Manabu Taniguchi1, Misaki Iwahashi1, Yuichiro Oka1,2, Sheena Y X Tiong1,2,3, Makoto Sato1,2,4. 1. Department of Anatomy and Neuroscience, Graduate School of Medicine, Osaka University, Suita, Japan. 2. Molecular Brain Science, Division of Developmental Neuroscience, Department of Child Development, United Graduate School of Child Development (UGSCD), Osaka University, Suita, Japan. 3. Faculty of Science, Institute of Biological Sciences, University of Malaya, Kuala Lumpur, Malaysia. 4. Graduate School of Frontier Biosciences, Osaka University, Suita, Japan.
Abstract
The fork cell and von Economo neuron, which are found in the insular cortex and/or the anterior cingulate cortex, are defined by their unique morphologies. Their shapes are not pyramidal; the fork cell has two primary apical dendrites and the von Economo neurons are spindle-shaped (bipolar). Presence of such neurons are reported only in the higher animals, especially in human and great ape, indicating that they are specific for most evolved species. Although it is likely that these neurons are involved in higher brain function, lack of results with experimental animals makes further investigation difficult. We here ask whether equivalent neurons exist in the mouse insular cortex. In human, Fezf2 has been reported to be highly expressed in these morphologically distinctive neurons and thus, we examined the detailed morphology of Fezf2-positive neurons in the mouse brain. Although von Economo-like neurons were not identified, Fezf2-positive fork cell-like neurons with two characteristic apical dendrites, were discovered. Examination with electron microscope indicated that these neurons did not embrace capillaries, rather they held another cell. We here term such neurons as holding neurons. We further observed several molecules, including neuromedin B (NMB) and gastrin releasing peptide (GRP) that are known to be localized in the fork cells and/or von Economo cells in human, were localized in the mouse insular cortex. Based on these observations, it is likely that an equivalent of the fork cell is present in the mouse.
The fork cell and von Economo neuron, which are found in the insular cortex and/or the anterior cingulate cortex, are defined by their unique morphologies. Their shapes are not pyramidal; the fork cell has two primary apical dendrites and the von Economo neurons are spindle-shaped (bipolar). Presence of such neurons are reported only in the higher animals, especially in human and great ape, indicating that they are specific for most evolved species. Although it is likely that these neurons are involved in higher brain function, lack of results with experimental animals makes further investigation difficult. We here ask whether equivalent neurons exist in the mouse insular cortex. In human, Fezf2 has been reported to be highly expressed in these morphologically distinctive neurons and thus, we examined the detailed morphology of Fezf2-positive neurons in the mouse brain. Although von Economo-like neurons were not identified, Fezf2-positive fork cell-like neurons with two characteristic apical dendrites, were discovered. Examination with electron microscope indicated that these neurons did not embrace capillaries, rather they held another cell. We here term such neurons as holding neurons. We further observed several molecules, including neuromedin B (NMB) and gastrin releasing peptide (GRP) that are known to be localized in the fork cells and/or von Economo cells in human, were localized in the mouse insular cortex. Based on these observations, it is likely that an equivalent of the fork cell is present in the mouse.
The insular cortex (insula) is an integral brain hub that is reciprocally connected with the sensory, emotional, motivational and cognitive systems. It receives afferents from the dorsal thalamus and several sensory cortical areas, and projects to the frontal cortical areas and the subcortical brain regions, which include the nucleus accumbens and the caudate putamen that are implicated in motivation [1-5]. The insular cortex is segregated into three different areas: the granular, dysgranular and agranular insular cortices (abbreviated as GI, DI and AI, respectively), which differ in their cytoarchitectures. The GI has a classical six-layered structure, with a well-developed granular layer IV. In the DI, layer IV is thinner and layer V is more prominent than in the GI. Unlike the GI and DI, no obvious layer IV can be recognized in the AI, whereas layers II, III, V and VI are well developed [6-8]. The three main areas of the insular cortex are strongly interconnected along the dorso-ventral and rostro-caudal axes [9].A unique feature of the insular cortex in higher animals, such as human and great ape, is the presence of special cells in layer V, the von Economo neurons (VENs) and fork cells [10-13]. VENs had large spindle-shaped perikarya with a thick basal dendrite and an apical dendrite [13]. The fork cell was first reported as a distinct neuronal type in the human insular cortex [14] and it closely resembles the VEN, but has two apical dendrites instead of a single apical dendrite [11,12]. These types of neurons had been found in the anterior cingulate cortex and the insular cortex in mammalian phylogeny, especially in large-brained and social animals, including hominoid primates. Up to now, VENs have been identified in distantly related mammals such as cetaceans [15], perissodactyls [16] and elephants [17], as well as in humans, great apes and macaques [10,18,19]. However, it is generally assumed that such cells do not exist in rodents, the one most commonly used laboratory animal. If the analogous neurons exist in the experimental animal, it would present a unique platform to study these cell types in detail.Some VENs and fork cells are found to be positive for TDP‑43 aggregation at the earliest stages of sporadic behavioral variant of frontotemporal dementia (bvFTD), and VENs and fork cells are considered to be involved in bvFTD [20-22]. However, an immense lack of appropriate laboratory animals has notably impeded the progress of studies on VENs and fork cells. Neuronal circuits of the VENs and fork cells in human remain unknown and the biological identity of these neurons are unspecified.In the developing human neocortex, there exist higher animal-specific neurons, such as outer radial glia. Even though it is assumed that such cells are not present in laboratory animals, recent studies revealed that mice have prototypes of the progenitors in the cortex [23,24]. Therefore, we set out to explore the possibility that equivalents of VENs and/or fork cells exist in the mouse cortex.Although VENs and fork cells are defined based on their morphological features, data on the molecular characteristics of VENs and/or fork cells have been accumulating. In humans, there are several proteins that are selectively expressed in VENs [10,25-28]. Among these proteins, neuromedin B (NMB), gastrin releasing peptide (GRP) and Fezf2 showed the most intense staining in VENs.We asked whether these specific molecules for VENs and/or Fork cells were expressed in the mouse insular cortex. Interestingly, we found that some neurons in layer V of the insular cortex were positive for NMB, GRP or Fezf2. Moreover, A few Fezf2-positive neurons exhibited morphology representing that of fork cell-like neuron. This is the first study reporting the presence of fork cell-like neurons in the mouse insular cortex.
