the chondrogenic differentiation of ADSCs [31].

2.5. EXO Isolation and Determination

After cell confluency of treated ADSCs reached 80%, the cells were transferred to a serum-free medium or serum-free medium with 5 M KGN for 72 hours. Then, the supernatant was collected. EXOs were isolated by multiple centrifugations at 4°C as in the method by Shao et al. [28]. After centrifuging at 300g for 10 minutes, the supernatant was collected and recentrifuged at 2000g for 10 minutes for collection. After centrifuging at 10,000g for 30 minutes, the supernatant was collected again and recentrifuged at 100,000g for 70 minutes. The supernatant was then discarded, and PBS was used to resuspend the pellet. After centrifuging again at 100,000g for 70 minutes, the supernatant was discarded. Finally, the pellet was resuspended in 200 μL of PBS and stored at −80°C for subsequent experiments. The morphology of EXOs, which were negatively stained with uranyl acetate, was observed with a transmission electron microscope (TEM). Then, 10 μL of ADSC-EXOs suspension was selected and dropped on a sample-loaded copper grid with a pore size of 2 nm. This was left standing for 3–5 minutes at room temperature. After blotting the suspension with filter paper, 10 μL uranyl acetate solution was added and negatively stained for 5 minutes at room temperature. The negative staining solution was blotted with filter paper. Then, the copper mesh was placed under TEM to observe the morphology of ADSC-EXOs and obtain pictures. The diameter of EXOs was analyzed using a nanoparticle tracking analyzer with nanoparticle tracking analysis (NTA) software, which automatically tracks and determines particle size based on Brownian motion and diffusion coefficients. The EXOs were resuspended in 1 mL of PBS. The diluted EXOs were then injected into a NanoSight LM10 instrument (Nano Sight Ltd., Minton Park, UK) for measurements of particle size. The NTA measurement conditions were 23.75°C ± 0.5°C. The measurement time was 60 seconds. Lastly, filtered PBS was used as a control.

2.6. Uptake of EXO

The EXOs were labeled with PKH67, according to the instructions of the PKH67 Green Fluorescent Cell Linker Midi Kit (Sigma-Aldrich, USA). The labeled EXOs were then cocultured with ADSCs for 24 hours. Following this, the samples were stained with 4′,6-diamidino-2-phenylindole (DAPI), and the uptake of EXOs by ADSCs was observed under a fluorescence microscope.

2.7. CCK-8 Assay

The third-passage ADSCs were collected and evenly plated in 96-well plates at 5000 cells/well. When the cells reached 60% confluence, 100 μL of the corresponding conditioned medium was replaced in each well, according to the experimental group. Samples were then placed in the incubator for continuous culture. OD450 was measured at 0 and 24 hours of culture. The measurement method was as follows: 10 μL of CCK-8 solution (MCE, USA) was added to each well and incubated at 37°C in the dark for 1–4 hours. The absorbance of each well at a wavelength of 450 nm was measured by a microplate reader. Six duplicate wells were set in each group, and the proliferation rate of cells in each group was calculated.

2.8. Cell Clone Formation Experiment

The third-passage ADSCs in the exponential growth phase were made into a cell suspension, and 1000 cells were seeded into a six-well plate. The cells were dispersed evenly by shaking the culture plate. The cells were cultured in a 37°C, 5% CO2 incubator for 2–3 weeks and then fixed with 4% paraformaldehyde and stained with crystal violet solution (Biyuntian, China). Finally, the colony formation was observed, and images were collected.

2.9. Scratch Test

The third-passage ADSCs were seeded in a six-well plate at a density of 2 × 105 cells/well. After the cells were confluent, the serum-free DMEM was replaced and cultured under starvation for 24 hours. A 20-μL pipette tip was used to make cell scratches on a vertical orifice plate, and PBS was used to wash the cells. Afterward, the serum-free medium was replaced according to the experimental group. After culturing for 0 and 12 hours, the cells were observed and photographed under a microscope. The space of the scratch area was determined by Image J software, and the mobility was thereby calculated.

2.10. Western Blot Assay

Cells to be tested were lysed on ice for 30 minutes with radioimmunoprecipitation assay lysis solution (Solebo, China), sonicated in an ice bath, and centrifuged at 10,000 rpm for 30 minutes to collect the protein supernatant. The protein concentration was determined using a BCA protein concentration assay kit (Solebo, China). 30 μg of total protein was separated by sodium dodecyl-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a polyvinylidene fluoride (PVDF) membrane and blocked at room temperature for 2 hours. The primary antibodies (Calnexin (ab133615), HSP70 (ab2787), CD63 (ab134045), Aggrecan (ab3778), Collagen III (ab6310), Collagen II (ab34712), SOX9 (ab185966), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (ab8245), and Abcam, USA) were added and incubated at 4°C overnight. Then, the diluted secondary antibody (Abcam, USA) was added and incubated at room temperature for 1 hour. Afterward, electrochemiluminescence (ECL) supersensitive luminescent solution was added dropwise for exposure, and images were collected. The relative protein expression level was analyzed using ImageJ, with GAPDH as the internal reference protein.

