Steffen Fuchs1,2,3,4,5,6, Loélia Babin5,6, Elissa Andraos5,6, Chloé Bessiere5,6, Semjon Willier7, Johannes H Schulte1,2,3,4, Christine Gaspin8,9, Fabienne Meggetto5,6. 1. Department of Pediatric Oncology and Hematology, Charité - Universitätsmedizin Berlin, Berlin, Germany. 2. German Cancer Consortium (DKTK), Partner Site Berlin, Berlin, Germany. 3. German Cancer Research Center (DKFZ), Heidelberg, Germany. 4. Berlin Institute of Health at Charité -Universitätsmedizin Berlin, BIH Biomedical Innovation Academy, BIH Charité Clinician Scientist Program, Berlin, Germany. 5. CRCT, Inserm, CNRS, Université Toulouse III-Paul Sabatier, Centre de Recherches en Cancérologie de Toulouse, Université de Toulouse, Toulouse, France. 6. Laboratoire d'Excellence Toulouse Cancer-TOUCAN, Toulouse, France. 7. Department of Pediatric Hematology, Oncology and Stem Cell Transplantation, Dr. von Hauner Children's Hospital, University Hospital, LMU Munich, Munich, Germany. 8. INRAE, BioinfOmics, GenoToul Bioinformatics Facility, Université Fédérale de Toulouse, Castanet-Tolosan, France. 9. INRAE, MIAT, Université Fédérale de Toulouse, Castanet-Tolosan, France.
Abstract
Circular RNA (circRNA) is a noncoding RNA class with important implications for gene expression regulation, mostly by interaction with other RNA species or RNA-binding proteins. While the commonly applied short-read Illumina RNA-sequencing techniques can be used to detect circRNAs, their full sequence is not revealed. However, the complete sequence information is needed to analyze potential interactions and thus the mechanism of action of circRNAs. Here, we present an improved protocol to enrich and sequence full-length circRNAs by using the Oxford Nanopore long-read sequencing platform. The protocol involves an enrichment of lowly abundant circRNAs by exonuclease treatment and negative selection of linear RNAs. Then, a cDNA library is created and amplified by PCR. This protocol provides enough material for several sequencing runs. The library is used as input for ligation-based sequencing together with native barcoding. Stringent quality control of the libraries is ensured by a combination of Qubit, Fragment Analyzer and qRT-PCR. Multiplexing of up to 4 libraries yields in total more than 1-2 Million reads per library, of which 1-2% are circRNA-specific reads with >99% of them full-length. The protocol works well with human cancer cell lines. We further provide suggestions for the bioinformatic analysis of the created data, as well as the limitations of our approach together with recommendations for troubleshooting and interpretation. Taken together, this protocol enables reliable full-length analysis of circRNAs, a noncoding RNA type involved in a growing number of physiologic and pathologic conditions. Metadata Associated content. https://dx.doi.org/10.17504/protocols.io.rm7vzy8r4lx1/v2.
Circular RNA (circRNA) is a noncoding RNA class with important implications for gene expression regulation, mostly by interaction with other RNA species or RNA-binding proteins. While the commonly applied short-read Illumina RNA-sequencing techniques can be used to detect circRNAs, their full sequence is not revealed. However, the complete sequence information is needed to analyze potential interactions and thus the mechanism of action of circRNAs. Here, we present an improved protocol to enrich and sequence full-length circRNAs by using the Oxford Nanopore long-read sequencing platform. The protocol involves an enrichment of lowly abundant circRNAs by exonuclease treatment and negative selection of linear RNAs. Then, a cDNA library is created and amplified by PCR. This protocol provides enough material for several sequencing runs. The library is used as input for ligation-based sequencing together with native barcoding. Stringent quality control of the libraries is ensured by a combination of Qubit, Fragment Analyzer and qRT-PCR. Multiplexing of up to 4 libraries yields in total more than 1-2 Million reads per library, of which 1-2% are circRNA-specific reads with >99% of them full-length. The protocol works well with human cancer cell lines. We further provide suggestions for the bioinformatic analysis of the created data, as well as the limitations of our approach together with recommendations for troubleshooting and interpretation. Taken together, this protocol enables reliable full-length analysis of circRNAs, a noncoding RNA type involved in a growing number of physiologic and pathologic conditions. Metadata Associated content. https://dx.doi.org/10.17504/protocols.io.rm7vzy8r4lx1/v2.