Materials and methods
Animals
ICR (SLC, MGI Cat# 5462094, RRID:MGI:5462094) mice were used. Fezf2-tdTomato mouse (STOCK Tg(Fezf2-tdTomato) SZ89Gsat/Mmucd, ID: 036540-UCD) was obtained from the Mutant Mouse Regional Resource Center, a NCRR-NIH funded strain repository, and was donated to the MMRRC by the NINDS funded GENSAT BAC transgenic project. The day of birth was designated as postnatal day 0 (P0). All experiments were conducted in compliance with the guidelines for the use of laboratory animals of Osaka University, and approved by Animal Research Committee of Osaka University. All possible efforts were made to minimize the number of animals used and their suffering.
Probe generation
cDNA fragments of NMB and GRP were PCR-amplified from mouse brain cDNA with the following primer pairs. NMB-fwd.: 5′ AAGCAAGATTCGAGTGCACC 3′; rev.: 5′ CAGCATCCGGTTTGTTCCAT 3′; GRP-fwd.: 5′ TGAATCCCCGTCCCTGTATG 3′; and rev.: 5′ GGTAGCAAATTGGAGCCCTG 3′. Amplified fragments were cloned into pGEM-T vector (Promega). In vitro transcription of cRNA probes was performed with T7 or SP6 RNA polymerase (Roche) and RNA DIG labeling mix (Roche) according to the manufacturer’s instructions using the template plasmids linearized with an appropriate restriction enzyme.
Tissue preparation
During all surgical procedures, animals were deeply anesthetized by intraperitoneal injection of a combination anesthetic (MMB: 0.3 mg/kg of medetomidine, 4.0 mg/kg of midazolam, and 5.0 mg/kg of butorphanol) and intracardially perfused with ice-cold phosphate buffered saline (PBS) followed by 4% paraformaldehyde (PFA) in PBS. Whole brains were carefully dissected out after perfusion and post-fixed in 4% PFA overnight at 4°C, then transferred to 30% sucrose solution (≥24 h or until brains sank to the bottom of the tube at 4°C). The whole brains were embedded in OCT compound. The tissue was then cryosectioned at 16 μm, mounted on SuperFrost microslide glasses, and stored at − 80°C. For electron microscopy, animals were transcardially perfused with ice-cold PBS followed by 0.05% glutaraldehyde and 4% paraformaldehyde in PBS. Brains were removed and post-fixed in the same fixative for 2h at 4°C, followed by immersion in 0.1 M PB overnight at 4°C. Brain sections of 40 μm thick were then cut by vibrating microtome and stored at 4°C.
Nissl staining
The sections were placed in 0.5% cresyl violet in water at RT for 5 min, then were briefly rinsed twice in 95% ethanol and dipped in 100% ethanol three times before being dehydrated in xylene three times for 5 min each. The sections were affixed to glass coverslips using Entellan new solution (Merck KGaA, Darmstadt, Germany) and examined under a light microscope.
in situ Hybridization Histochemistry (ISHH)
In situ hybridization was performed as described before [29] using cryosections (16 μm) prepared from wild-type ICR at P56 as mentioned above. The cryosections were air dried for 1 h and fixed in 4% PFA in PBS for 10 min at room temperature. The sections were then incubated in 0.2 M HCl for 10 min, followed by permeabilization with Proteinase K (7.9 μg/ml; Roche) digestion for 10 min at 37°C. Next, the sections were treated with acetic anhydride in 0.1 M triethanolamine for 10 min. The slides were rinsed with PBS in between each step. Finally, the sections were transferred to 5× saline sodium citrate (SSC) for 10 min or longer. Hybridization was carried out with the generated probes in the hybridization buffer (50% formamide, 5× SSC, 200 μg/ml yeast tRNA) overnight for at least 16 h at 55°C. High-stringency washes were carried out in the following steps: 5× SSC, 20 min at room temperature; 2× SSC, 20 min at 65°C; two washes with 0.2× SSC, 20 min at 65°C and lastly, the slides were transferred to PBS at room temperature. Detection of specific hybridization was performed using anti-Digoxigenin coupled with alkaline phosphatase (Roche), and subsequently visualized using nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP). Sense probes were used as negative controls and no signals were observed with the sense probes.