2.11. Statistical Analysis

The data results were expressed as mean ± standard deviation (SD), and SPSS 21.0 software was used for statistical analysis. T-tests were used between two groups, and one-way analysis of variance was used for comparison of multiple groups. P < 0.05 was regarded as statistically significant.

3. Results

3.1. Identification of ADSCs and the Chondrogenic Differentiation of ADSCs Induced by KGN

First, we performed flow cytometry to detect the surface antigen markers of ADSCs. The results showed that the surface antigens of ADSCs were positive for CD73 (97.9%) and CD90 (97.6%), while CD45 (0.39%) was negative (Figure 1(a)). Subsequently, Alcian blue and toluidine blue staining was performed to evaluate the chondrogenic differentiation ability of ADSCs. The staining results showed that different concentrations of KGN promoted the chondrogenic differentiation of ADSCs. Notably, 5 μM KGN had the best effect (Figures 1(b)–1(e)). In addition, the protein expression levels of Aggrecan, Collagen III, Collagen II, and SOX9 in ADSCs induced by different concentrations of KGN were all significantly increased (P < 0.05). The group receiving the 5 μM concentration showed the most significant changes (Figure 1(f)). This suggested that the chondrogenic differentiation of ADSCs can be induced by different concentrations of KGN and that 5 μM KGN has the optimal effect.
Figure 1

Identification of ADSCs and the effect of KGN on the chondrogenic differentiation of ADSCs. (a) Flow cytometry was used to identify the surface antigens CD73, CD90, and CD45 of ADSCs. (b–c) Alcian blue staining was used to evaluate the chondrogenic differentiation ability of ADSCs in each group. (d–e) Toluidine blue staining was used to evaluate the chondrogenic differentiation of ADSCs in each group. (f) Western blot was used to detect the protein expression levels of Aggrecan, Collagen III, Collagen II, and SOX9 in ADSCs of each group, and grayscale analysis was performed. ∗P < 0.05, ∗∗P < 0.01 vs. 100 nM group.

3.2. Extraction and Characterization of EXOs

Subsequently, ADSC-EXOs were isolated and extracted for identification. The results showed that round or oval vesicles with a membrane-like structure were observed in both the Exo group and the Exo/KGN group under TEM (Figure 2(a)). The NTA results showed that the diameters of EXOs in the Exo and Exo/KGN groups ranged from 45 to 165 nm (Figure 2(b)). Through Western blot, two positive protein indicators (HSP70 and CD63) and one negative protein indicator (Calnexin) were detected in EXOs. The results showed that the protein expression levels of HSP70 and CD63 in EXOs of the Exo and Exo/KGN groups were significantly increased (P < 0.01). Meanwhile, the protein expression level of Calnexin was significantly decreased (P < 0.01) (Figure 2(c)). In addition, the immunofluorescence (IF) test results also showed PKH26-labeled EXOs in both the Exo group and Exo/KGN group cells. EXOs were observed in the cytoplasm of ADSCs (Figure 2(d)). This indicated that EXOs were successfully extracted and isolated and that EXOs were taken up by ADSCs in coculture.
Figure 2

Extraction and characterization of EXOs. (a) The morphology of EXOs in the Exo and Exo/KGN groups was observed by TEM. (b) The diameters of EXOs were analyzed with NTA software. (c) The protein expression levels of Calnexin, HSP70, and CD63 in cell lysates and Exos were detected by Western blot. (d) The level of EXO uptake by ADSCs was detected through PKH67 labeling. ADSC nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI). ∗∗P < 0.01 vs. cell lysate group.

