| Literature DB >> 36060520 |
Manouchehr Ahmadi Hedayati1,2, Delniya Khani2, Farshad Sheikhesmaeili1, Bijan Nouri3.
Abstract
Background: ptk2 and mt2a genes contribute to the cell cycle during proliferation and apoptosis, respectively. Designing a case-control study including gastric adenocarcinoma and gastritis patients with and without Helicobacter pylori infection would lead to determinate of the correlations between ptk2 and mt2a genes expression with H. pylori infection in gastric antral epithelial cells.Entities:
Mesh:
Substances:
Year: 2022 PMID: 36060520 PMCID: PMC9436627 DOI: 10.1155/2022/8699408
Source DB: PubMed Journal: Can J Gastroenterol Hepatol ISSN: 2291-2789
Primers of H. pylori T4SS, 16s rDNA, and vacA in simple PCR.
| Specific primers | Sequence | Annealing Tm°C | Product size bp | Reference |
|---|---|---|---|---|
|
| CTGGAGAGACTAAGCCCTCC | 50 | 446 | This study |
|
| ||||
|
| TGACCAACAACCACAAACCG | 57 | 108 | This study |
|
| ||||
|
| AAGAAAGCAGGACAAGCAGC | 55 | 188 | This study |
|
| ||||
|
| AGGGTGTGGTGATGATAGCG | 55 | 154 | This study |
|
| ||||
|
| GAATGGAGCGAGCGATGAAA | 56 | 163 | This study |
|
| ||||
|
| AGTTCAAGTGGCGCTAGATTG | 57 | 200 | This study |
|
| ||||
|
| ATGGAAATACAACAAACACAC | 55 | 259/286 | Atherton et al. [ |
|
| ||||
|
| TGGATAGTGCGACTGGGTTT | 54 | 205/220 | This study |
The primers yield various fragments of vacA depending on the presence of a repetitive nucleotides sequence in some vacA alleles.
Primers of H. pylori adhesins and surface proteins.
| Specific primers | Sequence | Annealing Tm°C | Product size bp | Reference |
|---|---|---|---|---|
|
| GTGTTTTTAACCAAAGTATC | 45 | 247 | Van Doorn et al. [ |
|
| ||||
|
| GTTGGGTATATCACAATTTAT | 47 | 229/234 | Van Doorn et al. [ |
|
| ||||
|
| ACGAACGCGCAAAAACTTTA | 55 | 187 | Sicinschi et al. [ |
|
| ||||
|
| ACAGCCACTCCAATCCAGAA | 55 | 160 | Sicinschi et al. [ |
|
| ||||
|
| CAATGCGGTGCGTGAAAATC | 57 | 205 | This study |
|
| ||||
|
| CAATTCCCCGGCGTATCAAG | 56 | 175 | This study |
|
| ||||
|
| TCTCTCGCTTGCGGTATCAT | 56 | 204 | This study |
|
| ||||
|
| GCATTCAAACGGCGAACAAC | 56 | 248 | This study |
|
| ||||
|
| CGCTCCTATCAAAACCGCTC | 55 | 185 | This study |
|
| ||||
|
| TCAACTTGCGAGCAGACCTA | 57 | 218 | This study |
|
| ||||
|
| CTCCACGCTGAAAGGAATGG | 55 | 233 | This study |
Specific Primers of ptk2 and mt2a in Real-Time RT PCR.
| Specific primers | Sequence | Annealing Tm°C | Product size bp | Reference |
|---|---|---|---|---|
|
| GAAGGTGAAGGTCGGAGTCAAC | 60 | 71 | |
|
| GCACCCACCGAGAGATTGAG | 60 | 81 | [ |
|
| GCCCAGGGCTGCATCTG | 60 | 102 | [ |
Demographic data of patients.
| Gastritis | Gastric cancer | Total |
| |
|---|---|---|---|---|
|
| 23/27 | 11/19 | 34/46 | 0.487 |
| Sex (male/female) | 24/26 | 24/6 | 48/32 | 0.024 |
| Age group (18–30/31–45/46–60/61–85) | 10/18/17/5 | 0/0/7/23 | 10/18/24/28 | 0.005 |
The frequency of H. pylori infection among males and females in various age groups.
|
| Sex ( | Age group ( | ||||
|---|---|---|---|---|---|---|
| Male | Female | 18–30 | 31–45 | 46–60 | 61–85 | |
|
| 19 | 15 | 2 | 10 | 11 | 11 |
|
| 29 | 17 | 8 | 8 | 13 | 17 |
| Total | 48 | 32 | 10 | 18 | 24 | 28 |
Correlations between ptk2 and mt2a ΔCt and patients' demographic characters.
| Sex | Age group | Disease |
| Gastric cancer area | Tumor grade | |
|---|---|---|---|---|---|---|
|
| 0.080 | −0.334 | −0.379 | 0.042 | −0.107 | 0.345 |
|
| 0.146 | −0.055 | −0.104 | −0.049 | 0.041 | 0.257 |
Figure 1A simple scatter plot of ΔCt of the ptk2 gene depicts a reverse relationship with R2 linear 0.057. This means the ptk2 gene expression will increase along with increasing age.
Correlations between ptk2 and mt2a ΔCt and gene expression of H. pylori virulence genes in gastric antral epithelial cells of gastritis and gastric adenocarcinoma patients.
|
|
|
|
|
|
|
|
|
|
|
|
| |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| 0.320 | −0.216 | −0.156 | −0.082 | −0.238 | −0.390 | −0.215 | 0.192 | −0.192 | 0.186 | 0.152 | 0.519 |
|
| −0.256 | 0.292 | 0.304 | 0.009 | −0.378 | 0.289 | −0.367 | −0.388 | 0.040 | −0.093 | −0.348 | −0.293 |
The statistical relationships of ptk2 genes expression with H. pylori infection and its virulence genes expression using Mann–Whitney U test. Fold changes of ptk2 gene expression were calculated by using the average of ptk2 ΔCt in the case and control groups (P < 0.05).
|
| Mean rank |
|
| Mean ΔCt | Fold change | ||
|---|---|---|---|---|---|---|---|
| Disease | Adenocarcinoma | 30 | 29.20 | −3.371 | 0.001 | 5.4730 | 2.51 |
| Age group | 61–85 | 28 | 18.48 | −3.163 | 0.002 | 5.6203 | 4.32 |
|
|
| 17 | 12.4122.59 | −2.983 | 0.002 | 4.8719 | 7.66 |
|
| Positive | 5 | 8.3 | −2.239 | 0.023 | 4.3460 | 5.06 |
The statistical results of mt2a gene expression with H. pylori infection and its virulence genes expression using Mann–Whitney U test. Fold changes of mt2a gene expression were calculated by using the average of mt2a ΔCt in the case and control groups (P < 0.01).
|
| Mean rank |
|
| Mean ΔCt | Fold change | ||
|---|---|---|---|---|---|---|---|
|
| Negative | 17 3 | 9.08 | −1.876 | 0.061 | 5.3767 | 5.14 |
|
| |||||||
|
| Negative | 3 31 | 20.50 | −1.671 | 0.095 | 6.1300 | 2.71 |
|
| |||||||
|
|
| 13 21 | 9.40 | −1.815 | 0.068 | 4.1490 | 2.2 |