Immunohistochemistry (IHC)
Brain cryosections were prepared from Tg(Fezf2-tdTomato) mice (P56). After being air-dried for an hour at room temperature, the sections were treated in PBS. Sections were then blocked for 1 h with 5% BSA, 0.1% TritonX-100 in PBS, and then incubated overnight at 4°C with anti RFP (1:400; rabbit; MBL International, PM005, RRID: AB_591279). This was followed by incubation with donkey anti-rabbit IgG Alexa Fluor 568 (Thermo Fisher Scientific, Waltham, MA, USA) or biotinylated anti- rabbit IgG secondary antibody (Vector Laboratories Inc., Burlingame, CA) for 4–6 h at 4°C. All secondary antibodies were diluted at 1:500 in PBS. Fluorescence signals were imaged with a laser scanning confocal microscope (LSM5 PASCAL with Zeiss). For detection of biotinylated secondary antibody binding sites, sections were visualized using a Vectastain Elite ABC kit according to manufacturer’s manual (Vector Laboratories Inc., Burlingame, CA). After amplification with avidin-biotin complex from the Vectastain Elite ABC kit, reaction products were visualized with 0.05 M Tris-HCl buffer (TBS; pH 7.6) containing 0.05% diaminobenzidine tetrahydrochloride (DAB) and 0.01% hydrogen peroxide.
ISHH-IHC dual staining method
Shortly after the ISHH signal detection was completed, the sections were treated in PBS and then processed for Fezf2 IHC staining as described above.
Immunoelectron microscopy
Brain sections were prepared from Tg(Fezf2-tdTomato) mice (P56). IHC was performed according to staining procedure with diaminobenzidine (DAB) [30]. In brief, Tg(Fezf2-tdTomato) mice (P56) were transcardially perfused with ice-cold PBS followed by 0.05% glutaraldehyde and 4% paraformaldehyde in PBS. Brains were removed and post-fixed in the same fixative for 2h at 4°C, followed by immersion in 0.1 M PB overnight at 4°C. Brains sections of 40 μm thick were then cut by vibrating microtome. Immunohistochemistry was performed using free-floating sections according to the ABC method. The anti-RFP antibodies (1:400; rabbit; MBL International, PM005, RRID: AB_591279) were used at a dilution of 1:400 as a primary antibody. Biotinylated anti-rabbit IgG (Vectastain Elite) was used as a secondary antibody. Immunoreactivity was visualized with 0.05% diaminobenzidine and 0.01% hydrogen peroxide in 50 mM Tris, pH 7.6. Sections were washed several times in a 0.1 M phosphate buffer (pH 7.4) and immersed in 1% osmium tetroxide in 0.1 M PB for 1 hour on ice, followed by three rinses with distilled water. After the third rinse, the samples were stained with 0.5% uranyl acetate in distilled water overnight at 4°C. The samples were then dehydrated in increasing concentrations of ethanol (65%, 75%, 85%, 95% and 100%) at RT, with 5 min incubation time between ethanol changes. They were then dehydrated three times with anhydrous ethanol processed by molecular sieve and twice with propylene oxide at room temperature (RT), with 20 min incubation time. The samples were then replaced with a 1:1 solution of propylene oxide: epoxy resins overnight at RT. This mixture was thoroughly removed and they were flat-embedded in Epon 812. After polymerization, ultrathin sections were cut using a Reichert-Nissei Ultracut N microtome (Leica, Germany) and observed with a transmission electron microscope (H-7650, Hitachi, Tokyo, Japan) without counterstaining with uranyl acetate and lead citrate.
3D images
Confocal Z stack images were acquired using a Zeiss LSM 810 confocal microscope and Zen software (Carl Zeiss). These images were collected at 1024 × 1024 pixel resolution. For 3D rendering, images were collected at 8 bit with the optimal slice settings. Compiled software of Zeiss microscope was used for image analysis and 3D rendering.
The Allen Mouse Brain Atlas ISHH Data
Data from the Allen Mouse Brain Atlas (http://mouse.brain-map.org/) on male 56-day-old C57BL/6J mice were used for analyses in this study.
Results
Whereas VENs and fork cells are defined based on their morphologies, molecules that are expressed in VENs and/or fork cells endow such neurons with specific characteristics. Table 1 is the summary of recent reports on molecules that are expressed in VENs and/or fork cells.