Circular RNAs (circRNAs) are a class of noncoding RNA, which is generated by a form of alternative splicing termed back-splicing. Their ring-like structure and lack of free 5’ and 3’ ends render them exonuclease resistant and more stable than linear RNAs. This is the reason why they escape detection by the highly used poly(A)-selected mRNA sequencing [1, 2]. circRNAs regulate gene expression by e.g. binding to microRNAs or RNA-binding proteins, or interact directly with the transcriptional machinery [3-5]. The commonly applied Illumina-based short-read sequencing techniques can be readily used (total RNA-seq) to identify circRNAs by their characteristic back-splice junction [6]. However, since circRNAs, which have an average size ranging from 200 to 800 nt [7, 8], share their remaining sequence with their cognate linear RNAs from the same gene, the full-length information cannot be confidently retrieved by these methods. The recently developed long-read RNA-sequencing techniques such as the Oxford-Nanopore sequencing platform bear great potential to obtain this missing information due to their ability to sequence transcripts in full-length.Sequencing of circRNAs by a direct RNA-sequencing protocol with Oxford Nanopore is an attractive option to analyze circRNAs including their epigenetic modifications without introduction of bias by PCR. However, such an approach requires a linearization of circRNA molecules and has a reduced sensitivity, since the detection of lowly abundant circRNAs is limited and the sequencing coverage is not as high as for Illumina-based methods. Wang et al. followed this approach to analyze plant RNA [9], which they fragmented to be able to sequence it. While several circRNAs were detected, the high amount of input RNA remains a critical limitation in particular when analyzing human and especially patient samples that are often degraded.Recently, a workflow was published to sequence circRNAs by creating a cDNA library that is amplified by PCR, without the need of fragmentation [8]. The approach of Zhang et al. uses a ribodepletion followed by an enrichment of circRNAs by exonuclease treatment and a size selection of transcripts longer than 1 kb. The created library is then used for ligation-based sequencing with Oxford Nanopore. With this approach the team obtained between 0.8 and 4 million reads per library, of which 1–6% were circRNA-specific reads that mapped to the back-splice junction. Here, we present a modified version of this workflow that we adapted to retrieve full-length sequencing information also of shorter circRNAs to cover the whole spectrum of circRNAs. The workflow produces an increased library output to sequence several times, if needed, to potentially detect also lowly abundant circRNAs. In more detail, we changed the ribodepletion method from a commercial kit to the published method of Baldwin et al. [10], which worked more efficiently in our hands. This ribodepletion method is based on a pool of DNA oligonucleotides that hybridize with ribosomal RNA and a subsequent digest of DNA:RNA hybrids by RNaseH. For further circRNA enrichment a negative selection of poly(A) transcripts was added by using oligo(dT)-conjugated magnetic beads. The final size selection of the amplified circRNA library was adapted to include shorter circRNAs. Finally, we introduced a quality control by qRT-PCR to detect the enrichment of circRNAs and the depletion of unwanted transcripts, such as ribosomal RNA, mitochondrial RNA and small-nucleolar RNAs. Further, we provide recommendations for the Nanopore library creation and sequencing together with recommendations for the bioinformatics analysis.
Materials and methods
The protocol described in this peer-reviewed article is published on protocols.io, https://dx.doi.org/10.17504/protocols.io.rm7vzy8r4lx1/v2
(version 2) and is included for printing as S1 File with this article.
circRNA validation
1 μg RNA isolated from COST anaplastic large-cell lymphoma (ALCL) cells was used to create cDNA with the ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, #E6560S) according to the manufacturer using random hexamer primers. An RT-PCR was performed using the FastStart Taq DNA Polymerase (Roche, #4738381001) according to the manufacturer. The used primer sequences are as follows: circARID1A (F: CTCCAGTAAGGGAGGGCAAG, R: TGTTGCTGCGAGTATGGGTT), circNFATC3 (F: TGAAACTGAAGGTAGCCGAGG, R: ATGTGGTAAGCAAAGTGGTGTG), circASAP1 (F: GGATACAGCATGCATCAGCTC, R: TCAGCTCCTGTTATCTCTGTGC), circSETD3 (F: TCCTTTGGTGACACAGTTGCT, R: ACTCCTTCTGGCAGCCCTAT) and circZBTB46 (F: CCGGTAGTGGGACGTGATTT, R: ACTCGCTGTCCCAGTCTGTA). PCR products were analyzed by agarose gel electrophoresis (2% agarose, 100 V, 30 min.). The band of the expected size was cut and the DNA cleaned by NucleoSpin Gel and PCR Clean-up kit (Macherey Nagel, #740609.50) following the manufacturer’s recommendations. The samples were sent for Sanger sequencing to Eurofins Genomics (Ebersberg, Germany). Obtained sequences were analyzed by NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and aligned to the human genome (GRCh38) and the respective circRNA sequence.