3.3. The Effect of KGN-Induced ADSC-EXOs on the Proliferation, Apoptosis, and Migration of ADSCs

The effects of KGN-induced ADSC-EXOs on the proliferation, apoptosis, and migration of ADSCs were explored with a CCK8, colony formation, flow, and scratch assays. Compared with those in the Exo group and the control group, the results showed that the abilities of colony formation, proliferation, and migration were significantly increased in the EXO/KGN group. However, the apoptosis rate was significantly decreased (P < 0.01) (Figure 3). These results indicated that cell proliferation, migration, and colony formation can be promoted, and apoptosis can be inhibited by coculturing KGN-induced ADSC-EXOs with ADSCs.
Figure 3

Effects of KGN-induced ADSC-Exo on the proliferation, apoptosis, and migration of ADSCs. (a) CCK-8 was used to detect the proliferation ability of ADSCs in each group. (b) The colony formation assay was used to detect the clone formation ability of ADSCs in each group. (c) Flow cytometry was used to detect the apoptosis rate of ADSCs in each group. (d) Scratch assays were used to detect the migration ability of ADSCs in each group. ∗∗P < 0.01 vs. control group, ##P < 0.01 vs. Exo group.

3.4. The Effect of KGN-Induced ADSC-EXOs on the Chondrogenic Differentiation of ADSCs

To clarify the effect of KGN-induced ADSC-EXOs on the chondrogenic differentiation of ADSCs, we assessed the degree of differentiation with Alcian blue staining and toluidine blue staining. As shown in Figures 4(a) and 4(b), ADSC-EXOs and KGN-induced ADSC-EXOs can both significantly improve the chondrogenic differentiation ability of ADSCs (P < 0.01). Compared with ADSC-EXOs, KGN-induced ADSC-EXOs can significantly improve the chondrogenic differentiation ability of ADSCs (P < 0.01). Ultimately, this suggests that KGN-induced ADSC-EXOs can significantly promote the chondrogenic differentiation of ADSCs.
Figure 4

The effect of KGN-induced ADSC-EXOs on the chondrogenic differentiation of ADSCs. Alcian blue staining (a) and toluidine blue staining (b) were used to evaluate the chondrogenic differentiation ability of ADSCs in each group. ∗∗P < 0.01 vs. control group, ##P < 0.01 vs. Exo group.

3.5. Effect of KGN-Induced ADSC-EXOs on ADSC Chondrogenesis-Related Genes

The expression of chondrogenesis-related genes (Aggrecan, Col III, Col II, and SOX9) was analyzed. The results showed that the mRNA and protein expression levels of Aggrecan, Collagen III, Collagen II, and SOX9 in the Exo/KGN group were significantly increased compared with those in the Exo group or the Control group (P < 0.01) (Figures 5(a)–5(e)). This suggests that KGN-induced ADSC-EXOs could significantly increase the expression levels of ADSC chondrogenesis-related genes.
Figure 5

Effect of KGN-induced ADSC-EXOs on the expression of ADSCs chondrogenesis-related genes. The mRNA expression levels of Aggrecan (a), Col III (b), Col II (c), and SOX9 (d) genes in ADSCs of each group were detected by qRT-PCR. (e) The protein expression levels of Aggrecan, Collagen III, Collagen II, and SOX9 in ADSCs of each group were detected by Western blot and analyzed by grayscale. ∗P < 0.05, ∗∗P < 0.01 vs. control group, ##P < 0.01 vs. Exo group.

3.6. Effect of KGN-Induced ADSC-EXOs on the Expression of ADSCs Chondrolysis-Related Genes

Finally, the effect of KGN-induced ADSC-EXOs on ADSC chondrogenic differentiation was further evaluated by detecting the expression levels of ADSC chondrolysis-related genes (MMP-3, ADAMTS4, and ADAMTS5) in each group. The results showed that the expression levels of MMP-3, ADAMTS4, and ADAMTS5 in the cells of the Exo/KGN group were significantly decreased compared with those in the Exo group or the control group (P < 0.01) (Figure 6). These results indicate that the expression of chondrolysis-related genes can be significantly inhibited by KGN-induced ADSC-EXOs.
Figure 6

The effect of KGN-induced ADSC-EXOs on the expression of ADSCs chondrolysis-related genes. The expression levels of MMP-3 (a), ADAMTS4 (b), and ADAMTS5 (c) genes in ADSCs of each group were detected by qRT-PCR. ∗∗P < 0.01 vs. control group, ##P < 0.01 vs. Exo group.