Table 1
Reported human VEN and/or fork cell marker molecules
*expression in the insular cortex is reported.Italics indicate mRNA.We asked whether VENs and fork cells or their equivalents exist in the mouse brain based on the molecules that are expressed, in addition to the morphologies. Based on these reports in Table 1, we first studied the expression profiles of Fezf2 in the mouse insular cortex. Since tdTomato expression is driven by Fezf2 promoter in Fezf2-tdTomato mouse, Fezf2-tdTomato mouse allowed us to visualize whole cell morphology including axons and dendrites comparable to Golgi staining. We used Fezf2-tdTomato mouse for the identification of von Economo neurons and/or folk cells.
A few Fezf2-positive fork cell-like neurons were identified in the mouse insular cortex
Since a great majority of VENs are identified in layer V of the human insular cortex, we focused on this layer for further investigation. In order to study the detailed morphology of Fezf2-positive cells, we performed immunohistochemistry using antibody against RFP with frozen brain sections of Tg(Fezf2-tdTomato) mouse. In the mouse insular cortex, Fezf2-positive neurons were distributed widely in the rostral-caudal axis of layers V/VI, where most neurons were densely located in layer V (GI and DI) (Figs 1 and 2). Unexpectedly, a few Fezf2-positive neurons had two apical dendrites that resembled the morphological features of fork cells (Fig 2F). No VEN-like shaped (bipolar) cells were seen in the mouse insular cortex. In order to study further the detailed morphology of Fezf2-positive cells, we performed immunofluorescence for RFP. Signals for RFP were observed in neurons of layers V/VI, with the highest expression in layer V, which was similar with the results shown in Figs 1–3. We again identified a few fork cell-like neurons, which had two apical dendrites, in the mouse insular cortex (Fig 3D and 3E). In human frontoinsular cortex (FI), VENs are often found alongside fork cells characterized by a single large basal dendrite and a bifurcated apical dendrite [11,12]. However, no VEN was observed in the mouse insular cortex analyzed here.
Fig 1
Fezf2 was expressed in layer V/VI neurons of the mouse insular cortex.
Sections were numbered in rostral-caudal order. (a1)–(a8); Nissl staining. (b1)–(b8); adjacent tissue sections of (a1)–(a8). Fezf2 was expressed widely in rostral-caudal axis in layers V/VI. Fezf2 was visualized by immunohistochemistry against RFP in Tg(Fezf2-tdTomato) mice. Dotted lines indicate the borders of GI, DI and AI. Scale bar: 200 μm.
Fig 2
Fezf2-positive neuron exhibiting fork cell-like shape, having two apical dendrites in layer V neurons of the mouse insular cortex.
A (a), (b), are images taken from the same section Fig 1A4, and (c), (d), (e), (f) are images taken from the same section Fig 1B4. Fezf2 was expressed in layer Ⅴ and Ⅵ with most neurons being densely accumulated in layer V (GI and DI). (a), (b); Nissl staining. (c)—(f); Fezf2. (b), (d) are the higher magnification images of the squares in panels (a), (c), respectively. (e) is the higher magnification image of the square in panel (d). (f) is the enlarged image including the rounded rectangle in panel (e). A Fezf2-positive neuron exhibiting fork cell-like shape, having two apical dendrites, is indicated by an arrow. No VENs-like shaped (bipolar) cells were identified. Scale bars (a), (c): 500 μm, (b), (d): 200 μm, (e): 100 μm, (f): 50 μm.
Fig 3
A few Fezf2-positive neurons in the mouse insular cortex exhibited fork cell-like shape by immunofluorescence staining.
Immunofluorescence against RFP was performed to visualize Fezf2 signals with frozen brain sections of Tg(Fezf2-tdTomato) mouse. (a)—(c) Fezf2 was expressed in layer Ⅴ and Ⅵ. (b) High magnification image of the red squared box in (a). (d) A fork cell-like neuron indicated by the red arrow in (b), which had two apical dendrites. (e) A fork cell-like neuron indicated by the red arrow in (c). (f) A typical pyramidal neuron in (c). No VEN-like shaped (bipolar) cells were found in the mouse insular cortex. (g) A depicted image of neurons in (d) and (e). Scale bars (a), (c): 200 μm, (b): 100 μm, (d)—(g) 20 μm.
Fezf2 was expressed in layer V/VI neurons of the mouse insular cortex.
Sections were numbered in rostral-caudal order. (a1)–(a8); Nissl staining. (b1)–(b8); adjacent tissue sections of (a1)–(a8). Fezf2 was expressed widely in rostral-caudal axis in layers V/VI. Fezf2 was visualized by immunohistochemistry against RFP in Tg(Fezf2-tdTomato) mice. Dotted lines indicate the borders of GI, DI and AI. Scale bar: 200 μm.
Fezf2-positive neuron exhibiting fork cell-like shape, having two apical dendrites in layer V neurons of the mouse insular cortex.