Expected results
Using the described protocol, we prepared sequencing libraries of 4 different anaplastic large-cell lymphoma (ALCL) cell lines that served as a model to test the workflow (SU-DHL-1, Karpas-299, COST [11], SUP-M2). The obtained libraries had an average length of 606.8 nt and a concentration of 4.8 ng/μl (117–133 ng of library in total), respectively (Fig 1, Table 1). The library length corresponds with the average published size of circRNAs, which is between 200–800 nt [7, 8], thus showing that our workflow maintains the size of circRNAs and does not degrade them.
Fig 1
Generated libraries have the size of the average circRNA length.
Shown is the library created from RNA of the anaplastic large-cell lymphoma cell line SU-DHL-1. The library size was analyzed by Fragment Analyzer with the kit hs NGS. The average library size was 654 nt. RFU, relative fluorescence units.
Table 1
Results of the library preparation.
Libraries for Nanopore sequencing were prepared of 4 anaplastic large-cell lymphoma cell lines (SU-DHL1, Karpas-299, COST, SUP-M2). The concentration was measured with the Qubit BR dsDNA kit and library size by Fragment Analyzer with the hs NGS kit.
SU-DHL-1
Karpas-299
COST
SUP-M2
Average
Concentration [ng/μl]
5.12
4.68
4.92
4.5
4.81
Size [nt]
654
629
573
571
606.8
Generated libraries have the size of the average circRNA length.
Shown is the library created from RNA of the anaplastic large-cell lymphoma cell line SU-DHL-1. The library size was analyzed by Fragment Analyzer with the kit hs NGS. The average library size was 654 nt. RFU, relative fluorescence units.
Results of the library preparation.
Libraries for Nanopore sequencing were prepared of 4 anaplastic large-cell lymphoma cell lines (SU-DHL1, Karpas-299, COST, SUP-M2). The concentration was measured with the Qubit BR dsDNA kit and library size by Fragment Analyzer with the hs NGS kit.As part of our introduced quality control workflow, a qRT-PCR was performed to detect the enrichment of circRNAs and the depletion of unwanted RNA transcripts (Fig 2). We used 3 different circRNAs as indicator for an enrichment, of which we know from previous Illumina-based RNA-sequencing experiments that they are well expressed in our cell line models. The enrichment was on average between 4 and 17-fold in comparison to the non-enriched control. Ribosomal RNA was depleted more than 30,000-fold and also other unwanted transcripts were degraded (mitochondrial RNA, small nucleolar RNA, signal recognition particle RNA, linear RNAs and mRNAs).
Fig 2
circRNAs get enriched by the library workflow.
4 different RNA samples from anaplastic large-cell lymphoma cell lines (SU-DHL-1, Karpas-299, COST and SUP-M2) were treated enzymatically to enrich for circRNAs as described in the protocol. The expression of circRNAs and unwanted transcripts (ribosomal RNA, 18S rRNA; mitochondrial RNA, mtRNR1; small-nucleolar RNA, RNU6B; signal recognition particle RNA, RN7SL2 and linear RNAs/mRNAs, linkZKSCAN1, linHIPK3) was analyzed by qRT-PCR and compared with an untreated Mock control.
circRNAs get enriched by the library workflow.
4 different RNA samples from anaplastic large-cell lymphoma cell lines (SU-DHL-1, Karpas-299, COST and SUP-M2) were treated enzymatically to enrich for circRNAs as described in the protocol. The expression of circRNAs and unwanted transcripts (ribosomal RNA, 18S rRNA; mitochondrial RNA, mtRNR1; small-nucleolar RNA, RNU6B; signal recognition particle RNA, RN7SL2 and linear RNAs/mRNAs, linkZKSCAN1, linHIPK3) was analyzed by qRT-PCR and compared with an untreated Mock control.The created library pool was used as input for Oxford Nanopore sequencing with the ligation-based sequencing kit (SQK-LSK109) together with the native barcoding kit (EXP-NBD104) according to the manufacturer and sequenced on one flow cell on a MinION MK1C. The sequencing output was on average 1,536,229 reads per library and the reads were of high quality (Table 2, mean Q-score 15).