4. Discussion

Owing to their numerous advantages, including self-renewal ability and multilineage differentiation potential, easy access, sufficient sources, low immune rejection, high cell viability, and low ethical controversy, in recent years, ADSCs have received increasing attention in tissue and organ damage repair and regenerative medicine [9-11]. In this study, surface antigen markers CD73, CD90, and CD45 of the isolated ADSCs were detected by flow cytometry. The results showed that ADSCs were positive for CD73 and CD90 and negative for CD45. This suggested that ADSCs meet the basic criteria of the International Society for Cell & Gene Therapy for human MSCs [32] and can therefore be used for subsequent studies. In further experiments, KGN at concentrations of 100 nM, 500 nM, 1 μM, 5 μM, and 10 μM was used to induce ADSCs. The results showed that 5 μM KGN had the optimal chondrogenic differentiation enhancing the effect on ADSCs. In addition, the protein expression levels of chondrogenesis-related proteins in ADSCs, such as Aggrecan, Collagen III, Collagen II, and SOX9, were increased. This suggested that KGN could induce chondrogenesis in ADSCs. Consistent with previous studies on KGN-induced chondrogenic differentiation of MSCs, Jiao et al. also found that KGN could induce chondrogenic differentiation in rat ADSCs. However, they found that 1 μM KGN had the highest ability to induce chondrogenic differentiation [33]. Multiple reasons could explain this difference in the most effective concentration. Firstly, there are differences in the source species of ADSCs induced by KGN. Secondly, their study used only four concentrations (100 nM, 500 nM, 1 μM, and 10 μM) so the induction effect of 5 μM KGN on rat ADSCs could not be determined. EXOs are double-layered vesicles with a diameter of 40–160 nm [19]. HSP70 and CD63 are positive protein markers of EXOs, while Calnexin is a negative protein marker for EXOs [34, 35]. EXOs can regulate the repair and regeneration process in damaged sites by influencing biological functions, such as cell proliferation, migration, and differentiation [20]. Further, studies have shown that adipose-derived stem cell-derived exosomes (ADSC-EXOs) can promote the osteogenic, proliferative, migratory, and angiogenic abilities of MSCs in human bone marrow [21, 22]. In this study, the extracted KGN-induced ADSC-EXOs were identified, and their cellular uptake was analyzed by TEM, NTA, WB, and PKH67 fluorescent labeling. The results showed that the diameter of the round or oval vesicles under EM ranged from 45 to 165 nm. Furthermore, the EXO marker proteins, such as HSP70 and CD63, were positive, while Calnexin was negative. We also found that PKH67-labeled EXOs can be taken up by ADSCs. These results showed that the isolated KGN-induced ADSC-EXOs conformed to every characteristic of EXOs, and the EXOs could be taken up during the coculture process. Normal human articular cartilage is mainly composed of chondrocytes and ECM, where the main component of ECM is aggrecan. MMPs and proteases composed of ADAMTS are involved in the breakdown of proteoglycans [36, 37]. In addition, aggrecan and collagen II are major ECM proteins in cartilage [38]. Collagen III acts primarily as a regulator of a fibrillar network composed of collagen II and other minor collagens during cartilage tissue healing [39]. In addition, SOX9, as a master transcription factor, is involved in cartilage formation by regulating a series of downstream factors [40]. In our study, through a series of cell biology experiments, we found that KGN-induced ADSC-EXOs can significantly promote the proliferation, clone formation, migration, and chondrogenic differentiation of ADSCs and inhibit cell apoptosis. We also found that the expression levels of genes related to chondrogenesis (Aggrecan, collagen II, collagen III, and SOX9) were significantly increased, while the levels of genes related to chondrolysis (MMP-3, ADAMTS4, and ADAMTS5) were significantly decreased. Although no current study exists on the function of KGN-induced ADSC-EXOs, it is consistent with the study results of KGN-induced MSC-EXOs from other sources to promote cartilage differentiation. For example, Liu et al. found that KGN-induced BMSC-EXOs can significantly promote chondrocyte proliferation, migration, and high expression of chondrogenesis-related genes, while reducing the expression of chondrolysis-related genes in bone marrow MSCs (BMSCs). It was also found that the proliferative capacity of KGN-induced BMSC-EXOs was higher than that of BMSCs with the same concentration [29]. In addition, Shao et al. reported similar results in the study of KGN-induced IPFP-MSC EXOs in chondrocyte anabolism and articular cartilage regeneration [28]. Therefore, we suggest that KGN-induced ADSC-EXOs can enhance the chondrogenic differentiation ability of ADSCs. However, there are limitations to this study. First, the effect of KGN-induced ADSC-EXOs on the chondrogenic differentiation of ADSCs was only explored at the cellular level. No corresponding animal model was established to verify the effect of chondrogenic differentiation. Secondly, the microRNAs or proteins in ADSC-EXOs, which promote chondrogenesis, were not analyzed in this study due to their extremely complex components. In addition, studies showed that ADSC-EXOs can alleviate the toxicity of glutamate to neurons by activating the phosphatidylinositol-3-kinase protein kinase-B (PI3/K-Akt) signaling pathway and offer a protective role in the glutamate nerve injury model [41]. Therefore, KGN-induced ADSC-EXOs can exert the function of promoting chondrogenic differentiation through certain signaling pathways. However, the specific mechanism of such an effect was not explored in our study. Consequently, further research is needed.