A (a), (b), are images taken from the same section Fig 1A4, and (c), (d), (e), (f) are images taken from the same section Fig 1B4. Fezf2 was expressed in layer Ⅴ and Ⅵ with most neurons being densely accumulated in layer V (GI and DI). (a), (b); Nissl staining. (c)—(f); Fezf2. (b), (d) are the higher magnification images of the squares in panels (a), (c), respectively. (e) is the higher magnification image of the square in panel (d). (f) is the enlarged image including the rounded rectangle in panel (e). A Fezf2-positive neuron exhibiting fork cell-like shape, having two apical dendrites, is indicated by an arrow. No VENs-like shaped (bipolar) cells were identified. Scale bars (a), (c): 500 μm, (b), (d): 200 μm, (e): 100 μm, (f): 50 μm.
A few Fezf2-positive neurons in the mouse insular cortex exhibited fork cell-like shape by immunofluorescence staining.
Immunofluorescence against RFP was performed to visualize Fezf2 signals with frozen brain sections of Tg(Fezf2-tdTomato) mouse. (a)—(c) Fezf2 was expressed in layer Ⅴ and Ⅵ. (b) High magnification image of the red squared box in (a). (d) A fork cell-like neuron indicated by the red arrow in (b), which had two apical dendrites. (e) A fork cell-like neuron indicated by the red arrow in (c). (f) A typical pyramidal neuron in (c). No VEN-like shaped (bipolar) cells were found in the mouse insular cortex. (g) A depicted image of neurons in (d) and (e). Scale bars (a), (c): 200 μm, (b): 100 μm, (d)—(g) 20 μm.
An immunoelectron microscope established that fork cell-like neurons and/or enveloping cell-like neurons (holding neurons) were found in the mouse insular cortex
Next, to further investigate the fine structure of fork cell-like neurons that were observed in the mouse insular cortex, we employed the immunoperoxidase method for electron microscopy. Intense signals were detected in layers V/VI neurons, with the highest expression in layer V, which was similar with the results shown in Figs 1, 2 and 4. Immunoelectron microscopy established that the fork cell-like neurons that had two apical dendrites and a basal dendrite, based on their morphology, were found in the mouse insular cortex (Fig 4Ad). Typical fork cells with bifurcated apical dendrites are thoroughly described by von Angela Syring [33]. Some literature have defined the neuron that embraces a capillary or a neighboring cell as enveloping neuron [27]. In order to discuss precisely about the nature of such fork cell-like neurons, from now on, we here name a neuron that embraces a neighboring capillary an ‘enveloping neuron’, whereas one that holds a neighboring cell a ‘holding neuron’. We identified a few holding neurons in the mouse insular cortex (Fig 4Bc). The nuclear envelopes of the holding neurons had an irregular contour (Fig 4Bc and 4Bd). Electron microscopic analyses showed that the cells embraced by the holding neurons had an electron-lucent nucleus and non-condensed euchromatin (Fig 4Bc).
Fig 4
The ultrastructural analyses of fork cell-like neurons and holding neurons by immunoelectron microscopy.
IHC against RFP was performed to visualize Fezf2 signals with a brain section of Tg(Fezf2-tdTomato) mouse. A. A few Fezf2-positive neurons exhibited fork cell-like neurons that has two apical dendrites and a basal dendrite. (a) Fezf2 was expressed in layer Ⅴ and Ⅵ. (b) High magnification image of the black squared box in (a). (c) High magnification image of the black squared box in (b). A fork cell-like neuron is indicated by the black dotted squared box. (d) Electron microscopy image of the black dotted squared box in (c). The ultrastructure of a fork cell-like neuron, which had two apical dendrites and a basal dendrite were observed in the mouse insular cortex. Scale bars (a): 500 μm, (b): 200 μm, (c): 50 μm, (d) 2 μm. B. A few Fezf2-positive neurons in the mouse insular cortex exhibited enveloping cell-like shape. (a) Fezf2 was expressed in layer Ⅴ and Ⅵ (the black squared box). (b) High magnification image of the black squared box in (a). (c) Electron microscopy image of the black squared box in (b). A holding neuron (see text for further definition), which had two apical dendrites were found in the mouse insular cortex. A cell which was embraced by a holding neuron had weak electron density. (d) High magnification image of (c). The nuclear envelope, having an irregular contour is indicated by arrows. Scale bars (a): 500 μm, (b): 50 μm, (c): 2 μm, (d) 1 μm.
The ultrastructural analyses of fork cell-like neurons and holding neurons by immunoelectron microscopy.
IHC against RFP was performed to visualize Fezf2 signals with a brain section of Tg(Fezf2-tdTomato) mouse. A. A few Fezf2-positive neurons exhibited fork cell-like neurons that has two apical dendrites and a basal dendrite. (a) Fezf2 was expressed in layer Ⅴ and Ⅵ. (b) High magnification image of the black squared box in (a). (c) High magnification image of the black squared box in (b). A fork cell-like neuron is indicated by the black dotted squared box. (d) Electron microscopy image of the black dotted squared box in (c). The ultrastructure of a fork cell-like neuron, which had two apical dendrites and a basal dendrite were observed in the mouse insular cortex. Scale bars (a): 500 μm, (b): 200 μm, (c): 50 μm, (d) 2 μm. B. A few Fezf2-positive neurons in the mouse insular cortex exhibited enveloping cell-like shape. (a) Fezf2 was expressed in layer Ⅴ and Ⅵ (the black squared box). (b) High magnification image of the black squared box in (a). (c) Electron microscopy image of the black squared box in (b). A holding neuron (see text for further definition), which had two apical dendrites were found in the mouse insular cortex. A cell which was embraced by a holding neuron had weak electron density. (d) High magnification image of (c). The nuclear envelope, having an irregular contour is indicated by arrows. Scale bars (a): 500 μm, (b): 50 μm, (c): 2 μm, (d) 1 μm.Next, to consolidate our findings, we reconstructed 3D images of fork cell-like neurons that were observed in the mouse insular cortex. We processed Z-axis image stacks for reconstruction. Neurons that had two apical dendrites were clearly recognized (S1 Movie).