Table 2
Sequencing results obtained with one MinION flow cell.
circRNA-enriched libraries from 4 anaplastic large-cell lymphoma cell lines were sequenced by Oxford Nanopore. Calculations are based on the passed reads and the circRNA analysis was performed with CIRI-Long. BSJ, back-splice junction.
SU-DHL1
Karpas-299
COST
SUP-M2
Average
Raw reads
1,473,419
1,734,196
899,725
2,037,577
1,536,229
Mean read length [nt]
459.6
368.2
386.3
403.3
404.4
Maximum read length [nt]
4,006
3,889
3,538
3,455
3,722
BSJ-reads (% of reads)
1.05
0.95
0.95
1.06
1.00
Full-length circRNAs
15,673
16,725
8,750
21,918
15,767
Different circRNAs
3,143
3,195
1,426
4,017
2,945
Mean circRNA length [nt]
435.1
354.9
366.4
370.4
381.7
Maximum circRNA length [nt]
1,798
1,634
1,596
2,228
1,814
Sequencing results obtained with one MinION flow cell.
circRNA-enriched libraries from 4 anaplastic large-cell lymphoma cell lines were sequenced by Oxford Nanopore. Calculations are based on the passed reads and the circRNA analysis was performed with CIRI-Long. BSJ, back-splice junction.Importantly, the pores were not completely saturated, so probably a longer sequencing run with more material would have been possible. Base calling of the raw sequencing data was performed with Guppy from the MinKNOW software (v22.05.8, part of the operation system of the MinION sequencing device) and fastq files were generated. Bioinformatics analysis of the fastq files involved cleaning the reads from adapter sequences with cutadapt (v.3.4, https://doi.org/10.14806/ej.17.1.200). Then the CIRI-Long software (v1.0.3, [8]) was used to detect circRNAs using default settings (detailed recommendations are included in our protocol as S1 File). Following the analysis workflow described for CIRI-Long in our protocol we could identify on average 15,767 circRNA-specific reads, thus 1.0% of the total reads, of which 99% covered the full length of the circRNA (Figs 3 and 4), similar to the study from Zhang et al. [8]. On average 2,945 different circRNAs were identified. Of note, it is visible that when more reads are generated, more different full-length circRNA isoforms are detected, which could be another argument for deeper sequencing. The results were comparable among the samples from the 4 different human cancer cell lines, which demonstrates the robustness of the workflow.
Fig 3
Distribution of the length of identified circRNAs.
Shown are the results of circRNA sequencing from 4 anaplastic large-cell lymphoma (ALCL) cell lines with Oxford Nanopore. A) Distribution of read length and B) length of the identified circRNAs in the 4 different ALCL cell line samples. Gaussian kernel density estimation was used to calculate the distribution of circRNA length.
Fig 4
One long read captures the entire length of one circRNA several times.
A) Shown is exemplified the alignment of sequencing reads obtained by Oxford Nanopore sequencing in the anaplastic large-cell lymphoma cell line SU-DHL-1. The alignment to exon 2–4 of the ARID1A gene supports a circRNA with a back-splice junction between exon 4 and 2 that was captured by one long-read (arrows). Track 1: genomic location, track 2: sequencing coverage, track 3: predicted splice junctions, track 4: selected sequencing reads and their alignment, track 5: genes and their exons and introns. The alignment was visualized with IGV Genomics Viewer. B) Scheme showing the long read from panel A aligning several times to circARID1A derived from ARID1A. Marked is the back-splice junction (BSJ).
Distribution of the length of identified circRNAs.
Shown are the results of circRNA sequencing from 4 anaplastic large-cell lymphoma (ALCL) cell lines with Oxford Nanopore. A) Distribution of read length and B) length of the identified circRNAs in the 4 different ALCL cell line samples. Gaussian kernel density estimation was used to calculate the distribution of circRNA length.
One long read captures the entire length of one circRNA several times.
A) Shown is exemplified the alignment of sequencing reads obtained by Oxford Nanopore sequencing in the anaplastic large-cell lymphoma cell line SU-DHL-1. The alignment to exon 2–4 of the ARID1A gene supports a circRNA with a back-splice junction between exon 4 and 2 that was captured by one long-read (arrows). Track 1: genomic location, track 2: sequencing coverage, track 3: predicted splice junctions, track 4: selected sequencing reads and their alignment, track 5: genes and their exons and introns. The alignment was visualized with IGV Genomics Viewer. B) Scheme showing the long read from panel A aligning several times to circARID1A derived from ARID1A. Marked is the back-splice junction (BSJ).We then selected randomly 5 different circRNAs detected by Nanopore for validation (Fig 5 and S1 Fig). COST ALCL cells were used to isolate RNA and transcribe cDNA. Primers were designed to specifically amplify the circRNAs, which were submitted for Sanger sequencing. The characteristic back-splice junction essential for the formation of the RNA circle was detected for all of the circRNAs, which validates our sequencing workflow.
