| Literature DB >> 36071823 |
D Y Reyes-Bravo1, P Villalobos-Aguilera2, J T Almonte-Zepeda1, M S Mendoza-Trejo1, M Giordano1, A Orozco2, V M Rodríguez1.
Abstract
The herbicide atrazine (ATR; 2-chloro-4-ethylamino-6-isopropylamino-s-triazine) is widely used to destroy grasses and broadleaf weeds in crops and some fruits. Studies in rodents have shown that acute, repeated or chronic exposure to ATR is associated with alterations in the nigrostriatal dopaminergic pathway, whereas its effects on GABAergic and glutamatergic pathways have only recently been reported. Sprague-Dawley male rats were exposed daily to 1 or 10 mg ATR/kg of BW for 13 months to evaluate the ATR effects on GABAergic and glutamatergic systems. At the end of the ATR treatment, the levels of mRNA of several genes involved in the production, vesiculation, reuptake, and receptors of GABA and Glu in the striatum (STR), nucleus accumbens (NAcc), prefrontal cortex (PFC), ventral midbrain (vMID) and hippocampus (HIPP) were evaluated by absolute qPCR. For the GABAergic genes, increased expression of GAD67 and Slc32a1 in STR and/or vMID in rats exposed to 1 and/or 10 mg ATR were detected. With regard to the expression of genes involved in the glutamatergic system, Slc17a6 and Grin1 in HIPP of rats exposed to 1 and/or 10 mg ATR, increased as was Gria1 in STR and PFC in the group exposed to 1 mg ATR. In the same fashion, Slc1a3 expression and MGLUR1 increased in STR of rats exposed to 1 and 10 mg ATR groups. The expression of the glutaminases gls (variants 1 and 2) was greater in STR, NAcc, HIPP, and PFC of rats exposed to 1 and/or 10 mg ATR. These findings show that the GABAergic and, especially glutamatergic systems are targets of ATR exposure.Entities:
Keywords: GABA; albino rat; glutamate; herbicides; mRNA expression; neurodegenenerative diseases
Year: 2022 PMID: 36071823 PMCID: PMC9441881 DOI: 10.3389/ftox.2022.933300
Source DB: PubMed Journal: Front Toxicol ISSN: 2673-3080
FIGURE 1Experimental design.
Primer pairs used in the quantitative PCR reactions.
| Gene name (common name) | Symbol | GeneBank | Primer (5´-3´) | Length (bp) | Primer concentration (nM) | Ta (°C) | Reference |
|---|---|---|---|---|---|---|---|
| Glutaminase transcript variant 1 |
| NM_012569.2 | F: CAGAACAGCCCTGCATGTTGCTGCTG | 100 | 250 | 61 |
|
| R: CCACCTGTCCTTGGGGAAGGGGT | |||||||
| Glutaminase transcript variant 2 |
| NM_001109968.3 | F: GGCATTCCTTTGGACCATTGGAC | 143 | 250 | 61 |
|
| R: CCTCTCCCCCAGACTTTCCATTC | |||||||
| Solute carrier family 17 member 6 (Vesicular glutamate transporter) |
| NM_053427.1 | F: AGGAGCAAGCAAATTCTTTC | 106 | 400 | 61 |
|
| R: AGGAGCAAGCAAATTCTTTC | |||||||
| Glutamate ionotropic receptor NMDA type subunit 1 |
| NM_001270602.1 | F: ATGGCTTCTGCATAGACC | 110 | 600 | 61 |
|
| R: GTTGTTTACCCGCTCCTG | |||||||
| Glutamate ionotropic receptor kainate type subunit 1 |
| NM_001111117.1 | F: TGCTAAATAGTTTCTGGTTTGG | 94 | 400 | 57 |
|
| R: ATTCCTCCAACTATTCTGGTC | |||||||
| Glutamate ionotropic receptor AMPA type subunit 1 |
| M36419.1 | F: GACTCTGGCTCCACTAAAGA | 105 | 200 | 61 |
|
| R: AGTCCTCACAAACACAGAGG | |||||||
| Solute carrier family 1 member 3 (Excitatory amino acid transporter) |
| S59158.1 | F: GGATGACATCACACTCATCA | 108 | 400 | 61 |
|
| R: GACAAGTGTTCAACAATCCC | |||||||
| Metabotropic glutamate receptor |
| M61099.1 | F: AGGAGGTGTGGTTCGATGAG | 77 | 250 | 57 |
|