GRP and NMB were expressed differently in the mouse insular cortex
Next, since GRP and NMB are expressed in VENs and fork cells in human (Table 1), we studied the distribution of GRP- or NMB-expressing cells in three subregions: GI, DI and AI of the mouse insular cortex. GRP or NMB was expressed in different parts of the three aforementioned subregions. GRP was expressed widely in layer Ⅱ/Ⅲ and layer Ⅴ, with the highest expression in AI (Figs 5 and 6). Alternatively, NMB was scattered in the deep layers, layer Ⅴ and layer Ⅵ (GI, DI, and AI), with the highest expression in layer VI (Figs 5 and 7). Relatively strong NMB expression was also observed in the claustrum (Fig 5). Next, we investigated whether GRP and Fezf2 were co-expressed in some neurons of the mouse insular cortex. Once the ISHH signal detection against GRP was completed with frozen brain sections of Tg(Fezf2-tdTomato) mouse, we performed immunohistochemistry using antibody against RFP. As is shown in S2 Fig., GRP and Fezf2 were co-expressed in some neurons of the mouse insular cortex (S2C Fig).
Fig 5
GRP and NMB were expressed differently in the mouse insular cortex.
A-C. Distribution of GRP or NMB in the mouse insular cortex. Sections were numbered in rostral-caudal order. (a1)—(a10) are Nissl-stained adjacent tissue sections of (b1)—(b10) and (c1)—(c10). Gray arrowheads indicate GRP-expressing neurons. Red brown arrowheads indicate NMB-expressing neurons. Scale bar: 200 μm.
Fig 6
GRP was expressed widely in layer Ⅱ/Ⅲ and layer Ⅴ, with the highest expression in AI of the mouse insular cortex.
(a), (b). High-magnification image of the squared box in Fig 5Ba4 and 5Bb4. (b). GRP was expressed widely in layer Ⅱ/Ⅲ and layer Ⅴ. (a) and (b) are adjacent sections. Scale bar: 100 μm.
Fig 7
NMB was expressed in the deep layers, layer Ⅴ and layer Ⅵ (GI, DI, and AI), with the highest expression in layer VI neurons of the mouse insular cortex.
NMB expression was scattered in layer Ⅴ and Ⅵ, with the highest expression in layer VI. (d) and (e) are the higher magnification images of the rounded square boxes in (c) and (d). A square in Nissl stained (a) is shown as (b). (b) and (c) are adjacent sections. Scale bars (a): 500 μm, (b), (c): 200 μm, (d) 100 μm, (e): 50 μm.
GRP and NMB were expressed differently in the mouse insular cortex.
A-C. Distribution of GRP or NMB in the mouse insular cortex. Sections were numbered in rostral-caudal order. (a1)—(a10) are Nissl-stained adjacent tissue sections of (b1)—(b10) and (c1)—(c10). Gray arrowheads indicate GRP-expressing neurons. Red brown arrowheads indicate NMB-expressing neurons. Scale bar: 200 μm.
GRP was expressed widely in layer Ⅱ/Ⅲ and layer Ⅴ, with the highest expression in AI of the mouse insular cortex.
(a), (b). High-magnification image of the squared box in Fig 5Ba4 and 5Bb4. (b). GRP was expressed widely in layer Ⅱ/Ⅲ and layer Ⅴ. (a) and (b) are adjacent sections. Scale bar: 100 μm.
NMB was expressed in the deep layers, layer Ⅴ and layer Ⅵ (GI, DI, and AI), with the highest expression in layer VI neurons of the mouse insular cortex.
NMB expression was scattered in layer Ⅴ and Ⅵ, with the highest expression in layer VI. (d) and (e) are the higher magnification images of the rounded square boxes in (c) and (d). A square in Nissl stained (a) is shown as (b). (b) and (c) are adjacent sections. Scale bars (a): 500 μm, (b), (c): 200 μm, (d) 100 μm, (e): 50 μm.
Other molecular characteristics
Table 1 is the list of molecules that are reported to be expressed in VENs and/or fork cells in human insular cortex. We additionally examined distribution of these molecules with the Allen Brain Atlas mouse ISHH database. As in humans, ADRA1A is expressed in layers II, III and Ⅴ of the mouse insular cortex, although we did not identify any cells morphologically resembling VENs or fork cells. Expression of VMAT2 or GABRQ was not observed in the mouse cerebral cortex.