Fig 5
circRNAs detected by Nanopore were validated by Sanger sequencing.
3 different circRNAs (A: circZBTB46, B: circSETD3, C: circASAP1) detected by Nanopore-seq were amplified by RT-PCR using cDNA from COST ALCL cells and analyzed by Sanger sequencing. For each panel, the alignment of long reads against the exons that form the circRNA is shown in the upper part as visualized by IGV Genomics Viewer (tracks as in Fig 3). In the lower part a scheme of the circRNA is shown, together with the localization of the used primers and the BSJ-sequence obtained by Sanger sequencing. The circbase.org ID is mentioned [14]. BSJ, back-splice junction.
circRNAs detected by Nanopore were validated by Sanger sequencing.
3 different circRNAs (A: circZBTB46, B: circSETD3, C: circASAP1) detected by Nanopore-seq were amplified by RT-PCR using cDNA from COST ALCL cells and analyzed by Sanger sequencing. For each panel, the alignment of long reads against the exons that form the circRNA is shown in the upper part as visualized by IGV Genomics Viewer (tracks as in Fig 3). In the lower part a scheme of the circRNA is shown, together with the localization of the used primers and the BSJ-sequence obtained by Sanger sequencing. The circbase.org ID is mentioned [14]. BSJ, back-splice junction.The limitations of this protocol involve the relatively low abundance of circRNAs in general. Since Nanopore sequencing creates less reads in comparison to Illumina-based techniques, especially lowly abundant circRNAs might not be detected by our protocol. Further, the recommended RNA input of 7 μg to have enough material for several rounds of sequencing and also detect lower abundant circRNAs might be too high for situations, where the material is limited. However, we successfully tested our protocol with as little as 3 μg, without impairing the sequencing output. If the obtained amount of DNA by the circRNA enrichment workflow is not high enough, then the PCR amplification of the cDNA libraries can be adapted by increasing the volume of the PCR reaction and the number of cycles (step 12 of the protocol). Further, if the expected size of circRNAs in the cell model of interest is lower or higher than 200–800 nt, the size selection (step 13 of the protocol) can be easily adapted by changing the ratio of beads to DNA (lower ratio selects for larger fragments, higher ratio selects for shorter fragments). Limitations concerning the used tool CIRI-Long to detect circRNAs are that the tool does not detect circRNAs derived from fusion genes. Further, the alignment parameters are not modifiable and a bam file containing the aligned reads is not conserved. Therefore, we routinely perform a separate alignment using minimap2 (v.2.19, [12]) and a visualization by IGV Genomics Viewer (v2.9.4, [13]). By this means, chimeric alignments containing segments of the same read aligning to distant genes can be visualized and help to identify fusion gene derived circRNAs.In summary, this protocol facilitates consistent full-length sequencing of circRNAs, which will help to study this noncoding RNA type in a variety of physiologic and pathologic contexts.
Validation of circRNAs by Sanger sequencing.
2 circRNAs detected by Nanopore-seq were validated by Sanger sequencing similar as in Fig 5. Representative alignments and the BSJ-sequence obtained by Sanger sequencing are shown for A) circNFATC3 and B) circARID1A (alignments see Fig 4). The circbase.org ID is mentioned [14]. BSJ, back-splice junction.(TIF)Click here for additional data file.
Step-by-step protocol, also available on protocols.io.
(PDF)Click here for additional data file.23 May 2022
PONE-D-22-06858
Generation of full-length circular RNA libraries for Oxford Nanopore long-read sequencing
PLOS ONE
Dear Dr. Fuchs,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Among all comments, please take into account those regarding the methodology, challenges and interpretations.
In that sense, the whole protocol must be explained in detail.