5. Conclusion

In summary, KGN-induced ADSC-EXOs were successfully isolated and identified in this study. By coculturing EXOs with ADSCs, it was found that KGN-induced ADSC-EXOs can promote ADSC proliferation, clone formation, and migration, while inhibiting apoptosis. It was also found that KGN-induced ADSC-EXOs can increase the expression of chondrogenic differentiation-related genes and inhibit the expression of chondrolysis-related proteins, thereby enhancing the chondrogenic differentiation ability of ADSCs. However, further in vivo experiments using an animal OA model are required to verify these results.
  39 in total

Review 1.  Concise Review: MSC-Derived Exosomes for Cell-Free Therapy.

Authors:  Donald G Phinney; Mark F Pittenger
Journal:  Stem Cells       Date:  2017-03-10       Impact factor: 6.277

Review 2.  A systematic review of recommendations and guidelines for the management of osteoarthritis: The chronic osteoarthritis management initiative of the U.S. bone and joint initiative.

Authors:  Amanda E Nelson; Kelli D Allen; Yvonne M Golightly; Adam P Goode; Joanne M Jordan
Journal:  Semin Arthritis Rheum       Date:  2013-12-04       Impact factor: 5.532

3.  A stem cell-based approach to cartilage repair.

Authors:  Kristen Johnson; Shoutian Zhu; Matthew S Tremblay; Joshua N Payette; Jianing Wang; Laure C Bouchez; Shelly Meeusen; Alana Althage; Charles Y Cho; Xu Wu; Peter G Schultz
Journal:  Science       Date:  2012-04-05       Impact factor: 47.728

Review 4.  Adipose tissue-derived stem cells and their application in bone and cartilage tissue engineering.

Authors:  Tommaso Rada; Rui L Reis; Manuela E Gomes
Journal:  Tissue Eng Part B Rev       Date:  2009-06       Impact factor: 6.389

Review 5.  Intra-articular treatment options for knee osteoarthritis.

Authors:  Ian A Jones; Ryan Togashi; Melissa L Wilson; Nathanael Heckmann; C Thomas Vangsness
Journal:  Nat Rev Rheumatol       Date:  2019-02       Impact factor: 20.543

6.  Adipose-derived stromal cells protect intervertebral disc cells in compression: implications for stem cell regenerative disc therapy.

Authors:  Zhen Sun; Beier Luo; Zhi-Heng Liu; Dino Samartzis; Zhongyang Liu; Bo Gao; Liangliang Huang; Zhuo-Jing Luo
Journal:  Int J Biol Sci       Date:  2015-01-01       Impact factor: 6.580

7.  Mesenchymal stem cell-derived exosomes protect beta cells against hypoxia-induced apoptosis via miR-21 by alleviating ER stress and inhibiting p38 MAPK phosphorylation.

Authors:  Jin Chen; Junqiu Chen; Yuanhang Cheng; Yunfeng Fu; Hongzhou Zhao; Minying Tang; Hu Zhao; Na Lin; Xiaohua Shi; Yan Lei; Shuiliang Wang; Lianghu Huang; Weizhen Wu; Jianming Tan
Journal:  Stem Cell Res Ther       Date:  2020-03-04       Impact factor: 6.832

8.  Exosomes Derived from Human Urine-Derived Stem Cells Inhibit Intervertebral Disc Degeneration by Ameliorating Endoplasmic Reticulum Stress.

Authors:  HongFei Xiang; WeiLiang Su; XiaoLin Wu; WuJun Chen; WenBin Cong; Shuai Yang; Chang Liu; ChenSheng Qiu; Shang-You Yang; Yan Wang; GuoQing Zhang; Zhu Guo; DongMing Xing; BoHua Chen
Journal:  Oxid Med Cell Longev       Date:  2020-12-07       Impact factor: 6.543

9.  Use of conditioned media (CM) and xeno-free serum substitute on human adipose-derived stem cells (ADSCs) differentiation into urothelial-like cells.

Authors:  Ban Al- Kurdi; Nidaa A Ababneh; Nizar Abuharfeil; Saddam Al Demour; Abdalla S Awidi
Journal:  PeerJ       Date:  2021-03-31       Impact factor: 2.984

Review 10.  Stem Cell-Derived Exosome in Cardiovascular Diseases: Macro Roles of Micro Particles.

Authors:  Ye Yuan; Weijie Du; Jiaqi Liu; Wenya Ma; Lai Zhang; Zhimin Du; Benzhi Cai
Journal:  Front Pharmacol       Date:  2018-05-31       Impact factor: 5.810

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.