| R: ATTAGCTTCTGTGTACTGCAGATTC | |||||||
| Glutamic acid decarboxylase |
| M72422.1 | F: AGTGCCACAGCTGGAACCA | 155 | 250 | 57 |
|
| R: ACACCGTTCAGCTTCCACTTGT | |||||||
| Glutamic acid decarboxylase |
| M76177.1 | F: CATCCTGGTCAAGGAAAAGG | 78 | 250 | 57 |
|
| R: TGCTTGTCTGGCTGGAAGAG | |||||||
| Gamma.aminobutyric acid type A receptor subunit alpha 2 |
| NM_001135779.2 | F: GACAATGACCACATTAAGCATCAG | 356 | 200 | 61 | Designed by us |
| R: TCTTGGCTTCGGCTGGCTTGTTCTC | |||||||
| Solute carrier family 6 member 1 (GABA trasnsporter) |
| NM_024371.2 | F: GCGCAACATGCACCAAATGACA | 140 | 300 | 61 |
|
| R: AGACCACCTTTCCAGTCCATCCAA | |||||||
| Solute carrier family 32 member 1 (Vesicular GABA transporter) |
| NM_031782.2 | F: AAACGCCATTCAGGGCATGTTC | 197 | 300 | 61 |
|
| R: CGTTAGCTATGGCCACATACGA | |||||||
| Peptidylprolyl isomerase A (Cyclophilin A) | Ppia | NM_017101.1 | F: GGGTTCCTCCTTTCACAGA | 320 | 500 | 61 | Designed by us |
| R: GGCAAGACCAGCAAGAAGA |
Experimental conditions for quantitative PCR.
| Gene name (common name) | Symbol | Length (bp) | PCR cycles conditions | |||
|---|---|---|---|---|---|---|
| Denaturation time and temperature | Alignment time and temperature | Extension time and temperature | Number of cycles | |||
| Glutaminase transcript variant 1 |
| 100 | 10´´ at 95°C | 10´´ at 61°C | 8´´ at 72°C | 40 |
| Glutaminase transcript variant 2 |
| 143 | 10´´ at 95°C | 10´´at 61°C | 10´´ at 72°C | 40 |
| Solute carrier family 17 member 6 (Vesicular glutamate transporter) |
| 106 | 10´´ at 95°C | 10´´ at 61°C | 8´´ at 72°C | 40 |
| Glutamate ionotropic receptor NMDA type subunit 1 |
| 110 | 10´´ at 95°C | 10´´ at 61°C | 8´´ at 72°C | 40 |
| Glutamate ionotropic receptor kainate type subunit 1 |
| 94 | 10´´ at 95°C | 10´´ at 57°C | 8´´ at 72°C | 50 |
| Glutamate ionotropic receptor AMPA type subunit 1 |
| 105 | 10´´ at 95°C | 10´´ at 61°C | 8´´ at 72°C | 40 |
| Solute carrier family 1 member 3 (Excitatory amino acid transporter) |
| 108 | 10´´ at 95°C | 10´´ at 61°C | 8´´ at 72°C | 40 |
| Metabotropic glutamate receptor |
| 77 | 10´´ at 95°C | 10´´ at 57°C | 8´´ at 72°C | 40 |
| Glutamic acid decarboxylase |
| 155 | 10´´ at 95°C | 10´´ at 57°C | 10´´ at 72°C | 40 |
| Glutamic acid decarboxylase |
| 78 | 10´´ at 95°C | 10´´ at 57°C | 8´´ at 72°C | 40 |
| Gamma.aminobutyric acid type A receptor subunit alpha 2 |
| 356 | 1´ at 95°C | 1´ at 61°C | 1´ at 72°C | 40 |
| Solute carrier family 6 member 1 (GABA trasnsporter) |
| 140 | 10´´ at 95°C | 10´´ at 61°C | 10´´ at 72°C | 40 |
| Solute carrier family 32 member 1 (Glutamate vesicular transporter) |
| 197 | 10´´ at 95°C | 10´´ at 61°C | 20´´ at 72°C | 40 |
| Peptidylprolyl isomerase A (Cyclophilin A) | Ppia | 320 | 10´´ at 95°C | 10´´ at 61°C | 10´´ at 72°C | 40 |
FIGURE 2Horizontal activity, vertical episode activity, center distance, and margin distance of recorded throughout a 24-h dark/light cycle. Spontaneous locomotor activity was evaluated at 12 months of exposure to 1 or 10 mg ATR/kg. Chronic exposure to 10 mg ATR/kg caused a significant increase in vertical activity in comparison to 1 mg ATR/kg and control groups. Data were analyzed using a two-way analysis of variance with repeated measures (treatment x time) followed by Fisher’s LSD tests for pairwise comparisons.* Denotes differences of 10 mg ATR/kg group in comparison to the 1 mg ATR/kg and control groups, p < 0.05 (n = 10).