Please submit your revised manuscript by Jun 17 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Eduardo Andrés-LeónAcademic EditorPLOS ONEJournal Requirements:1. When submitting your revision, we need you to address these additional requirements.Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Thank you for providing the following Protocols.io DOI in your submission form [Protocols.io DOI]. In keeping with our submission requirements, please add the Protocols.io DOI to the Methods section of your manuscript as well using this format: “The protocol described in this peer-reviewed article is published on protocols.io, https://dx.doi.org/10.17504/protocols.io[........] and is included for printing as supporting information file 1 with this article.” For more information, please see our submission guidelines: https://journals.plos.org/plosone/s/submission-guidelines#loc-guidelines-for-specific-study-types3. Please update your submission to use the PLOS LaTeX template. The template and more information on our requirements for LaTeX submissions can be found at http://journals.plos.org/plosone/s/latex.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Does the manuscript report a protocol which is of utility to the research community and adds value to the published literature? Reviewer #1: YesReviewer #2: Yes********** 2. Has the protocol been described in sufficient detail?Descriptions of methods and reagents contained in the step-by-step protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample sizes and replication needed to ensure that the data are robust and reproducible. Reviewer #1: NoReviewer #2: Yes********** 3. Does the protocol describe a validated method?The manuscript must demonstrate that the protocol achieves its intended purpose: either by containing appropriate validation data, or referencing at least one original research article in which the protocol was used to generate data. Reviewer #1: NoReviewer #2: Yes********** 4. If the manuscript contains new data, have the authors made this data fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: NoReviewer #2: Yes**********
5. Is the article presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please highlight any specific errors that need correcting in the box below. Reviewer #1: YesReviewer #2: Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this manuscript, the authors have developed a circRNA sequencing protocol that allows full length analysis using Oxford nanopore. Overall, the attempt to identify the full length of circRNAs is appreciated. However, the authors need to include the full detailed protocol within this manuscript with full analysis, troubleshooting, challenges, expected results and interpretations. The authors should also provide other data than those published at protocols.io with examples of fully delineated sequences of various circRNAs and confirmed by sanger sequencing.Reviewer #2: Fuchs et al. present a comprehensive protocol based on the published Full-length sequencing protocol by Zhang et al. The adapted approach differs in several aspects, such as the optimization of different circRNA lengths and addition of cleanup procedures as well as QC steps.1. The authors mention “Modification of the ribodepletion method” as one of the parts changed in the adapted protocol. A short description on what the change is would be helpful in the abstract part of the protocol.2. The protocol suggests use of qRT-PCR for validation of circRNAs and linear RNAs. It might be helpful to include a link to tools that can easily generate circRNA-specific primer pairs, as standard tools usually do not easily work with circular RNAs.3. It would be helpful to directly state in the abstract on protocols.io the required amount of starting material, as this is crucial in cases where only little material is available.4. In general, the generated data data is freely available, however, the GEO entry has an embargo date of March 2023, thus the data is not immediately available.********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.25 Jun 2022Dear Dr. Andrés-León,Thank you very much for the consideration of our manuscript and the assessment. Further, we would like to thank you for the deadline extension, which allowed us to perform a thorough review. We appreciate the comments of the two reviewers that were very helpful for us. We carefully took their concerns and recommendations into account and now provide a much more detailed protocol (version 2), including further information about the bioinformatics analysis, challenges and limitations together with expected results of this protocol and their interpretation. Further, we created new in vitro data to show the robustness of our approach by validating several circRNAs detected by Nanopore via Sanger sequencing. Changes in the manuscript are marked in blue and are italicized. We updated our protocol on protocols.io and attached a .pdf copy as supplementary file to the manuscript. The changes in the protocol we made are described in detail below, since the protocols.io website does not allow tracking of the changes.We hope that the following explanations as well as our point-by-point response to the reviewers, where we have addressed all of their concerns and comments, will make the manuscript acceptable for publication in PLOS ONE.If you require any further information, please do not hesitate to contact us directly. Thank you for your time and consideration. We look forward to hearing from you at your earliest convenience.Yours sincerely,Steffen Fuchs----------------------Reviewer #1:In this manuscript, the authors have developed a circRNA sequencing protocol that allows full length analysis using Oxford nanopore. Overall, the attempt to identify the full length of circRNAs is appreciated. However, the authors need to include the full detailed protocol within this manuscript with full analysis, troubleshooting, challenges, expected results and interpretations. The authors should also provide other data than those published at protocols.io with examples of fully delineated sequences of various circRNAs and confirmed by sanger sequencing.Response:We thank the reviewer for the appreciation of our provided approach to sequence circRNAs in full length and for the provided feedback and comments. We agree with the reviewer that more methodical details of the protocol, including its limitations and challenges together with troubleshooting and further more details on the expected results and their interpretation will be very helpful for the researchers planning to use it. We therefore expanded our protocol and added those details to “Steps” and added these new sections to the protocol: 5) Suggestions for Nanopore sequencing, 6) Recommendations for bioinformatics analysis of the data, 7) Expected results and interpretation, 8) Limitations and challenges, 9) Troubleshooting.Although, the creation of the sequencing libraries and the sequencing itself follows the official protocol provided by Oxford Nanopore (kits EXP-NBD104 and SQK-LSK109), we provide now explanations and suggestions for modifications that improved sequencing for us. For instance, we included an optional part on washing the flow cell during a sequencing run and reloading the library to obtain more sequencing reads.While the focus of this protocol lies on the generation of the enriched circRNA-fraction for library generation, we agree with the reviewer that more information concerning the data analysis should be provided. Therefore, we provide now detailed recommendations concerning the bioinformatics analysis including the used commands, the limitations of the analysis and how to overcome them (in the protocol at section 6) “Recommendations for bioinformatics analysis of the data” and in sections 7 to 9).This protocol is part of the materials and methods section of the manuscript and further attached as supplementary data file, now in the more detailed version 2. In the manuscript we added a summary of all this information in the abstract lines 71-73 (page 3), the introduction at lines 117-118 (page 5), and in the expected results section at lines 189-194 (page 8) and lines 236-254 (pages 9, 10).We appreciate the recommendation of the reviewer to validate circRNAs by Sanger sequencing that we detected by Oxford Nanopore. This approach will help to show the robustness of our workflow. We now selected randomly 5 circRNAs that were detected by Nanopore. The circRNAs were amplified by PCR and Sanger sequencing was performed. With this approach we could confirm all of the selected circRNAs as indicated by the detected back-splice junction in one of the anaplastic large-cell lymphoma cell lines that we sequenced by Nanopore. This information is now added as Figure 5 and supplementary figure S1 in the manuscript. Text was added to the manuscript in lines 124-140 (pages 5, 6), 217-234 (pages 8, 9).Reviewer #2:Fuchs et al. present a comprehensive protocol based on the published Full-length sequencing protocol by Zhang et al. The adapted approach differs in several aspects, such as the optimization of different circRNA lengths and addition of cleanup procedures as well as QC steps.1. The authors mention “Modification of the ribodepletion method” as one of the parts changed in the adapted protocol. A short description on what the change is would be helpful in the abstract part of the protocol.Response:We thank the reviewer for this comment. Indeed, the ribodepletion method is crucial for the enrichment of circRNAs for the generation of libraries, since their abundance is much lower than that of ribosomal RNA. In the basic protocol from Zhang et al. the authors propose the use of a commercial ribodepletion kit (RiboErase kit, #07962266001, Kapa Biosystems). This kit, like other newer kits e.g. from New England Biolabs (NEBNext rRNA Depletion Kit v2, #E7405), is based on the protocol of Adiconis et al.[1], which uses a pool of DNA oligonucleotides directed against human rRNAs followed by a digest of DNA:RNA hybrids by RNaseH. However, the exact composition of the commercial kits remains proprietary and the used sequences are not public. In our protocol, we use the method published by Baldwin et al. [2] that is an updated and more efficient version of the Adiconis method. We use this method routinely as well successfully for the creation of Illumina RNA-sequencing libraries. Key changes are an increased ratio of DNA oligonucleotides to RNA (5:1, whereas in the Adiconis protocol a 1:1 ratio is used) and a higher incubation temperature of RNaseH (65°C in comparison to 45°C), which increases the activity and reduces the incubation time. We compared the commercial kit with the Adiconis and the Baldwin method. Adiconis and Baldwin’s methods outperformed the kit, while Baldwin’s method led to the most efficient ribodepletion. We added this information to the manuscript in line 110-112 (page 5) and in the protocol in the section “Steps”.2. The protocol suggests use of qRT-PCR for validation of circRNAs and linear RNAs. It might be helpful to include a link to tools that can easily generate circRNA-specific primer pairs, as standard tools usually do not