Discussion
The major findings of this study are: (1) discovery of fork cell-like neurons in the mouse insular cortex and (2) identification of NMB-, GRP- or Fezf2-positive neurons in layer V of the mouse insular cortex, which are the molecules that are known to be contained in human VENs and/or fork cells. It has been argued that VENs and/or fork cells do not exist in rodents [17]. On the other hand, Raghanti et al. reported that VENs and fork cells exist in cetaceans, artiodactyls, and perissodactyls with species-specific differences in distributions and cell densities [16]. This suggested that VENs and fork cells were not unique to highly encephalized or socially complex species. In this study, we found several Fezf2-positive neurons exhibiting fork cell-like shape, having two apical dendrites. In addition, although no neurons that morphologically resembled VEN were observed, some possessed NMB and/or GRP. Therefore, it is possible that equivalents of the fork cells are present in the mouse.Fezf2 is essential to the differentiation of layer V neurons that project to the striatum, superior colliculus, pons, and spinal cord [34,35]. It is reported that Fezf2 is a marker for the layer V projection neurons in the mouse motor cortex [34]. Earlier evidence of VENs are subcortically projecting neurons [10,19,36] has been further supported by recent findings that VENs preferentially express transcription factors, including Fezf2, which are characteristic of subcortical projection neurons [32]. Our study revealed Fezf2 was localized in certain population of neurons in deep layers of the mouse insula, with the highest expression in layer V. Therefore, it is likely that Fezf2-positive fork cell-like neurons in layer V of the mouse insular cortex are subcortically projecting neurons.We found that NMB and GRP were expressed differently in three subregions of the mouse insular cortex; NMB was present in a very restricted population of neurons in the deep layers of the insular cortex and the claustrum, but not in the medially adjacent putamen; whereas GRP was expressed mainly in layer Ⅱ/Ⅲ and layer Ⅴ of agranular regions in the mouse insular cortex. It is possible that NMB-positive neurons and GRP-positive neurons belong to different subpopulations in the mouse insular cortex.Recently Banovac et al. discussed that the identification of specialized cells such as VENs in non-primates should be done by demonstrating the dendritic and axonal morphology or by identifying specific markers or marker combinations that would enable the identification of VENs without relying solely on morphology [37]. We here provided the existent case. We found both NMB- and GRP-positive neurons in layer V of the mouse insular cortex, suggesting that some neurons in this area have the characteristics of VENs and/or fork cells, despite they are not identifiable as VENs and fork cells based on their morphologies. The potential of these mRNAs as VEN and/or fork cell marker should be further investigated.We defined ‘holding neurons’ here as those neurons that embrace other cells, but not capillaries. It is possible that the cells embraced by these holding neurons may contribute to new features through interactions by either the cell bodies and/or dendrites of holding neurons, yet further studies are required to clarify the characteristics and biological significance of these holding neurons.
The 3D images.
Some Fezf2-positive neurons in the mouse insular cortex exhibited fork cell-like shape. Immunofluorescence against RFP was performed to visualize Fezf2 signals with brain sections of Tg(Fezf2-tdTomato) mouse. (a) Fezf2 was expressed in layer Ⅴ and Ⅵ. (b) High-magnification image of a fork cell-like neuron indicated by the white arrow in the insular cortex of (a), which had two apical dendrites. Scale bars (a): 100 μm, (b) 10 μm.(TIF)Click here for additional data file.
GRP and Fezf2 were co-expressed in the mouse insular cortex.
(a) IHC for RFP was performed after in situ hybridization against GRP. Tg(Fezf2-tdTomato) mouse. Scale bar: 200 μm. (b) A high-magnification image of (a). Scale bar: 50 μm. (c) A high-magnification image of (b). The black arrow indicates a neuron co-expressing GRP and Fezf2. Scale bar: 25 μm.(TIF)Click here for additional data file.
An example of a Fezf2-positive neuron which exhibited fork cell-like shape.