Summary of the effects of chronic ATR exposure on the expression genes associated with GABAergic and glutamatergic systems.
| Real time PCR | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Brain region | Glutamatergic system | GABAergic system | |||||||||||
|
|
|
|
|
|
|
|
|
|
|
|
|
| |
| Striatum | ↑ |
|
|
|
| ↑ | ↑ | ↑ |
| ↑ |
|
| ↑ |
| Nucleus accumbens | ↑ |
|
|
|
|
|
|
|
|
|
|
|
|
| Ventral midbrain |
|
|
|
|
|
|
|
|
|
|
|
| ↑ |
| Prefrontal cortex |
| ↑ |
|
|
| ↑ |
|
|
|
|
|
|
|
| Hippocampus |
| ↑ | ↑ | ↑ |
|
|
|
|
|
|
|
|
|
1 mg ATR/kg.
10 mg ATR/kg.
FIGURE 3Chronic exposure to 1 or 10 mg ATR/kg increased the mRNA expression of glutaminase variant 1 (Gls), N-methyl-D-aspartate receptor (Gria1), excitatory amino acid transporter 1 (Slc1a3), and metabotropic glutamate receptor 1 (MGLUR1) of the glutamatergic system and increased the expression of glutamate decarboxylase 67 (GAD67) and the vesicular GABA transporter (Slc32a1) of the GABAergic system in the striatum. Data were analyzed by Kruskal-Wallis test for overall effects; in case of significant effects, Mann–Whitney U test was used for pairwise comparisons. * Denotes differences between 1 or 10 mg ATR/kg group and the control group, p < 0.05. (n = 10).
FIGURE 4Chronic exposure to 1 or 10 mg ATR/kg only increased the mRNA expression of glutaminase variant 1 (Gls) of the glutamatergic system in the nucleus accumbens. Data were analyzed by Kruskal-Wallis test for overall effects; in case of significant effects, Mann–Whitney U test was used for pairwise comparisons. * Denotes differences between 1 or 10 mg ATR/kg group and the control group, p < 0.05. (n = 10).
FIGURE 5Chronic exposure to 1 mg ATR/kg increased the mRNA expression of vesicular GABA transporter (Slc32a1) of the GABAergic system in the ventral midbrain. Data were analyzed by Kruskal-Wallis test for overall effects; in case of significant effects, Mann–Whitney U test was used for pairwise comparisons. * Denotes differences between 1 or 10 mg ATR/kg group and the control group, p < 0.05. (n = 10).
FIGURE 6Chronic exposure to 1 or 10 mg ATR/kg increased the mRNA expression of glutaminase variant 2 (Gls) and α-amino-3-hydroxy 5 methyl-4-isoxazole propionic acid receptor (Gria1) of the glutamatergic system in the prefrontal cortex. Data were analyzed by Kruskal-Wallis test for overall effects; in case of significant effects, Mann–Whitney U test was used for pairwise comparisons. * Denotes differences between 1 or 10 mg ATR/kg group and the control group, p < 0.05. (n = 10).
FIGURE 7Chronic exposure to 1 or 10 mg ATR/kg increased the mRNA expression of glutaminase variant 2 (Gls), vesicular glutamate transporter 2 (Slc17a6), and N-methyl D-aspartate receptor (Grin1) of the glutamatergic system in the hippocampus. Data were analyzed by Kruskal-Wallis test for overall effects; in case of significant effects, Mann–Whitney U test was used for pairwise comparisons. * Denotes differences between 1 or 10 mg ATR/kg group and the control group, p < 0.05. (n = 10).