easily work with circular RNAs.Response:We thank the reviewer for this helpful remark. Indeed, it is important to carefully design divergent primers to specifically amplify the backsplice-junction of a circRNA without amplifying the cognate linear RNA transcribed from the same gene. We added information in the protocol to section “4) Quality control, Step 15 Validation of circRNA enrichment” on how to design primers to specifically detect circRNAs and linked two tools for primer design: CircInteractome [3] and CircPrimer 2.0 [4].3. It would be helpful to directly state in the abstract on protocols.io the required amount of starting material, as this is crucial in cases where only little material is available.Response:We appreciate this useful remark of the reviewer and we agree that it is crucial to mention the amount of needed starting material to prepare the sequencing libraries, especially when it comes to patient samples, which might be limited. We tested different RNA quantities to enrich for circRNAs and found that 7 µg, as we wrote in the protocol, works best and further provides enough material to sequence the samples several times to create enough data. However, we also tried 3-5 µg as input, and we could observe no major change in the amount of obtained reads, especially when multiplexing several samples, which should still lead to sufficient pore occupancy while sequencing. We added this information to the abstract and the materials section of the protocol and further in the “Expected results” part of the manuscript, lines 238-242 (page 9).4. In general, the generated data are freely available, however, the GEO entry has an embargo date of March 2023, thus the data is not immediately available.Response:We thank the reviewer for this comment. The data was uploaded to the public repository NCBI GEO and is freely available, thus following the recommendations of PLOS ONE. However, we put an embargo on the dataset for the moment, to protect our data while the manuscript is still under revision. The data will be open as soon as the manuscript is accepted, which is in line with the NCBI GEO recommendations. We are happy to provide a temporary reviewer access to the data for the purpose of the review, which is as follows: NCBI GEO: https://www.ncbi.nlm.nih.gov/geo/, dataset ID: GSE197872, temporary reviewer password: erkpwyakjfezzed.New references added:1. Adiconis X, Borges-Rivera D, Satija R, DeLuca DS, Busby MA, Berlin AM, et al. Comparative analysis of RNA sequencing methods for degraded or low-input samples. Nat Methods. 2013;10(7):623-9. doi: 10.1038/nmeth.2483. PubMed PMID: 23685885; PubMed Central PMCID: PMCPMC3821180.2. Baldwin A, Morris AR, Mukherjee N. An Easy, Cost-Effective, and Scalable Method to Deplete Human Ribosomal RNA for RNA-seq. Curr Protoc. 2021;1(6):e176. Epub 2021/06/25. doi: 10.1002/cpz1.176. PubMed PMID: 34165268.3. Dudekula DB, Panda AC, Grammatikakis I, De S, Abdelmohsen K, Gorospe M. CircInteractome: A web tool for exploring circular RNAs and their interacting proteins and microRNAs. RNA biology. 2016;13(1):34-42. doi: 10.1080/15476286.2015.1128065. PubMed PMID: 26669964; PubMed Central PMCID: PMCPMC4829301.4. Zhong S, Wang J, Zhang Q, Xu H, Feng J. CircPrimer: a software for annotating circRNAs and determining the specificity of circRNA primers. BMC bioinformatics. 2018;19(1):292. doi: 10.1186/s12859-018-2304-1. PubMed PMID: 30075703.Submitted filename: Response to reviewers.pdfClick here for additional data file.5 Aug 2022Generation of full-length circular RNA libraries for Oxford Nanopore long-read sequencingPONE-D-22-06858R1Dear Dr. Fuchs,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Eduardo Andrés-LeónAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Does the manuscript report a protocol which is of utility to the research community and adds value to the published literature? Reviewer #1: YesReviewer #2: Yes********** 2. Has the protocol been described in sufficient detail?Descriptions of methods and reagents contained in the step-by-step protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample sizes and replication needed to ensure that the data are robust and reproducible. Reviewer #1: YesReviewer #2: Yes********** 3. Does the protocol describe a validated method?The manuscript must demonstrate that the protocol achieves its intended purpose: either by containing appropriate validation data, or referencing at least one original research article in which the protocol was used to generate data. Reviewer #1: YesReviewer #2: Yes********** 4. If the manuscript contains new data, have the authors made this data fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes**********
5. Is the article presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please highlight any specific errors that need correcting in the box below. Reviewer #1: YesReviewer #2: Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors have adressed my comments. They have expanded on the protocol, added more information regarding the method and also bioinformatics. They also have performed RT-qPCR validation. Please accept with or without changes.Reviewer #2: The authors addressed all of my points, I have no further questions. Congratulations on a very helpful protocol.********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Kotb AbdelmohsenReviewer #2: No**********26 Aug 2022PONE-D-22-06858R1Generation of full-length circular RNA libraries for Oxford Nanopore long-read sequencingDear Dr. Fuchs:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Eduardo Andrés-LeónAcademic EditorPLOS ONE