| Literature DB >> 36061427 |
Dongmei Lan1,2,3, Chao Yao1,2,3, Xue Li1,2,3, Haijiang Liu2,4, Dan Wang5,6, Yan Wang2,7, Shengcai Qi1,2,3.
Abstract
Oxidative stress can induce bone tissue damage and the occurrence of multiple diseases. As a type of traditional medicine, tocopherol has been reported to have a strong antioxidant effect and contributes to osteogenic differentiation. The purpose of this study was to investigate the protective effect of tocopherol on the oxidative stress of rat bone marrow-derived mesenchymal stem cells (BMSCs) and the underlying mechanisms. By establishing an oxidative stress model in vitro, the cell counting kit-8 (CCK-8), reactive oxygen species (ROS) analysis, Western blot (WB), real-time PCR (RT-PCR), alkaline phosphatase (ALP) staining, and Alizarin Red staining (ARS) evaluated the effects of tocopherol on the cell viability, intracellular ROS levels, and osteogenic differentiation in BMSCs. In addition, ferroptosis-related markers were examined via Western blot, RT-PCR, and Mito-FerroGreen. Eventually, the PI3K/AKT/mTOR signaling pathway was explored. We found that tocopherol significantly maintained the cell viability, reduced intracellular ROS levels, upregulated the levels of anti-oxidative genes, promoted the levels of osteogenic-related proteins, and the mRNA of BMSCs stimulated by H2O2. More importantly, tocopherol inhibited ferroptosis and upregulated the phosphorylation levels of PI3K, AKT, and mTOR of BMSCs upon H2O2 stimulation. In summary, tocopherol protected BMSCs from oxidative stress damage via the inhibition of ferroptosis through the PI3K/AKT/mTOR pathway.Entities:
Keywords: BMSCs; PI3K/Akt/mTOR pathway; ferroptosis; osteogenic differentiation; tocopherol
Year: 2022 PMID: 36061427 PMCID: PMC9428255 DOI: 10.3389/fbioe.2022.938520
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Nucleotide sequences of the primers used for RT -PCR.
| Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
|
| AACGTGGCCAAGAACATCATCA | TGTCCATCTCCAGCCGTGTC |
|
| CCATTTACGGAGACCCAC | TCTGAGCGGCAACTTTAT |
|
| TGAGGACCCTCTCTCTGCTC | GGGCTCCAAGTCCATTGTT |
|
| GCACCCAGCCCATAATAGA | TTGGAGCAAGGAGAACCC |
|
| GCGTCATTCACTTCGAGCAG | ATAGGGAATGTTTATTGGGCAATC |
|
| GAGCAAGGTCGCTTACAGA | CTCCCAGTTGATTACATTCC |
|
| GTCACTCAGGTGCGGACATTC | TCTTAGGCTTCTGGGAGTTGT |
|
| ATCTGAGTCCTTCACTG | GGGATACTGTTCATCAGAAA |
|
| CGATACGCCGAGTGTGGTTT | CGGCTGCAAACTCCTTGATT |
|
| TTCCAAACCAGCAGGCTCAT | CAGCGGATGCCAGTGATAGA |
|
| TCAGATTGTTACGGCCTCCC | GGTCACTCAGCTCACGATGT |
|
| CAGGGCTGCCTTCTCTTGT | TCCCGTTGATGACCAGCTTC |
FIGURE 1Assessment of the protection of different concentrations of tocopherol in H2O2-stimulated BMSCs. (A) Cell viability of H2O2-stimulated BMSCs after tocopherol (1–200 μM) treatment was detected by the CCK-8 assay. (B) Intracellular ROS measurement was measured by microscopy (scale bar = 100 μM). (C) Intracellular ROS measurement was measured by flow cytometry. (D–G) RT‐PCR analysis measured the ROS level of H2O2-stimulated BMSCs (*p < 0.05; **p < 0.01 vs. the H2O2 group).
FIGURE 2Effects of tocopherol on osteoblastic differentiation in H2O2-stimulated BMSCs. (A) BMSCs stained with ALP after 7 days of treatment (scale bar = 100 μM). (B) BMSCs stained with Alizarin Red after 14 days of treatment (scale bar = 100 μM). (C) Osteogenic-related protein expression of BMSCs was detected by Western blot after a treatment with H2O2 and tocopherol for 0 and 7 days. (D–E) Quantitative analysis of ALP and OPN.
FIGURE 3Effects of tocopherol on ferroptosis in H2O2-stimulated BMSCs. (A) GPX4, xCT, and ACSL4 protein levels in BMSCs were determined by Western blot. (B–D) Gpx4, Ptgs2, and Ncoa4 mRNA levels in BMSCs were determined by RT-PCR. (E) Confocal fluorescent microscope was used to detect the generation of ferroptosis by the Mito-FerroGreen analysis. (F–J) Adding the ferroptosis activator erastin (5 μM) combined with H2O2 and tocopherol, ferroptosis-related proteins (ACSL4, xCT, and GPX4) and mRNA (Gpx4, Nrf2, Ptgs2, and Ncoa4) expression levels were analyzed. (*p < 0.05; **p < 0.01 vs. H2O2 group).
FIGURE 4Effects of tocopherol on osteogenic differentiation in H2O2-stimulated ferroptosis. (A) ALP and RUNX2 protein levels were detected by Western blotting. (B–I) Alp, Opn, Ocn, and Runx2 mRNA levels were detected by RT-PCR. (J) Osteogenic differentiation was evaluated by ALP staining and Alizarin Red staining. (*p < 0.05; **p < 0.01 vs. H2O2 group).
FIGURE 5Exploration of the anti-oxidative stress mechanism of tocopherol. (A) Signaling pathways associated to oxidative stress were determined by Western blot. (B) Adding the ferroptosis inhibitor ferrostatin-1 (5 μM), PI3K/AKT/mTOR-related protein levels were determined by Western blot. (C) After treated with 2 μM 740-YP (a PI3K agonist), GPX4, xCT, and ACSL4 protein levels were determined by Western blot. (D–G) Nrf2, Gpx4, Ptgs2, and Ncoa4 mRNA levels were determined by RT-PCR. (*p < 0.05; **p < 0.01 vs. H2O2 group)
FIGURE 6Regulation of osteogenic differentiation by tocopherol through the PI3K/AKT/mTOR signaling pathways. ALP and Alizarin Red staining of 10 µM tocopherol-treated BMSCs at day 7 and day 14, with or without 2 uM 740-YP for activating the PI3K/AKT/mTOR signaling pathway. (scale bar = 100 μM).