See S1B Fig.(MP4)Click here for additional data file.11 Apr 2022
PONE-D-22-05313
Fezf2-positive Fork cell-like neurons in the mouse insular cortex
PLOS ONE
Dear Dr. Sato,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.ACADEMIC EDITOR: This academic editor think that, especially, more detailed morphological analysis is required as pointed out by Reviewer 2.Please submit your revised manuscript by May 26 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Masabumi Minami, Ph.D.Academic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: YesReviewer #2: Partly********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: N/A********** 3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: Yes********** 5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The study by Taniguchi et al. (MS# PONE-D-22-05313)tested the presence in the mouse insular cortex of an equivalent of the von Economo neuron and/or folk cell, which are reported in the insular cortex and anterior cingulate cortex of higher animals and possess characteristic dendritic morphology and molecular expression, such as Fezf2, neuromedin B, and gastrin-releasing peptide. To do this, authors examined the morphology of Fezf2-expressing neurons by the light and electron microscopic levels, and identified such neurons that have two characteristic apical dendrites and embrace neighboring different neurons. Moreover mRNAs for neuromedin B, and gastrin-releasing peptide were expressed in this brain region. Based on these findings, authors conclude that it is likely that neurons equivalent to folk cells are present in the mouse insular cortex.This paper is well organized and written, and experiments are appropriately executed. I raise one major comment only.Major1. At the regional level, authors showed the presence of neurons expressing Fezf2, neuromedin B mRNA, and gastrin-releasing peptide mRNA in the mouse insular cortex. However, it is still unclear whether or to which extents Fezf2-positve neurons express these peptides. This can be answered by combining ISH for these peptides with immunohistochemistry for Fezf2 (RFP), and should strengthen the conclusion of this study.Minor2. In method sections for Tissue Preparation, anesthetize mice were intracardially perfused by either 4% PFA or 0.05%GLA/4% PFA. If fresh frozen sections were used for ISH experiment, additional information on the preparation of fresh frozen section from anesthetized mice is necessary. Please confirm this point.3. Reported cell maker molecules for human von Economo neurons and/or folk cells are listed in Table 1. Based on this, authors selected Fezf2 to examine expression profiles in the mouse insular cortex. It is better to be explained why Fezf2 is selected from the listed molecules.Reviewer #2: The authors addressed von Ecomono neurons (VEN) and the folk cells (FC) whose existence in cerebral cortex are known specifically in human, great ape and some evolutionally higher animals. In this paper the authors demonstrated possible existence of the FC in rodent cerebral cortex as well, and attempted to compare molecular characteristics between human and mice.The major concern would be the morphologies they demonstrated are not fully convincing. Neurons in Figures 2f, 3e and 4c appears to have two apical processes, but how the authors exclude the possible existence of additional major process. Currently researchers are able to capture 3D morphology of cells by using the software such as Imaris or something comparable. Alternatively a sequential scanning EM, which provide 3D images of EM, would be available to show more precise primary dendritic arbor.Another concern is the significance of Fezf2 in mice FC. Previous paper by Tantirigama et al (2015) demonstrated very clear localization of Fezf2 using Fezf2-Gfp reporter mouse. They identified two distinct subtypes of Fezf2+ neurons in the matured cortex that resembled pyramidal tract projection neurons (PT-PNs) and intratelencephalic projection neurons (IT-PNs). This paper also demonstrated that Fezf2 positive neurons were widely localized in the layer 5 of various cortical regions from the motor to sensory. This would suggest that Fezf2 does not necessarily imply molecular or functional significances in FC.Another aim of this study, I guess, might be molecular characterization of the FC and VEN enquiring whether the molecular composition in FC is similar or not between human and mice. Human VENs and FC may contain NMB, GRP, Fezf2. However, all these molecules could show much wider localized in the brain. They concluded that the additional possible markers such as NMB, GRP, VMAT2, and GABRQ seem negative in FC, although they need more precise labeling indicating both the two apical processes and immunostaining simultaneously. If the authors found a specific combination of markers are useful for the identification of FC, it would be a good job.Other minor point:The authors used ICR strain of mice. Why do authors used this strain rather than C57BL6. This should be mentioned.As for the holding neurons, how many cells are examined with the EM. Do all the FC cells have this type of cells between the two proximal dendrites.?********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.18 Aug 2022Reviewer #1: We would like to thank Reviewer #1 for valuable comments on our manuscript. I have incorporated all of your suggestions into my revision. They were very helpful. Thank you for your help.Reviewer #2: We would like to thank Reviewer #2 for valuable comments on our manuscript. I have incorporated all of your suggestions into my revision. They were very helpful. Thank you very much.Submitted filename: Response to Reviewers.docxClick here for additional data file.24 Aug 2022Fezf2-positive Fork cell-like neurons in the mouse insular cortexPONE-D-22-05313R1Dear Dr. Sato,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Masabumi Minami, Ph.D.Academic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressedReviewer #2: All comments have been addressed********** 2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: YesReviewer #2: Yes********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: Yes********** 4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Now authors responded to my previous comments made to the original MS, with no more additional comments.Reviewer #2: (No Response)********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: No**********26 Aug 2022PONE-D-22-05313R1Fezf2-positive Fork cell-like neurons in the mouse insular cortexDear Dr. Sato:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Masabumi MinamiAcademic EditorPLOS ONE
Authors: William W Seeley; Florian T Merkle; Stephanie E Gaus; A D Bud Craig; John M Allman; Patrick R Hof; C V Economo Journal: Cereb Cortex Date: 2011-06-08 Impact factor: 5.357
Authors: Eun-Joo Kim; Manu Sidhu; Stephanie E Gaus; Eric J Huang; Patrick R Hof; Bruce L Miller; Stephen J DeArmond; William W Seeley Journal: Cereb Cortex Date: 2011-06-08 Impact factor: 5.357
Authors: Atiya Y Hakeem; Chet C Sherwood; Christopher J Bonar; Camilla Butti; Patrick R Hof; John M Allman Journal: Anat Rec (Hoboken) Date: 2009-02 Impact factor: 2.064